General Information of the m6A Target Gene (ID: M6ATAR00731)
Target Name UBX domain-containing protein 1 (UBXN1)
Synonyms
SAPK substrate protein 1; UBA/UBX 33.3 kDa protein
    Click to Show/Hide
Gene Name UBXN1
Chromosomal Location 11q12.3
Function
Ubiquitin-binding protein that plays a role in the modulation of innate immune response. Blocks both the RIG-I-like receptors (RLR) and NF-kappa-B pathways. Following viral infection, UBXN1 is induced and recruited to the RLR component MAVS. In turn, interferes with MAVS oligomerization, and disrupts the MAVS/TRAF3/TRAF6 signalosome. This function probably serves as a brake to prevent excessive RLR signaling . Interferes with the TNFalpha-triggered NF-kappa-B pathway by interacting with cellular inhibitors of apoptosis proteins (cIAPs) and thereby inhibiting their recruitment to TNFR1. Prevents also the activation of NF-kappa-B by associating with CUL1 and thus inhibiting NF-kappa-B inhibitor alpha/NFKBIA degradation that remains bound to NF-kappa-B. Interacts with the BRCA1-BARD1 heterodimer and regulates its activity. Specifically binds 'Lys-6'-linked polyubiquitin chains. Interaction with autoubiquitinated BRCA1 leads to the inhibition of the E3 ubiquitin-protein ligase activity of the BRCA1-BARD1 heterodimer. Component of a complex required to couple deglycosylation and proteasome-mediated degradation of misfolded proteins in the endoplasmic reticulum that are retrotranslocated in the cytosol.
    Click to Show/Hide
Gene ID 51035
Uniprot ID
UBXN1_HUMAN
HGNC ID
HGNC:18402
KEGG ID
hsa:51035
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
UBXN1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Embryonic stem cells Mus musculus
Treatment: METTL3 knockout mESCs
Control: Wild type mESCs
GSE156481
Regulation
logFC: -9.05E-01
p-value: 4.00E-16
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Target Regulation Down regulation
Responsed Disease Glioma ICD-11: 2A00.0
Pathway Response NF-kappa B signaling pathway hsa04064
In-vitro Model U87 (A primary glioblastoma cell line)
N33 (The GBM patient-derived cell line)
LN-229 Glioblastoma Homo sapiens CVCL_0393
H4 Astrocytoma Homo sapiens CVCL_1239
In-vivo Model Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
YTH domain-containing family protein 2 (YTHDF2) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Target Regulation Down regulation
Responsed Disease Glioma ICD-11: 2A00.0
Pathway Response NF-kappa B signaling pathway hsa04064
In-vitro Model U87 (A primary glioblastoma cell line)
N33 (The GBM patient-derived cell line)
LN-229 Glioblastoma Homo sapiens CVCL_0393
H4 Astrocytoma Homo sapiens CVCL_1239
In-vivo Model Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
Brain cancer [ICD-11: 2A00]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Responsed Disease Glioma [ICD-11: 2A00.0]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response NF-kappa B signaling pathway hsa04064
In-vitro Model U87 (A primary glioblastoma cell line)
N33 (The GBM patient-derived cell line)
LN-229 Glioblastoma Homo sapiens CVCL_0393
H4 Astrocytoma Homo sapiens CVCL_1239
In-vivo Model Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary YTHDF2 accelerated UBX domain-containing protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A, which, in turn, promoted NF-Kappa-B activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Responsed Disease Glioma [ICD-11: 2A00.0]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
Target Regulation Down regulation
Pathway Response NF-kappa B signaling pathway hsa04064
