m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00724)

Target Name	Wee1-like protein kinase (WEE1)
Synonyms	WEE1hu; Wee1A kinase Click to Show/Hide
Gene Name	WEE1
Chromosomal Location	11p15.4
Family	Protein kinase superfamily, Ser/Thr protein kinase family, WEE1 subfamily
Function	Acts as a negative regulator of entry into mitosis (G2 to M transition) by protecting the nucleus from cytoplasmically activated cyclin B1-complexed CDK1 before the onset of mitosis by mediating phosphorylation of CDK1 on 'Tyr-15'. Specifically phosphorylates and inactivates cyclin B1-complexed CDK1 reaching a maximum during G2 phase and a minimum as cells enter M phase. Phosphorylation of cyclin B1-CDK1 occurs exclusively on 'Tyr-15' and phosphorylation of monomeric CDK1 does not occur. Its activity increases during S and G2 phases and decreases at M phase when it is hyperphosphorylated. A correlated decrease in protein level occurs at M/G1 phase, probably due to its degradation. Click to Show/Hide
Gene ID	7465
Uniprot ID	WEE1_HUMAN
HGNC ID	HGNC:12761
KEGG ID	hsa:7465

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

WEE1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	KIAA1429 plays an oncogenic role in CRC cells by inhibiting the expression of Wee1-like protein kinase (WEE1) in an m6A-independent manner and is associated with poor survival in CRC patients.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer	ICD-11: 2B91	Disease Info

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	KIAA1429 plays an oncogenic role in CRC cells by inhibiting the expression of Wee1-like protein kinase (WEE1) in an m6A-independent manner and is associated with poor survival in CRC patients.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Protein virilizer homolog (VIRMA)	WRITER	Regulator Info
Target Regulation	Down regulation

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00724)

Wee1-like protein kinase (WEE1)

Adenosine-to-Inosine editing (A-to-I)

In total 9 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004532		Click to Show/Hide the Full List
mod site	chr11:9581914-9581915:+		[3]
Sequence	ATTCTGTGGCCCAGGCCGGAATGCAGTGGCACCATCTCCGC
Transcript ID List	ENST00000530175.5; ENST00000299613.10; ENST00000530712.5; ENST00000524612.5; ENST00000450114.7
External Link	RMBase: RNA-editing_site_20348
mod ID: A2ISITE004533		Click to Show/Hide the Full List
mod site	chr11:9583082-9583083:+		[4]
Sequence	CCCAGCACTCTGGCAGGCCAAGGCAGGCAGATCACGAGGCA
Transcript ID List	ENST00000530712.5; ENST00000299613.10; ENST00000524612.5; rmsk_3472916; ENST00000450114.7; ENST00000530175.5
External Link	RMBase: RNA-editing_site_20349
mod ID: A2ISITE004534		Click to Show/Hide the Full List
mod site	chr11:9584328-9584329:+		[3]
Sequence	TTTTTTCTTTTTCTTTTTGTAGAGACAGGGTCTCACTATCT
Transcript ID List	ENST00000530175.5; ENST00000530712.5; ENST00000524612.5; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: RNA-editing_site_20350
mod ID: A2ISITE004535		Click to Show/Hide the Full List
mod site	chr11:9584334-9584335:+		[3]
Sequence	CTTTTTCTTTTTGTAGAGACAGGGTCTCACTATCTTGCCCA
Transcript ID List	ENST00000530175.5; ENST00000524612.5; ENST00000450114.7; ENST00000530712.5; ENST00000299613.10
External Link	RMBase: RNA-editing_site_20351
mod ID: A2ISITE004536		Click to Show/Hide the Full List
mod site	chr11:9584913-9584914:+		[3]
Sequence	GTGAAACCCCGTCTCTACTAAAAATATAAAAGTTAGCTAGA
Transcript ID List	ENST00000450114.7; rmsk_3472923; ENST00000299613.10; ENST00000530712.5; ENST00000530175.5; ENST00000524612.5
External Link	RMBase: RNA-editing_site_20352
mod ID: A2ISITE004537		Click to Show/Hide the Full List
mod site	chr11:9584940-9584941:+		[3]
Sequence	AAAAGTTAGCTAGATGTGGCATGTGCCTGTAGTCCCAGCTA
