m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00731)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
UBXN1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Embryonic stem cells | Mus musculus |
|
Treatment: METTL3 knockout mESCs
Control: Wild type mESCs
|
GSE156481 | |
| Regulation |
![]() ![]() |
logFC: -9.05E-01 p-value: 4.00E-16 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Glioma | ICD-11: 2A00.0 | ||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| In-vitro Model | U87 (A primary glioblastoma cell line) | |||
| N33 (The GBM patient-derived cell line) | ||||
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| H4 | Astrocytoma | Homo sapiens | CVCL_1239 | |
| In-vivo Model | Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin. | |||
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Glioma | ICD-11: 2A00.0 | ||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| In-vitro Model | U87 (A primary glioblastoma cell line) | |||
| N33 (The GBM patient-derived cell line) | ||||
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| H4 | Astrocytoma | Homo sapiens | CVCL_1239 | |
| In-vivo Model | Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin. | |||
Brain cancer [ICD-11: 2A00]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification. | |||
| Responsed Disease | Glioma [ICD-11: 2A00.0] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| In-vitro Model | U87 (A primary glioblastoma cell line) | |||
| N33 (The GBM patient-derived cell line) | ||||
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| H4 | Astrocytoma | Homo sapiens | CVCL_1239 | |
| In-vivo Model | Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification. | |||
| Responsed Disease | Glioma [ICD-11: 2A00.0] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| In-vitro Model | U87 (A primary glioblastoma cell line) | |||
| N33 (The GBM patient-derived cell line) | ||||
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| H4 | Astrocytoma | Homo sapiens | CVCL_1239 | |
| In-vivo Model | Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03320 | ||
| Epigenetic Regulator | Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C) | |
| Regulated Target | Histone H3 lysine 9 monomethylation (H3K9me1) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Brain cancer | |
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03540 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 trimethylation (H3K27me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Brain cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00731)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000016 | Click to Show/Hide the Full List | ||
| mod site | chr11:62679094-62679095:- | [3] | |
| Sequence | GTGACCCAAACAGATCCGGCACTTCCGCTTCCCCTCGGCTT | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-MAP-seq | ||
| Transcript ID List | ENST00000436354.2; ENST00000616865.4 | ||
| External Link | RMBase: m1A_site_195 | ||
5-methylcytidine (m5C)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE005171 | Click to Show/Hide the Full List | ||
| mod site | chr11:62679024-62679025:- | ||
| Sequence | GAGCCGGGTGAGAGAGCGAGCGCCCGTCGGCGGGTGTCGAG | ||
| Cell/Tissue List | muscle | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000534176.1; ENST00000532904.5; ENST00000436354.2; ENST00000528907.5; ENST00000529640.5; ENST00000527421.5; ENST00000294119.6; ENST00000531056.5; ENST00000616865.4; ENST00000531625.1; ENST00000533476.5; ENST00000524762.5; ENST00000301935.9; ENST00000525717.5; ENST00000533908.5 | ||
| External Link | RMBase: m5C_site_7567 | ||
| mod ID: M5CSITE005172 | Click to Show/Hide the Full List | ||
| mod site | chr11:62679041-62679042:- | [4] | |
| Sequence | TGTTCCCGGCTGCTATAGAGCCGGGTGAGAGAGCGAGCGCC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000294119.6; ENST00000525717.5; ENST00000527421.5; ENST00000616865.4; ENST00000532904.5; ENST00000436354.2; ENST00000531625.1; ENST00000301935.9; ENST00000531056.5; ENST00000528907.5; ENST00000533908.5; ENST00000524762.5 | ||
| External Link | RMBase: m5C_site_7568 | ||