In-vitro Model U87 (A primary glioblastoma cell line)
N33 (The GBM patient-derived cell line)
LN-229 Glioblastoma Homo sapiens CVCL_0393
H4 Astrocytoma Homo sapiens CVCL_1239
In-vivo Model Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 105) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03320
Epigenetic Regulator Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target Histone H3 lysine 9 monomethylation (H3K9me1)
Crosstalk relationship Histone modification → m6A
Disease Brain cancer
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03540
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Brain cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00731)
UBX domain-containing protein 1 (UBXN1)
N1-methyladenosine (m1A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000016 Click to Show/Hide the Full List
mod site chr11:62679094-62679095:- [3]
Sequence GTGACCCAAACAGATCCGGCACTTCCGCTTCCCCTCGGCTT
Cell/Tissue List HEK293T
Seq Type List m1A-MAP-seq
Transcript ID List ENST00000436354.2; ENST00000616865.4
External Link RMBase: m1A_site_195
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005171 Click to Show/Hide the Full List
mod site chr11:62679024-62679025:-
Sequence GAGCCGGGTGAGAGAGCGAGCGCCCGTCGGCGGGTGTCGAG
Cell/Tissue List muscle
Seq Type List Bisulfite-seq
Transcript ID List ENST00000534176.1; ENST00000532904.5; ENST00000436354.2; ENST00000528907.5; ENST00000529640.5; ENST00000527421.5; ENST00000294119.6; ENST00000531056.5; ENST00000616865.4; ENST00000531625.1; ENST00000533476.5; ENST00000524762.5; ENST00000301935.9; ENST00000525717.5; ENST00000533908.5
External Link RMBase: m5C_site_7567
mod ID: M5CSITE005172 Click to Show/Hide the Full List
mod site chr11:62679041-62679042:- [4]
Sequence TGTTCCCGGCTGCTATAGAGCCGGGTGAGAGAGCGAGCGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000294119.6; ENST00000525717.5; ENST00000527421.5; ENST00000616865.4; ENST00000532904.5; ENST00000436354.2; ENST00000531625.1; ENST00000301935.9; ENST00000531056.5; ENST00000528907.5; ENST00000533908.5; ENST00000524762.5
External Link RMBase: m5C_site_7568
N6-methyladenosine (m6A)
In total 31 m6A sequence/site(s) in this target gene
mod ID: M6ASITE006258 Click to Show/Hide the Full List
mod site chr11:62676513-62676514:- [5]
Sequence ATCTCCTTCCTAATAAATAGACCCTGAGTTCTGTACATGCC
Motif Score 2.876744048
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000616865.4; ENST00000532904.5; ENST00000529640.5; ENST00000533000.5; ENST00000301935.9; ENST00000533476.5; ENST00000294119.6
External Link RMBase: m6A_site_144540
mod ID: M6ASITE006259 Click to Show/Hide the Full List
mod site chr11:62676535-62676536:- [6]
Sequence TCATCTTTGATAAAGCACTGACATCTCCTTCCTAATAAATA
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000294119.6; ENST00000301935.9; ENST00000532904.5; ENST00000533000.5; ENST00000616865.4; ENST00000529640.5; ENST00000525717.5; ENST00000533476.5
External Link RMBase: m6A_site_144541
mod ID: M6ASITE006260 Click to Show/Hide the Full List
mod site chr11:62676637-62676638:- [5]
Sequence TGTTTTCTTCCATCTTCAGGACTCGTGCCTTCTGCTGTTCT
Motif Score 4.065041667
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000533000.5; ENST00000294119.6; ENST00000529640.5; ENST00000525717.5; ENST00000532904.5; ENST00000533476.5; ENST00000616865.4; ENST00000534176.1; ENST00000301935.9
External Link RMBase: m6A_site_144542
mod ID: M6ASITE006261 Click to Show/Hide the Full List
mod site chr11:62676682-62676683:- [7]