Transcript ID List	ENST00000524612.5; ENST00000299613.10; ENST00000450114.7; ENST00000530175.5; ENST00000530712.5; rmsk_3472923
External Link	RMBase: RNA-editing_site_20353
mod ID: A2ISITE004538		Click to Show/Hide the Full List
mod site	chr11:9584964-9584965:+		[3]
Sequence	GCCTGTAGTCCCAGCTACTCAGGAGGTTGAATGAAGCATGA
Transcript ID List	ENST00000299613.10; ENST00000530175.5; ENST00000524612.5; ENST00000450114.7; ENST00000530712.5; rmsk_3472923
External Link	RMBase: RNA-editing_site_20354
mod ID: A2ISITE004539		Click to Show/Hide the Full List
mod site	chr11:9585014-9585015:+		[3]
Sequence	GAACCTTGTTGCAGTGAGCCAAGATCATGCCACTGCACTCC
Transcript ID List	ENST00000524612.5; ENST00000450114.7; ENST00000299613.10; ENST00000530175.5; ENST00000530712.5; rmsk_3472923
External Link	RMBase: RNA-editing_site_20355
mod ID: A2ISITE004540		Click to Show/Hide the Full List
mod site	chr11:9585015-9585016:+		[3]
Sequence	AACCTTGTTGCAGTGAGCCAAGATCATGCCACTGCACTCCA
Transcript ID List	ENST00000530175.5; ENST00000299613.10; ENST00000450114.7; ENST00000524612.5; rmsk_3472923; ENST00000530712.5
External Link	RMBase: RNA-editing_site_20356

5-methylcytidine (m5C)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005059		Click to Show/Hide the Full List
mod site	chr11:9574218-9574219:+		[5]
Sequence	TGGAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m5C_site_6949
mod ID: M5CSITE005060		Click to Show/Hide the Full List
mod site	chr11:9574219-9574220:+		[5]
Sequence	GGAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m5C_site_6950
mod ID: M5CSITE005061		Click to Show/Hide the Full List
mod site	chr11:9574220-9574221:+		[5]
Sequence	GAGGAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGGA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m5C_site_6951
mod ID: M5CSITE005062		Click to Show/Hide the Full List
mod site	chr11:9574223-9574224:+		[5]
Sequence	GAGGACCTGTTGCTGCCCGGCGCCTGCCCGGGCGCGGACGA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m5C_site_6952

N6-methyladenosine (m6A)

In total 70 m6A sequence/site(s) in this target gene
mod ID: M6ASITE003704		Click to Show/Hide the Full List
mod site	chr11:9573678-9573679:+		[6]
Sequence	CGGGAAGCCGCGGAGCCCGAACCTGAGACTGGACCTGAGGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; GSC-11; HEK293T; HEK293A-TOA; MSC; iSLK; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130905
mod ID: M6ASITE003705		Click to Show/Hide the Full List
mod site	chr11:9573685-9573686:+		[6]
Sequence	CCGCGGAGCCCGAACCTGAGACTGGACCTGAGGAGACCTCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; GSC-11; HEK293T; HEK293A-TOA; MSC; iSLK; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130906
mod ID: M6ASITE003706		Click to Show/Hide the Full List
mod site	chr11:9573690-9573691:+		[6]
Sequence	GAGCCCGAACCTGAGACTGGACCTGAGGAGACCTCAGCCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; GSC-11; HEK293T; HEK293A-TOA; MSC; iSLK; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130907
mod ID: M6ASITE003707		Click to Show/Hide the Full List
mod site	chr11:9573700-9573701:+		[6]
Sequence	CTGAGACTGGACCTGAGGAGACCTCAGCCTCGGTGCTCGGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; GSC-11; HEK293T; HEK293A-TOA; MSC; iSLK; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130908
mod ID: M6ASITE003708		Click to Show/Hide the Full List
mod site	chr11:9573855-9573856:+		[6]
Sequence	CGCCCAGCCGCACGTGGCGGACCCGCCCCCAGGCCCGCAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; U2OS; MT4; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130909
mod ID: M6ASITE003709		Click to Show/Hide the Full List
mod site	chr11:9573883-9573884:+		[6]
Sequence	CCAGGCCCGCAGTGTCCTGGACCCCGCAGGCCTCCGCTCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; U2OS; MT4; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130910