N6-methyladenosine (m6A)
| In total 31 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE006258 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676513-62676514:- | [5] | |
| Sequence | ATCTCCTTCCTAATAAATAGACCCTGAGTTCTGTACATGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000616865.4; ENST00000532904.5; ENST00000529640.5; ENST00000533000.5; ENST00000301935.9; ENST00000533476.5; ENST00000294119.6 | ||
| External Link | RMBase: m6A_site_144540 | ||
| mod ID: M6ASITE006259 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676535-62676536:- | [6] | |
| Sequence | TCATCTTTGATAAAGCACTGACATCTCCTTCCTAATAAATA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000294119.6; ENST00000301935.9; ENST00000532904.5; ENST00000533000.5; ENST00000616865.4; ENST00000529640.5; ENST00000525717.5; ENST00000533476.5 | ||
| External Link | RMBase: m6A_site_144541 | ||
| mod ID: M6ASITE006260 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676637-62676638:- | [5] | |
| Sequence | TGTTTTCTTCCATCTTCAGGACTCGTGCCTTCTGCTGTTCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | peripheral-blood; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000533000.5; ENST00000294119.6; ENST00000529640.5; ENST00000525717.5; ENST00000532904.5; ENST00000533476.5; ENST00000616865.4; ENST00000534176.1; ENST00000301935.9 | ||
| External Link | RMBase: m6A_site_144542 | ||
| mod ID: M6ASITE006261 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676682-62676683:- | [7] | |
| Sequence | CAGGAATTTTGGGAGCAAAAACCAAGTATCCTTGTGGTTCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000616865.4; ENST00000529640.5; ENST00000533476.5; ENST00000533000.5; ENST00000532904.5; ENST00000294119.6; ENST00000301935.9; ENST00000525717.5; ENST00000534176.1 | ||
| External Link | RMBase: m6A_site_144543 | ||
| mod ID: M6ASITE006262 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676716-62676717:- | [7] | |
| Sequence | AAAGAGAAGGGGCTTTGTGAACATGGTGCAAGGCCAGGAAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000534176.1; ENST00000532904.5; ENST00000529640.5; ENST00000533476.5; ENST00000301935.9; ENST00000616865.4; ENST00000294119.6; ENST00000533000.5; ENST00000525717.5 | ||
| External Link | RMBase: m6A_site_144544 | ||
| mod ID: M6ASITE006263 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676778-62676779:- | [8] | |
| Sequence | ACTAGAAACCAGGACTAGAAACTGGGGGAGTAGGGAGGCAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000294119.6; ENST00000616865.4; ENST00000301935.9; ENST00000532904.5; ENST00000533000.5; ENST00000529640.5; ENST00000525717.5; ENST00000534176.1; ENST00000533476.5 | ||
| External Link | RMBase: m6A_site_144545 | ||
| mod ID: M6ASITE006264 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676785-62676786:- | [8] | |
| Sequence | CTGCAAGACTAGAAACCAGGACTAGAAACTGGGGGAGTAGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000294119.6; ENST00000533000.5; ENST00000301935.9; ENST00000532904.5; ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000616865.4 | ||
| External Link | RMBase: m6A_site_144546 | ||
| mod ID: M6ASITE006265 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676791-62676792:- | [8] | |
| Sequence | GTATGGCTGCAAGACTAGAAACCAGGACTAGAAACTGGGGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000533000.5; ENST00000294119.6; ENST00000525717.5; ENST00000529640.5; ENST00000616865.4; ENST00000532904.5; ENST00000534176.1; ENST00000301935.9; ENST00000533476.5 | ||
| External Link | RMBase: m6A_site_144547 | ||
| mod ID: M6ASITE006266 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676798-62676799:- | [8] | |
| Sequence | GAGCTGGGTATGGCTGCAAGACTAGAAACCAGGACTAGAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000532904.5; ENST00000533000.5; ENST00000616865.4; ENST00000533476.5; ENST00000534176.1; ENST00000294119.6; ENST00000301935.9; ENST00000529640.5 | ||
| External Link | RMBase: m6A_site_144548 | ||
| mod ID: M6ASITE006267 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676838-62676839:- | [9] | |