Sequence CAGGAATTTTGGGAGCAAAAACCAAGTATCCTTGTGGTTCA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000616865.4; ENST00000529640.5; ENST00000533476.5; ENST00000533000.5; ENST00000532904.5; ENST00000294119.6; ENST00000301935.9; ENST00000525717.5; ENST00000534176.1
External Link RMBase: m6A_site_144543
mod ID: M6ASITE006262 Click to Show/Hide the Full List
mod site chr11:62676716-62676717:- [7]
Sequence AAAGAGAAGGGGCTTTGTGAACATGGTGCAAGGCCAGGAAT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000534176.1; ENST00000532904.5; ENST00000529640.5; ENST00000533476.5; ENST00000301935.9; ENST00000616865.4; ENST00000294119.6; ENST00000533000.5; ENST00000525717.5
External Link RMBase: m6A_site_144544
mod ID: M6ASITE006263 Click to Show/Hide the Full List
mod site chr11:62676778-62676779:- [8]
Sequence ACTAGAAACCAGGACTAGAAACTGGGGGAGTAGGGAGGCAT
Motif Score 2.627720238
Cell/Tissue List HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000294119.6; ENST00000616865.4; ENST00000301935.9; ENST00000532904.5; ENST00000533000.5; ENST00000529640.5; ENST00000525717.5; ENST00000534176.1; ENST00000533476.5
External Link RMBase: m6A_site_144545
mod ID: M6ASITE006264 Click to Show/Hide the Full List
mod site chr11:62676785-62676786:- [8]
Sequence CTGCAAGACTAGAAACCAGGACTAGAAACTGGGGGAGTAGG
Motif Score 4.065041667
Cell/Tissue List HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000525717.5; ENST00000294119.6; ENST00000533000.5; ENST00000301935.9; ENST00000532904.5; ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000616865.4
External Link RMBase: m6A_site_144546
mod ID: M6ASITE006265 Click to Show/Hide the Full List
mod site chr11:62676791-62676792:- [8]
Sequence GTATGGCTGCAAGACTAGAAACCAGGACTAGAAACTGGGGG
Motif Score 2.185083333
Cell/Tissue List HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000533000.5; ENST00000294119.6; ENST00000525717.5; ENST00000529640.5; ENST00000616865.4; ENST00000532904.5; ENST00000534176.1; ENST00000301935.9; ENST00000533476.5
External Link RMBase: m6A_site_144547
mod ID: M6ASITE006266 Click to Show/Hide the Full List
mod site chr11:62676798-62676799:- [8]
Sequence GAGCTGGGTATGGCTGCAAGACTAGAAACCAGGACTAGAAA
Motif Score 3.319380952
Cell/Tissue List HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000525717.5; ENST00000532904.5; ENST00000533000.5; ENST00000616865.4; ENST00000533476.5; ENST00000534176.1; ENST00000294119.6; ENST00000301935.9; ENST00000529640.5
External Link RMBase: m6A_site_144548
mod ID: M6ASITE006267 Click to Show/Hide the Full List
mod site chr11:62676838-62676839:- [9]
Sequence ACGGGCCTTCTCAGAAGCTGACATGGAGCGGCCTCTGCAGG
Motif Score 2.859755952
Cell/Tissue List brain; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000533000.5; ENST00000616865.4; ENST00000301935.9; ENST00000533476.5; ENST00000294119.6; ENST00000532904.5; ENST00000525717.5; ENST00000534176.1; ENST00000529640.5
External Link RMBase: m6A_site_144549
mod ID: M6ASITE006268 Click to Show/Hide the Full List
mod site chr11:62676889-62676890:- [7]
Sequence GGAACTAGGTGGGGGCCAGGACCCTGTGCAATTGCTCAGTG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000525717.5; ENST00000529640.5; ENST00000533476.5; ENST00000616865.4; ENST00000534176.1; ENST00000294119.6; ENST00000533000.5; ENST00000532904.5; ENST00000301935.9
External Link RMBase: m6A_site_144550
mod ID: M6ASITE006269 Click to Show/Hide the Full List
mod site chr11:62676906-62676907:- [7]
Sequence GAGCTCCACCGTGGGGAGGAACTAGGTGGGGGCCAGGACCC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000525717.5; ENST00000532904.5; ENST00000525004.5; ENST00000533000.5; ENST00000533476.5; ENST00000294119.6; ENST00000529640.5; ENST00000301935.9; ENST00000616865.4; ENST00000534176.1