mod ID: M6ASITE003710		Click to Show/Hide the Full List
mod site	chr11:9574087-9574088:+		[6]
Sequence	CGGCCACAGCACCGGGGAGGACTCGGCCTTTCAAGAGCCCG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; MT4; MM6; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130911
mod ID: M6ASITE003711		Click to Show/Hide the Full List
mod site	chr11:9574207-9574208:+		[6]
Sequence	CCCCGGCGAGCTGGAGGAGGACCTGTTGCTGCCCGGCGCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; TREX; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130912
mod ID: M6ASITE003712		Click to Show/Hide the Full List
mod site	chr11:9574438-9574439:+		[6]
Sequence	CCGCCGCTCGCCGCGGCCGGACCACCCGGGCACCCCGCCAC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; U2OS; Jurkat; GSC-11; HEK293T; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130913
mod ID: M6ASITE003713		Click to Show/Hide the Full List
mod site	chr11:9574464-9574465:+		[6]
Sequence	CGGGCACCCCGCCACACAAGACCTTCCGCAAGCTGCGACTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; GSC-11; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130914
mod ID: M6ASITE003714		Click to Show/Hide the Full List
mod site	chr11:9574498-9574499:+		[7]
Sequence	GCGACTCTTCGACACCCCGCACACGCCCAAGGTGAGAGCGG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000450114.7
External Link	RMBase: m6A_site_130915
mod ID: M6ASITE003715		Click to Show/Hide the Full List
mod site	chr11:9574696-9574697:+		[6]
Sequence	CGTTGAGATTATGTAACTGAACAATGGGCCTCGTCTGGAAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130916
mod ID: M6ASITE003716		Click to Show/Hide the Full List
mod site	chr11:9574715-9574716:+		[6]
Sequence	AACAATGGGCCTCGTCTGGAACTTCATCTTACAAAGGGGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130917
mod ID: M6ASITE003717		Click to Show/Hide the Full List
mod site	chr11:9575022-9575023:+		[6]
Sequence	GGTCTGGGGCATGCAGGGAGACTACGCTTGGACTTGGGAGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HEK293A-TOA; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130918
mod ID: M6ASITE003718		Click to Show/Hide the Full List
mod site	chr11:9575033-9575034:+		[6]
Sequence	TGCAGGGAGACTACGCTTGGACTTGGGAGTAAAGGCTGGCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; HEK293A-TOA; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130919
mod ID: M6ASITE003719		Click to Show/Hide the Full List
mod site	chr11:9575078-9575079:+		[6]
Sequence	AAGCATTTACAGTCCTACAGACTCATCCTAAGTCCAGGCAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130920
mod ID: M6ASITE003720		Click to Show/Hide the Full List
mod site	chr11:9575118-9575119:+		[6]
Sequence	GTACTGAGGCCTGTTTCTGGACAAGGTCTTGGCCCAGCATT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130921
mod ID: M6ASITE003721		Click to Show/Hide the Full List
mod site	chr11:9575196-9575197:+		[6]
Sequence	CGGCCTCCGTGTGATTAGGAACATCCTACCGTAGATAAGGT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130922
mod ID: M6ASITE003722		Click to Show/Hide the Full List
mod site	chr11:9575291-9575292:+		[6]
Sequence	CGCAGATGACCACTTTTAAAACTGCAGATTTTAAAGCTGAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130923
mod ID: M6ASITE003723		Click to Show/Hide the Full List
mod site	chr11:9575328-9575329:+		[6]
Sequence	TGATACTTCCAGAGATTAAGACAAGCCTCGCATTTGTAAGG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130924
mod ID: M6ASITE003724		Click to Show/Hide the Full List
mod site	chr11:9575564-9575565:+		[6]
Sequence	AGATTTTATGGGGCTCTCGGACTGCTTTCTATTTTTGGATG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10; ENST00000524549.1
External Link	RMBase: m6A_site_130925
mod ID: M6ASITE003725		Click to Show/Hide the Full List
mod site	chr11:9575623-9575624:+		[6]