| Sequence | ACGGGCCTTCTCAGAAGCTGACATGGAGCGGCCTCTGCAGG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000533000.5; ENST00000616865.4; ENST00000301935.9; ENST00000533476.5; ENST00000294119.6; ENST00000532904.5; ENST00000525717.5; ENST00000534176.1; ENST00000529640.5 | ||
| External Link | RMBase: m6A_site_144549 | ||
| mod ID: M6ASITE006268 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676889-62676890:- | [7] | |
| Sequence | GGAACTAGGTGGGGGCCAGGACCCTGTGCAATTGCTCAGTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000529640.5; ENST00000533476.5; ENST00000616865.4; ENST00000534176.1; ENST00000294119.6; ENST00000533000.5; ENST00000532904.5; ENST00000301935.9 | ||
| External Link | RMBase: m6A_site_144550 | ||
| mod ID: M6ASITE006269 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676906-62676907:- | [7] | |
| Sequence | GAGCTCCACCGTGGGGAGGAACTAGGTGGGGGCCAGGACCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000532904.5; ENST00000525004.5; ENST00000533000.5; ENST00000533476.5; ENST00000294119.6; ENST00000529640.5; ENST00000301935.9; ENST00000616865.4; ENST00000534176.1 | ||
| External Link | RMBase: m6A_site_144551 | ||
| mod ID: M6ASITE006270 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676954-62676955:- | [7] | |
| Sequence | CAGACGTTCCGGGCCCGGGAACAGCTGGCAGCTGTGAGGCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; peripheral-blood; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000529640.5; ENST00000525004.5; ENST00000532904.5; ENST00000616865.4; ENST00000301935.9; ENST00000534176.1; ENST00000294119.6; ENST00000533476.5; ENST00000533000.5 | ||
| External Link | RMBase: m6A_site_144552 | ||
| mod ID: M6ASITE006271 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676986-62676987:- | [7] | |
| Sequence | AGGTCAGGCTGCCAGATGGGACCTCACTGACCCAGACGTTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; peripheral-blood; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000529640.5; ENST00000533476.5; ENST00000533000.5; ENST00000525717.5; ENST00000532904.5; ENST00000525004.5; ENST00000534176.1; ENST00000616865.4; ENST00000524762.5; ENST00000294119.6; ENST00000527421.5; ENST00000301935.9 | ||
| External Link | RMBase: m6A_site_144553 | ||
| mod ID: M6ASITE006272 | Click to Show/Hide the Full List | ||
| mod site | chr11:62677484-62677485:- | [8] | |
| Sequence | ATTCTTATCTTCCTCTTGGGACCCCTTTGTTCCGTGTTAAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; U2OS; A549; Huh7; peripheral-blood; HEK293T; endometrial; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000532904.5; ENST00000616865.4; ENST00000525717.5; ENST00000529640.5; ENST00000534176.1; ENST00000527421.5; ENST00000524762.5; ENST00000294119.6; ENST00000533476.5; ENST00000301935.9; ENST00000533000.5; ENST00000525004.5 | ||
| External Link | RMBase: m6A_site_144554 | ||
| mod ID: M6ASITE006273 | Click to Show/Hide the Full List | ||
| mod site | chr11:62677802-62677803:- | [7] | |
| Sequence | TAGAGAAAAGATCGAGAGGGACAAAGCAGAGAGAGCCAAGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000533000.5; ENST00000529640.5; ENST00000301935.9; ENST00000527421.5; ENST00000526919.5; ENST00000294119.6; ENST00000525004.5; ENST00000534176.1; ENST00000524762.5; ENST00000616865.4; ENST00000525717.5; ENST00000532904.5; ENST00000533476.5 | ||
| External Link | RMBase: m6A_site_144555 | ||
| mod ID: M6ASITE006274 | Click to Show/Hide the Full List | ||
| mod site | chr11:62677831-62677832:- | [7] | |
| Sequence | TCTTCTTGTCTACATTTCAGACAAAGAGTTAGAGAAAAGAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000526919.5; ENST00000524762.5; ENST00000527421.5; ENST00000301935.9; ENST00000294119.6; ENST00000533908.5; ENST00000525004.5; ENST00000525717.5; ENST00000529640.5; ENST00000533000.5; ENST00000532904.5; ENST00000533476.5; ENST00000534176.1; ENST00000616865.4 | ||
| External Link | RMBase: m6A_site_144556 | ||
| mod ID: M6ASITE006275 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678030-62678031:- | [7] | |
