m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00735)
Target Name hsa-miR-589-5p
Gene Name hsa-miR-589-5p
miRBase ID
MIMAT0004799
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
hsa-miR-589-5p can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 up-regulated the expression of hsa-miR-589-5p and promoted the maturation of miR-589-5p. Overexpressed miR-589-5p and METTL3 promoted the viability, migration and invasion of liver cancer cells.
Target Regulation Up regulation
Responsed Disease Liver cancer ICD-11: 2C12
 Disease Info 
Pathway Response Adherens junction hsa04520
Cell Process Cell migration
Cell invasion
In-vitro Model THLE-2 Normal Homo sapiens CVCL_3803
SNU-423 Adult hepatocellular carcinoma Homo sapiens CVCL_0366
SNU-387 Adult hepatocellular carcinoma Homo sapiens CVCL_0250
SNU-182 Adult hepatocellular carcinoma Homo sapiens CVCL_0090
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
PLC/PRF/5 Adult hepatocellular carcinoma Homo sapiens CVCL_0485
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model The mice were fed in an SPF environment (cycle of 12-h light and 12-h dark) with a free diet. All the mice were adaptively fed for 5 days before experiments and randomly divided into the following four groups: the siNC+MC group (n = 10), the METTL3 siRNA1+MC group (n = 10), siNC+M group (n = 10) and the METTL3 siRNA1+M group (n = 10). Then, the right forelimb of mice in the siNC+MC group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with siNC and MC; the right forelimb of mice in the METTL3 siRNA1+MC group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with METTL3 siRNA1 and MC; the right forelimb of mice in the siNC+M group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with siNC and M; the right forelimb of mice in the METTL3 siRNA1+M group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with METTL3 siRNA1 and M.
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 up-regulated the expression of hsa-miR-589-5p and promoted the maturation of miR-589-5p. Overexpressed miR-589-5p and METTL3 promoted the viability, migration and invasion of liver cancer cells.
Responsed Disease Liver cancer [ICD-11: 2C12]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Adherens junction hsa04520
Cell Process Cell migration
Cell invasion
In-vitro Model THLE-2 Normal Homo sapiens CVCL_3803
SNU-423 Adult hepatocellular carcinoma Homo sapiens CVCL_0366
SNU-387 Adult hepatocellular carcinoma Homo sapiens CVCL_0250
SNU-182 Adult hepatocellular carcinoma Homo sapiens CVCL_0090
SK-HEP-1 Liver and intrahepatic bile duct epithelial neoplasm Homo sapiens CVCL_0525
PLC/PRF/5 Adult hepatocellular carcinoma Homo sapiens CVCL_0485
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model The mice were fed in an SPF environment (cycle of 12-h light and 12-h dark) with a free diet. All the mice were adaptively fed for 5 days before experiments and randomly divided into the following four groups: the siNC+MC group (n = 10), the METTL3 siRNA1+MC group (n = 10), siNC+M group (n = 10) and the METTL3 siRNA1+M group (n = 10). Then, the right forelimb of mice in the siNC+MC group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with siNC and MC; the right forelimb of mice in the METTL3 siRNA1+MC group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with METTL3 siRNA1 and MC; the right forelimb of mice in the siNC+M group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with siNC and M; the right forelimb of mice in the METTL3 siRNA1+M group was subcutaneously injected with 100 uL PBS containing 1 × 106 SK-Hep1 cells co-transfected with METTL3 siRNA1 and M.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05630
 Crosstalk Info 
Epigenetic Regulator hsa-miR-589-5p
Crosstalk relationship m6A → ncRNA
Disease Liver cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00735)
hsa-miR-589-5p
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001856 Click to Show/Hide the Full List
mod site chr7:5495891-5495892:- [2]
Sequence CCTGTGCCCAGCAGCCCCTGAGAACCACGTCTGCTCTGAGC
Transcript ID List ENST00000415009.5; MIMAT0004799; ENST00000458142.1; ENST00000385238.1; ENST00000382368.8; ENST00000453700.7; ENST00000620087.1
External Link RMBase: RNA-editing_site_120804
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE078511 Click to Show/Hide the Full List
mod site chr7:5495888-5495889:- [3]
Sequence GTGCCCAGCAGCCCCTGAGAACCACGTCTGCTCTGAGCTGG
Motif Score 2.930744048
Cell/Tissue List HeLa; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000458142.1; ENST00000620087.1; MIMAT0004799; ENST00000415009.5; ENST00000385238.1; ENST00000453700.7; ENST00000382368.8
External Link RMBase: m6A_site_747002