Sequence	ACTTTTAGCCACTAGAATGAACTTAGTTTTAGGCAGCATTT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7; ENST00000524549.1
External Link	RMBase: m6A_site_130926
mod ID: M6ASITE003726		Click to Show/Hide the Full List
mod site	chr11:9575845-9575846:+		[6]
Sequence	TTGAGAAGGCTGACTATAGGACTTGGATCCTAAAAATTGTA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000450114.7; ENST00000524549.1; ENST00000299613.10
External Link	RMBase: m6A_site_130927
mod ID: M6ASITE003727		Click to Show/Hide the Full List
mod site	chr11:9575931-9575932:+		[6]
Sequence	ATTGATTCCAGCTCTGTTAAACTCCGGGGTAGTTCTCTCTT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7; ENST00000524549.1
External Link	RMBase: m6A_site_130928
mod ID: M6ASITE003728		Click to Show/Hide the Full List
mod site	chr11:9575998-9575999:+		[6]
Sequence	GGGAATTTGATGTGCGACAGACTCCTCAAGTGAATATTAAT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7; ENST00000524549.1
External Link	RMBase: m6A_site_130929
mod ID: M6ASITE003729		Click to Show/Hide the Full List
mod site	chr11:9576057-9576058:+		[6]
Sequence	TTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000524549.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130930
mod ID: M6ASITE003730		Click to Show/Hide the Full List
mod site	chr11:9576243-9576244:+		[6]
Sequence	TTTTAGTTCCTGTGGTGAAGACATGGAAGCCAGTGATTATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10; ENST00000524549.1; rmsk_3472903
External Link	RMBase: m6A_site_130931
mod ID: M6ASITE003731		Click to Show/Hide the Full List
mod site	chr11:9576278-9576279:+		[6]
Sequence	ATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGGTAAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; rmsk_3472903; ENST00000524549.1; ENST00000450114.7
External Link	RMBase: m6A_site_130932
mod ID: M6ASITE003732		Click to Show/Hide the Full List
mod site	chr11:9576283-9576284:+		[6]
Sequence	GAGCTTGAAGATGAAACAAGACCTGCTAAGGTAAATAGCTT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000524549.1; ENST00000450114.7; rmsk_3472903; ENST00000299613.10
External Link	RMBase: m6A_site_130933
mod ID: M6ASITE003733		Click to Show/Hide the Full List
mod site	chr11:9577183-9577184:+		[6]
Sequence	TATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000524549.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130934
mod ID: M6ASITE003734		Click to Show/Hide the Full List
mod site	chr11:9577304-9577305:+		[6]
Sequence	TTGTGAGCTTGAGAAAATGAACATCGAGGAAATATTTATGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000450114.7; ENST00000524549.1; ENST00000299613.10
External Link	RMBase: m6A_site_130935
mod ID: M6ASITE003735		Click to Show/Hide the Full List
mod site	chr11:9581561-9581562:+		[6]
Sequence	AGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000524612.5; ENST00000530175.5; ENST00000450114.7; ENST00000299613.10; ENST00000530712.5
External Link	RMBase: m6A_site_130936
mod ID: M6ASITE003736		Click to Show/Hide the Full List
mod site	chr11:9581660-9581661:+		[8]
Sequence	TCATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTA
Motif Score	2.047297619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000530712.5; ENST00000450114.7; ENST00000299613.10; ENST00000530175.5; ENST00000524612.5
External Link	RMBase: m6A_site_130937
mod ID: M6ASITE003737		Click to Show/Hide the Full List
mod site	chr11:9581673-9581674:+		[6]
Sequence	TTGGTTCACATGGATATAAAACCTAGTAAGTATTGCAGATC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000530175.5; ENST00000530712.5; ENST00000524612.5; ENST00000450114.7
External Link	RMBase: m6A_site_130938
mod ID: M6ASITE003738		Click to Show/Hide the Full List
mod site	chr11:9585206-9585207:+		[6]
Sequence	GTATATGATCTTGTTTATGAACTCTGGTTTTATTATTATTA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000530712.5; ENST00000530175.5; ENST00000450114.7; ENST00000299613.10; ENST00000524612.5; ENST00000532275.1