| Sequence | CGGGAACGGCAGCGCAGGAGACAAGGGCAAGAGTTGTCAGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000534176.1; ENST00000525717.5; ENST00000528907.5; ENST00000533908.5; ENST00000301935.9; ENST00000532904.5; ENST00000294119.6; ENST00000616865.4; ENST00000533476.5; ENST00000527421.5; ENST00000526919.5; ENST00000524762.5; ENST00000525004.5; ENST00000529640.5 | ||
| External Link | RMBase: m6A_site_144557 | ||
| mod ID: M6ASITE006276 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678140-62678141:- | [7] | |
| Sequence | ACTCTGTCCATTTCTCTTGAACTGTTTTCCCTCGGCAACAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000526919.5; ENST00000525717.5; ENST00000531056.5; ENST00000524762.5; ENST00000529640.5; ENST00000616865.4; ENST00000533476.5; ENST00000532904.5; ENST00000533908.5; ENST00000527421.5; ENST00000525004.5; ENST00000294119.6; ENST00000528907.5; ENST00000534176.1; ENST00000301935.9 | ||
| External Link | RMBase: m6A_site_144558 | ||
| mod ID: M6ASITE006277 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678175-62678176:- | [7] | |
| Sequence | CCTAATTTTGTTTATTGTAAACTTTACACCTTCCCACTCTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; hNPCs; A549; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000531056.5; ENST00000301935.9; ENST00000524762.5; ENST00000526919.5; ENST00000294119.6; ENST00000525717.5; ENST00000525004.5; ENST00000528907.5; ENST00000527421.5; ENST00000529640.5; ENST00000533476.5; ENST00000616865.4; ENST00000533908.5; ENST00000534176.1; ENST00000532904.5 | ||
| External Link | RMBase: m6A_site_144559 | ||
| mod ID: M6ASITE006278 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678266-62678267:- | [10] | |
| Sequence | AGTACACGTCTGGTCAAAGAACCTTGACCTTTCCACATTTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000301935.9; ENST00000616865.4; ENST00000294119.6; ENST00000528907.5; ENST00000436354.2; ENST00000524762.5; ENST00000531056.5; ENST00000533476.5; ENST00000534176.1; ENST00000533908.5; ENST00000527421.5; ENST00000526919.5; ENST00000532904.5; ENST00000525717.5; ENST00000529640.5; ENST00000525004.5 | ||
| External Link | RMBase: m6A_site_144560 | ||
| mod ID: M6ASITE006279 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678349-62678350:- | [11] | |
| Sequence | AGTGAAGAGGAAAGACAGGAACAAACTAAGAGGTACAGTAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | CD34; HepG2; hESC-HEK293T; U2OS; hNPCs; A549; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000534176.1; ENST00000529640.5; ENST00000525004.5; ENST00000525717.5; ENST00000616865.4; ENST00000533476.5; ENST00000527421.5; ENST00000526919.5; ENST00000436354.2; ENST00000301935.9; ENST00000533908.5; ENST00000531056.5; ENST00000528907.5; ENST00000532904.5; ENST00000524762.5; ENST00000294119.6 | ||
| External Link | RMBase: m6A_site_144561 | ||
| mod ID: M6ASITE006280 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678355-62678356:- | [11] | |
| Sequence | GCTTTGAGTGAAGAGGAAAGACAGGAACAAACTAAGAGGTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; HepG2; U2OS; hNPCs; A549; Huh7; HEK293T; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000616865.4; ENST00000532904.5; ENST00000294119.6; ENST00000436354.2; ENST00000528907.5; ENST00000533476.5; ENST00000525004.5; ENST00000526919.5; ENST00000524762.5; ENST00000529640.5; ENST00000534176.1; ENST00000301935.9; ENST00000525717.5; ENST00000533908.5; ENST00000531056.5; ENST00000527421.5 | ||
| External Link | RMBase: m6A_site_144562 | ||
| mod ID: M6ASITE006281 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678379-62678380:- | [11] | |
| Sequence | TCTGCTGCCGGAGAAGGCAAACCCGCTTTGAGTGAAGAGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | CD34; HepG2; U2OS; hNPCs; A549; Huh7; HEK293T; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527421.5; ENST00000528907.5; ENST00000526919.5; ENST00000529640.5; ENST00000533908.5; ENST00000616865.4; ENST00000524762.5; ENST00000532904.5; ENST00000531056.5; ENST00000301935.9; ENST00000294119.6; ENST00000525004.5; ENST00000533476.5; ENST00000436354.2; ENST00000534176.1; ENST00000525717.5 | ||
| External Link | RMBase: m6A_site_144563 | ||
| mod ID: M6ASITE006282 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678543-62678544:- | [7] | |