External Link RMBase: m6A_site_144551
mod ID: M6ASITE006270 Click to Show/Hide the Full List
mod site chr11:62676954-62676955:- [7]
Sequence CAGACGTTCCGGGCCCGGGAACAGCTGGCAGCTGTGAGGCT
Motif Score 2.951386905
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000525717.5; ENST00000529640.5; ENST00000525004.5; ENST00000532904.5; ENST00000616865.4; ENST00000301935.9; ENST00000534176.1; ENST00000294119.6; ENST00000533476.5; ENST00000533000.5
External Link RMBase: m6A_site_144552
mod ID: M6ASITE006271 Click to Show/Hide the Full List
mod site chr11:62676986-62676987:- [7]
Sequence AGGTCAGGCTGCCAGATGGGACCTCACTGACCCAGACGTTC
Motif Score 3.622404762
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000529640.5; ENST00000533476.5; ENST00000533000.5; ENST00000525717.5; ENST00000532904.5; ENST00000525004.5; ENST00000534176.1; ENST00000616865.4; ENST00000524762.5; ENST00000294119.6; ENST00000527421.5; ENST00000301935.9
External Link RMBase: m6A_site_144553
mod ID: M6ASITE006272 Click to Show/Hide the Full List
mod site chr11:62677484-62677485:- [8]
Sequence ATTCTTATCTTCCTCTTGGGACCCCTTTGTTCCGTGTTAAG
Motif Score 3.622404762
Cell/Tissue List HepG2; U2OS; A549; Huh7; peripheral-blood; HEK293T; endometrial; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000532904.5; ENST00000616865.4; ENST00000525717.5; ENST00000529640.5; ENST00000534176.1; ENST00000527421.5; ENST00000524762.5; ENST00000294119.6; ENST00000533476.5; ENST00000301935.9; ENST00000533000.5; ENST00000525004.5
External Link RMBase: m6A_site_144554
mod ID: M6ASITE006273 Click to Show/Hide the Full List
mod site chr11:62677802-62677803:- [7]
Sequence TAGAGAAAAGATCGAGAGGGACAAAGCAGAGAGAGCCAAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000533000.5; ENST00000529640.5; ENST00000301935.9; ENST00000527421.5; ENST00000526919.5; ENST00000294119.6; ENST00000525004.5; ENST00000534176.1; ENST00000524762.5; ENST00000616865.4; ENST00000525717.5; ENST00000532904.5; ENST00000533476.5
External Link RMBase: m6A_site_144555
mod ID: M6ASITE006274 Click to Show/Hide the Full List
mod site chr11:62677831-62677832:- [7]
Sequence TCTTCTTGTCTACATTTCAGACAAAGAGTTAGAGAAAAGAT
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000526919.5; ENST00000524762.5; ENST00000527421.5; ENST00000301935.9; ENST00000294119.6; ENST00000533908.5; ENST00000525004.5; ENST00000525717.5; ENST00000529640.5; ENST00000533000.5; ENST00000532904.5; ENST00000533476.5; ENST00000534176.1; ENST00000616865.4
External Link RMBase: m6A_site_144556
mod ID: M6ASITE006275 Click to Show/Hide the Full List
mod site chr11:62678030-62678031:- [7]
Sequence CGGGAACGGCAGCGCAGGAGACAAGGGCAAGAGTTGTCAGC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000534176.1; ENST00000525717.5; ENST00000528907.5; ENST00000533908.5; ENST00000301935.9; ENST00000532904.5; ENST00000294119.6; ENST00000616865.4; ENST00000533476.5; ENST00000527421.5; ENST00000526919.5; ENST00000524762.5; ENST00000525004.5; ENST00000529640.5
External Link RMBase: m6A_site_144557
mod ID: M6ASITE006276 Click to Show/Hide the Full List
mod site chr11:62678140-62678141:- [7]
Sequence ACTCTGTCCATTTCTCTTGAACTGTTTTCCCTCGGCAACAC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000526919.5; ENST00000525717.5; ENST00000531056.5; ENST00000524762.5; ENST00000529640.5; ENST00000616865.4; ENST00000533476.5; ENST00000532904.5; ENST00000533908.5; ENST00000527421.5; ENST00000525004.5; ENST00000294119.6; ENST00000528907.5; ENST00000534176.1; ENST00000301935.9
External Link RMBase: m6A_site_144558