External Link	RMBase: m6A_site_130939
mod ID: M6ASITE003739		Click to Show/Hide the Full List
mod site	chr11:9585277-9585278:+		[6]
Sequence	GTAATATTTTCATATCTCGAACCTCAATCCCAAATGCTGCC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000532275.1; ENST00000299613.10; ENST00000530712.5; ENST00000524612.5; ENST00000450114.7; ENST00000530175.5
External Link	RMBase: m6A_site_130940
mod ID: M6ASITE003740		Click to Show/Hide the Full List
mod site	chr11:9585332-9585333:+		[7]
Sequence	CGAAGATGATTGGGCATCCAACAAAGTTATGTTTAAAATAG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000524612.5; ENST00000299613.10; ENST00000530712.5; ENST00000532275.1; ENST00000450114.7; ENST00000530175.5
External Link	RMBase: m6A_site_130941
mod ID: M6ASITE003741		Click to Show/Hide the Full List
mod site	chr11:9585475-9585476:+		[7]
Sequence	GTAACAAGGATCTCCAGTCCACAAGTTGAAGAGGGCGATAG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000530712.5; ENST00000299613.10; ENST00000530175.5; ENST00000524612.5; ENST00000450114.7; ENST00000532275.1
External Link	RMBase: m6A_site_130942
mod ID: M6ASITE003742		Click to Show/Hide the Full List
mod site	chr11:9586739-9586740:+		[9]
Sequence	CATCCAGATCCAGAGAGAAGACCTTCAGCAATGGCACTGGT
Motif Score	2.876744048
Cell/Tissue List	CD34; Jurkat; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000532275.1; ENST00000530712.5; ENST00000299613.10; ENST00000530175.5; ENST00000527848.1; ENST00000450114.7
External Link	RMBase: m6A_site_130943
mod ID: M6ASITE003743		Click to Show/Hide the Full List
mod site	chr11:9586802-9586803:+		[9]
Sequence	GCTTCTAGAAAGAGTGCAGAACAATTACGAATAGAATTGAA
Motif Score	2.951386905
Cell/Tissue List	CD34; hESC-HEK293T; Jurkat
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000450114.7; ENST00000532275.1; ENST00000530712.5; ENST00000527848.1; ENST00000530175.5; ENST00000299613.10
External Link	RMBase: m6A_site_130944
mod ID: M6ASITE003744		Click to Show/Hide the Full List
mod site	chr11:9588451-9588452:+		[10]
Sequence	TTCTATTTTTATGTCAGAGAACTCAAGAAAGCACAGATGGC
Motif Score	3.373380952
Cell/Tissue List	Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000532275.1; ENST00000530712.5; ENST00000299613.10; ENST00000527848.1; ENST00000450114.7; ENST00000530175.5
External Link	RMBase: m6A_site_130945
mod ID: M6ASITE003745		Click to Show/Hide the Full List
mod site	chr11:9588545-9588546:+		[6]
Sequence	CCACCACCCAGAGTAATAGAACATCTCGACTTATTGGAAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000450114.7; ENST00000527848.1; ENST00000299613.10; ENST00000530175.5
External Link	RMBase: m6A_site_130946
mod ID: M6ASITE003746		Click to Show/Hide the Full List
mod site	chr11:9588573-9588574:+		[6]
Sequence	ACTTATTGGAAAGAAAATGAACCGCTCTGTCAGCCTTACTA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000299613.10; ENST00000527848.1; ENST00000530175.5; ENST00000450114.7
External Link	RMBase: m6A_site_130947
mod ID: M6ASITE003747		Click to Show/Hide the Full List
mod site	chr11:9588590-9588591:+		[8]
Sequence	TGAACCGCTCTGTCAGCCTTACTATATACTGAGCTACTCCT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000450114.7; ENST00000299613.10; ENST00000530175.5
External Link	RMBase: m6A_site_130948
mod ID: M6ASITE003748		Click to Show/Hide the Full List
mod site	chr11:9588605-9588606:+		[8]
Sequence	GCCTTACTATATACTGAGCTACTCCTTTCCCACCTCCCCCT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000450114.7; ENST00000299613.10; ENST00000530175.5
External Link	RMBase: m6A_site_130949
mod ID: M6ASITE003749		Click to Show/Hide the Full List
mod site	chr11:9588628-9588629:+		[6]
Sequence	CCTTTCCCACCTCCCCCTGAACACTGTGACAAGAGGAAGCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10; ENST00000527848.1; ENST00000530175.5