| Sequence | CCTTTAGAGACTCCCCTTGGACATATCCTGGGACGGGAGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; hESC-HEK293T; MM6; Huh7; peripheral-blood; GSC-11; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000534176.1; ENST00000529640.5; ENST00000532904.5; ENST00000294119.6; ENST00000533476.5; ENST00000524762.5; ENST00000528907.5; ENST00000616865.4; ENST00000436354.2; ENST00000531056.5; ENST00000527421.5; ENST00000533908.5; ENST00000531625.1; ENST00000525717.5; ENST00000301935.9; ENST00000526919.5 | ||
| External Link | RMBase: m6A_site_144564 | ||
| mod ID: M6ASITE006283 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678554-62678555:- | [7] | |
| Sequence | ATGTGGACGAGCCTTTAGAGACTCCCCTTGGACATATCCTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000524762.5; ENST00000533476.5; ENST00000294119.6; ENST00000529640.5; ENST00000534176.1; ENST00000616865.4; ENST00000525717.5; ENST00000531625.1; ENST00000528907.5; ENST00000526919.5; ENST00000301935.9; ENST00000532904.5; ENST00000533908.5; ENST00000531056.5; ENST00000527421.5; ENST00000436354.2 | ||
| External Link | RMBase: m6A_site_144565 | ||
| mod ID: M6ASITE006284 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678692-62678693:- | [7] | |
| Sequence | GGGCATCGAGGCTGCGATGGACTGGTAAGCGCTCGTCCCGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000534176.1; ENST00000529640.5; ENST00000528907.5; ENST00000527421.5; ENST00000532904.5; ENST00000531056.5; ENST00000294119.6; ENST00000436354.2; ENST00000301935.9; ENST00000533476.5; ENST00000616865.4; ENST00000531625.1; ENST00000524762.5; ENST00000533908.5; ENST00000526919.5 | ||
| External Link | RMBase: m6A_site_144566 | ||
| mod ID: M6ASITE006285 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678716-62678717:- | [7] | |
| Sequence | GGCTCTGGCCCTCACAGGGAACCAGGGCATCGAGGCTGCGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000531056.5; ENST00000531625.1; ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000525717.5; ENST00000616865.4; ENST00000532904.5; ENST00000527421.5; ENST00000533908.5; ENST00000294119.6; ENST00000526919.5; ENST00000436354.2; ENST00000301935.9; ENST00000528907.5; ENST00000524762.5 | ||
| External Link | RMBase: m6A_site_144567 | ||
| mod ID: M6ASITE006286 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678817-62678818:- | [7] | |
| Sequence | GCGGGTGTGGGGGGTCGCGGACCTGTCTCGGCCTTTGCCCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000528907.5; ENST00000529640.5; ENST00000531625.1; ENST00000527421.5; ENST00000534176.1; ENST00000533476.5; ENST00000436354.2; ENST00000526919.5; ENST00000533908.5; ENST00000525717.5; ENST00000524762.5; ENST00000616865.4; ENST00000294119.6; ENST00000531056.5; ENST00000301935.9; ENST00000532904.5 | ||
| External Link | RMBase: m6A_site_144568 | ||
| mod ID: M6ASITE006287 | Click to Show/Hide the Full List | ||
| mod site | chr11:62678960-62678961:- | [12] | |
| Sequence | TTCCCGCCCTCCTTCTCGTCACACACCAGGTCCCCGCGGAA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000525717.5; ENST00000533908.5; ENST00000529640.5; ENST00000616865.4; ENST00000533476.5; ENST00000524762.5; ENST00000436354.2; ENST00000532904.5; ENST00000301935.9; ENST00000526919.5; ENST00000528907.5; ENST00000527421.5; ENST00000534176.1; ENST00000531056.5; ENST00000294119.6; ENST00000531625.1 | ||
| External Link | RMBase: m6A_site_144569 | ||
| mod ID: M6ASITE006288 | Click to Show/Hide the Full List | ||
| mod site | chr11:62679105-62679106:- | [7] | |
| Sequence | TCCGCCCCCACGTGACCCAAACAGATCCGGCACTTCCGCTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000616865.4 | ||
| External Link | RMBase: m6A_site_144570 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000324 | Click to Show/Hide the Full List | ||
| mod site | chr11:62676628-62676629:- | [13] | |
| Sequence | CCATCTTCAGGACTCGTGCCTTCTGCTGTTCTCATTGTGGC | ||
| Transcript ID List | ENST00000532904.5; ENST00000533476.5; ENST00000301935.9; ENST00000525717.5; ENST00000533000.5; ENST00000534176.1; ENST00000616865.4; ENST00000529640.5; ENST00000294119.6 | ||
| External Link | RMBase: Pseudo_site_889 | ||
References