mod ID: M6ASITE006277 Click to Show/Hide the Full List
mod site chr11:62678175-62678176:- [7]
Sequence CCTAATTTTGTTTATTGTAAACTTTACACCTTCCCACTCTG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hNPCs; A549; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000531056.5; ENST00000301935.9; ENST00000524762.5; ENST00000526919.5; ENST00000294119.6; ENST00000525717.5; ENST00000525004.5; ENST00000528907.5; ENST00000527421.5; ENST00000529640.5; ENST00000533476.5; ENST00000616865.4; ENST00000533908.5; ENST00000534176.1; ENST00000532904.5
External Link RMBase: m6A_site_144559
mod ID: M6ASITE006278 Click to Show/Hide the Full List
mod site chr11:62678266-62678267:- [10]
Sequence AGTACACGTCTGGTCAAAGAACCTTGACCTTTCCACATTTC
Motif Score 2.930744048
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000301935.9; ENST00000616865.4; ENST00000294119.6; ENST00000528907.5; ENST00000436354.2; ENST00000524762.5; ENST00000531056.5; ENST00000533476.5; ENST00000534176.1; ENST00000533908.5; ENST00000527421.5; ENST00000526919.5; ENST00000532904.5; ENST00000525717.5; ENST00000529640.5; ENST00000525004.5
External Link RMBase: m6A_site_144560
mod ID: M6ASITE006279 Click to Show/Hide the Full List
mod site chr11:62678349-62678350:- [11]
Sequence AGTGAAGAGGAAAGACAGGAACAAACTAAGAGGTACAGTAA
Motif Score 2.951386905
Cell/Tissue List CD34; HepG2; hESC-HEK293T; U2OS; hNPCs; A549; Huh7; endometrial
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000534176.1; ENST00000529640.5; ENST00000525004.5; ENST00000525717.5; ENST00000616865.4; ENST00000533476.5; ENST00000527421.5; ENST00000526919.5; ENST00000436354.2; ENST00000301935.9; ENST00000533908.5; ENST00000531056.5; ENST00000528907.5; ENST00000532904.5; ENST00000524762.5; ENST00000294119.6
External Link RMBase: m6A_site_144561
mod ID: M6ASITE006280 Click to Show/Hide the Full List
mod site chr11:62678355-62678356:- [11]
Sequence GCTTTGAGTGAAGAGGAAAGACAGGAACAAACTAAGAGGTA
Motif Score 2.897386905
Cell/Tissue List CD34; HepG2; U2OS; hNPCs; A549; Huh7; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000616865.4; ENST00000532904.5; ENST00000294119.6; ENST00000436354.2; ENST00000528907.5; ENST00000533476.5; ENST00000525004.5; ENST00000526919.5; ENST00000524762.5; ENST00000529640.5; ENST00000534176.1; ENST00000301935.9; ENST00000525717.5; ENST00000533908.5; ENST00000531056.5; ENST00000527421.5
External Link RMBase: m6A_site_144562
mod ID: M6ASITE006281 Click to Show/Hide the Full List
mod site chr11:62678379-62678380:- [11]
Sequence TCTGCTGCCGGAGAAGGCAAACCCGCTTTGAGTGAAGAGGA
Motif Score 2.185083333
Cell/Tissue List CD34; HepG2; U2OS; hNPCs; A549; Huh7; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527421.5; ENST00000528907.5; ENST00000526919.5; ENST00000529640.5; ENST00000533908.5; ENST00000616865.4; ENST00000524762.5; ENST00000532904.5; ENST00000531056.5; ENST00000301935.9; ENST00000294119.6; ENST00000525004.5; ENST00000533476.5; ENST00000436354.2; ENST00000534176.1; ENST00000525717.5
External Link RMBase: m6A_site_144563
mod ID: M6ASITE006282 Click to Show/Hide the Full List
mod site chr11:62678543-62678544:- [7]
Sequence CCTTTAGAGACTCCCCTTGGACATATCCTGGGACGGGAGCC
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; hESC-HEK293T; MM6; Huh7; peripheral-blood; GSC-11; endometrial; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000534176.1; ENST00000529640.5; ENST00000532904.5; ENST00000294119.6; ENST00000533476.5; ENST00000524762.5; ENST00000528907.5; ENST00000616865.4; ENST00000436354.2; ENST00000531056.5; ENST00000527421.5; ENST00000533908.5; ENST00000531625.1; ENST00000525717.5; ENST00000301935.9; ENST00000526919.5