External Link	RMBase: m6A_site_130950
mod ID: M6ASITE003750		Click to Show/Hide the Full List
mod site	chr11:9588636-9588637:+		[8]
Sequence	ACCTCCCCCTGAACACTGTGACAAGAGGAAGCTAGGTTGAA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000299613.10; ENST00000527848.1; ENST00000450114.7; ENST00000530175.5
External Link	RMBase: m6A_site_130951
mod ID: M6ASITE003751		Click to Show/Hide the Full List
mod site	chr11:9588684-9588685:+		[8]
Sequence	ATAGAATCCAGTTTGCAATTACTTTCTCGATTGGTGTCAGT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000530175.5; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130952
mod ID: M6ASITE003752		Click to Show/Hide the Full List
mod site	chr11:9588721-9588722:+		[6]
Sequence	CAGTAGTTTTACTGATTAGGACTTTTATTGTGAATTACAGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; iSLK
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000450114.7; ENST00000527848.1; ENST00000299613.10
External Link	RMBase: m6A_site_130953
mod ID: M6ASITE003753		Click to Show/Hide the Full List
mod site	chr11:9588830-9588831:+		[7]
Sequence	ATGTGTCACTGTTGGATGTTACACCAGCCTTTCCAGGGTTA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7; ENST00000527848.1
External Link	RMBase: m6A_site_130954
mod ID: M6ASITE003754		Click to Show/Hide the Full List
mod site	chr11:9588953-9588954:+		[6]
Sequence	ACTCAAGGGCTTTATTACAGACATACCCTCCCTTTGAAAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; A549
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000450114.7; ENST00000527848.1; ENST00000299613.10
External Link	RMBase: m6A_site_130955
mod ID: M6ASITE003755		Click to Show/Hide the Full List
mod site	chr11:9588976-9588977:+		[6]
Sequence	TACCCTCCCTTTGAAAAGGGACATGCTAAAAGACTCATTAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; fibroblasts; A549
Seq Type List	m6A-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000527848.1; ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130956
mod ID: M6ASITE003756		Click to Show/Hide the Full List
mod site	chr11:9588988-9588989:+		[6]
Sequence	GAAAAGGGACATGCTAAAAGACTCATTACTACTCAGCCTTC
Motif Score	3.319380952
Cell/Tissue List	HeLa; fibroblasts; A549; AML
Seq Type List	m6A-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000299613.10; ENST00000527848.1; ENST00000450114.7
External Link	RMBase: m6A_site_130957
mod ID: M6ASITE003757		Click to Show/Hide the Full List
mod site	chr11:9588998-9588999:+		[8]
Sequence	ATGCTAAAAGACTCATTACTACTCAGCCTTCAATGTACCTG
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000450114.7; ENST00000527848.1; ENST00000299613.10
External Link	RMBase: m6A_site_130958
mod ID: M6ASITE003758		Click to Show/Hide the Full List
mod site	chr11:9589061-9589062:+		[6]
Sequence	TTTTTTTAATTGTGAATTAGACTTGTATATCCCACTGGGAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10; ENST00000527848.1
External Link	RMBase: m6A_site_130959
mod ID: M6ASITE003759		Click to Show/Hide the Full List
mod site	chr11:9589176-9589177:+		[8]
Sequence	TAGTTTTGTCTTTGCTGTAAACTTGTAGCATTAAACAATCA
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130960
mod ID: M6ASITE003760		Click to Show/Hide the Full List
mod site	chr11:9589190-9589191:+		[8]
Sequence	CTGTAAACTTGTAGCATTAAACAATCATTGTTGTTAATAGG
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130961
mod ID: M6ASITE003761		Click to Show/Hide the Full List
mod site	chr11:9589224-9589225:+		[8]
Sequence	TAATAGGTCTTCTTTTTGAAACAATTATGTGAAATGTATAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000450114.7; ENST00000299613.10; ENST00000527848.1
External Link	RMBase: m6A_site_130962
mod ID: M6ASITE003762		Click to Show/Hide the Full List
mod site	chr11:9589294-9589295:+		[8]
Sequence	TTTTTTTTTTTTTCCTTTGAACTTTGAAGCTAGTGCATTGG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000299613.10; ENST00000527848.1; ENST00000450114.7
External Link	RMBase: m6A_site_130963
mod ID: M6ASITE003763		Click to Show/Hide the Full List
mod site	chr11:9589369-9589370:+		[8]
Sequence	ATTAATGTAGTATAATAATTACTGGTTTTGTAACTTGTTCT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000299613.10; ENST00000450114.7; ENST00000527848.1
External Link	RMBase: m6A_site_130964
mod ID: M6ASITE003764		Click to Show/Hide the Full List
mod site	chr11:9589381-9589382:+		[8]
Sequence	TAATAATTACTGGTTTTGTAACTTGTTCTGGTAATGTCCTT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130965
mod ID: M6ASITE003765		Click to Show/Hide the Full List
mod site	chr11:9589407-9589408:+		[6]
Sequence	TCTGGTAATGTCCTTCCCGGACTCTTTTTAAATGTCTCCCC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000299613.10; ENST00000527848.1; ENST00000450114.7
External Link	RMBase: m6A_site_130966
mod ID: M6ASITE003766		Click to Show/Hide the Full List
mod site	chr11:9589509-9589510:+		[6]
Sequence	TTCAATATTTGTGTATATAAACCGATCTTCGTGATACTGTA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000527848.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130967
mod ID: M6ASITE003767		Click to Show/Hide the Full List
mod site	chr11:9589524-9589525:+		[8]
Sequence	TATAAACCGATCTTCGTGATACTGTACATAGCTGTTTGAAA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000299613.10; ENST00000450114.7
External Link	RMBase: m6A_site_130968
mod ID: M6ASITE003768		Click to Show/Hide the Full List
mod site	chr11:9589555-9589556:+		[8]
Sequence	CTGTTTGAAATGCCAGAATGACTTCTGACATTCCAAGTTTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000450114.7; ENST00000527848.1; ENST00000299613.10
External Link	RMBase: m6A_site_130969
mod ID: M6ASITE003769		Click to Show/Hide the Full List
mod site	chr11:9589611-9589612:+		[8]
Sequence	TATCTGTGATTAGCCATTTGACTAATAATACTGGCTAACAG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527848.1; ENST00000450114.7; ENST00000299613.10
External Link	RMBase: m6A_site_130970
mod ID: M6ASITE003770		Click to Show/Hide the Full List
mod site	chr11:9593339-9593340:+		[11]
Sequence	TTGTGTCCAAACTTCATTAAACTAAGAGTCAAAGAAACTTC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000527848.1
External Link	RMBase: m6A_site_130971
mod ID: M6ASITE003771		Click to Show/Hide the Full List
mod site	chr11:9593355-9593356:+		[11]
Sequence	TTAAACTAAGAGTCAAAGAAACTTCGGCCAGTCCAGCCCAT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000527848.1
External Link	RMBase: m6A_site_130972
mod ID: M6ASITE003772		Click to Show/Hide the Full List
mod site	chr11:9593397-9593398:+		[11]
Sequence	AAGAAAAATACCTCAAAGGAACATTTACATCACAGTTCACA
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000527848.1
External Link	RMBase: m6A_site_130973
mod ID: M6ASITE003773		Click to Show/Hide the Full List
mod site	chr11:9593443-9593444:+		[11]
Sequence	TAGTTTTATATGGTTAATAAACATTTTGAAGAGCATATACT
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000527848.1
External Link	RMBase: m6A_site_130974

Ref 1	KIAA1429 is a potential prognostic marker in colorectal cancer by promoting the proliferation via downregulating WEE1 expression in an m6A-independent manner. Oncogene. 2022 Jan;41(5):692-703. doi: 10.1038/s41388-021-02066-z. Epub 2021 Nov 24.
Ref 2	Carotenoids reverse multidrug resistance in cancer cells by interfering with ABC-transporters. Phytomedicine. 2012 Aug 15;19(11):977-87.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 5	Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):6784-6789. doi: 10.1073/pnas.1817334116. Epub 2019 Mar 14.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 10	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 11	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map