External Link RMBase: m6A_site_144564
mod ID: M6ASITE006283 Click to Show/Hide the Full List
mod site chr11:62678554-62678555:- [7]
Sequence ATGTGGACGAGCCTTTAGAGACTCCCCTTGGACATATCCTG
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524762.5; ENST00000533476.5; ENST00000294119.6; ENST00000529640.5; ENST00000534176.1; ENST00000616865.4; ENST00000525717.5; ENST00000531625.1; ENST00000528907.5; ENST00000526919.5; ENST00000301935.9; ENST00000532904.5; ENST00000533908.5; ENST00000531056.5; ENST00000527421.5; ENST00000436354.2
External Link RMBase: m6A_site_144565
mod ID: M6ASITE006284 Click to Show/Hide the Full List
mod site chr11:62678692-62678693:- [7]
Sequence GGGCATCGAGGCTGCGATGGACTGGTAAGCGCTCGTCCCGG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000525717.5; ENST00000534176.1; ENST00000529640.5; ENST00000528907.5; ENST00000527421.5; ENST00000532904.5; ENST00000531056.5; ENST00000294119.6; ENST00000436354.2; ENST00000301935.9; ENST00000533476.5; ENST00000616865.4; ENST00000531625.1; ENST00000524762.5; ENST00000533908.5; ENST00000526919.5
External Link RMBase: m6A_site_144566
mod ID: M6ASITE006285 Click to Show/Hide the Full List
mod site chr11:62678716-62678717:- [7]
Sequence GGCTCTGGCCCTCACAGGGAACCAGGGCATCGAGGCTGCGA
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000531056.5; ENST00000531625.1; ENST00000533476.5; ENST00000534176.1; ENST00000529640.5; ENST00000525717.5; ENST00000616865.4; ENST00000532904.5; ENST00000527421.5; ENST00000533908.5; ENST00000294119.6; ENST00000526919.5; ENST00000436354.2; ENST00000301935.9; ENST00000528907.5; ENST00000524762.5
External Link RMBase: m6A_site_144567
mod ID: M6ASITE006286 Click to Show/Hide the Full List
mod site chr11:62678817-62678818:- [7]
Sequence GCGGGTGTGGGGGGTCGCGGACCTGTCTCGGCCTTTGCCCC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; peripheral-blood; HEK293T; endometrial; NB4; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000528907.5; ENST00000529640.5; ENST00000531625.1; ENST00000527421.5; ENST00000534176.1; ENST00000533476.5; ENST00000436354.2; ENST00000526919.5; ENST00000533908.5; ENST00000525717.5; ENST00000524762.5; ENST00000616865.4; ENST00000294119.6; ENST00000531056.5; ENST00000301935.9; ENST00000532904.5
External Link RMBase: m6A_site_144568
mod ID: M6ASITE006287 Click to Show/Hide the Full List
mod site chr11:62678960-62678961:- [12]
Sequence TTCCCGCCCTCCTTCTCGTCACACACCAGGTCCCCGCGGAA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000525717.5; ENST00000533908.5; ENST00000529640.5; ENST00000616865.4; ENST00000533476.5; ENST00000524762.5; ENST00000436354.2; ENST00000532904.5; ENST00000301935.9; ENST00000526919.5; ENST00000528907.5; ENST00000527421.5; ENST00000534176.1; ENST00000531056.5; ENST00000294119.6; ENST00000531625.1
External Link RMBase: m6A_site_144569
mod ID: M6ASITE006288 Click to Show/Hide the Full List
mod site chr11:62679105-62679106:- [7]
Sequence TCCGCCCCCACGTGACCCAAACAGATCCGGCACTTCCGCTT
Motif Score 2.20572619
Cell/Tissue List HeLa; A549; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000616865.4
External Link RMBase: m6A_site_144570
Pseudouridine (Pseudo)
In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000324 Click to Show/Hide the Full List
mod site chr11:62676628-62676629:- [13]
Sequence CCATCTTCAGGACTCGTGCCTTCTGCTGTTCTCATTGTGGC
Transcript ID List ENST00000532904.5; ENST00000533476.5; ENST00000301935.9; ENST00000525717.5; ENST00000533000.5; ENST00000534176.1; ENST00000616865.4; ENST00000529640.5; ENST00000294119.6
External Link RMBase: Pseudo_site_889