General Information of the m6A Target Gene (ID: M6ATAR00715)
Target Name Constitutive NOS (eNOS)
Synonyms
Constitutive NOS; cNOS; EC-NOS; Endothelial NOS; eNOS; NOS type III; NOSIII
    Click to Show/Hide
Gene Name eNOS
Chromosomal Location 7q36.1
Family NOS family
Function
Produces nitric oxide (NO) which is implicated in vascular smooth muscle relaxation through a cGMP-mediated signal transduction pathway. NO mediates vascular endothelial growth factor (VEGF)-induced angiogenesis in coronary vessels and promotes blood clotting through the activation of platelets; [Isoform eNOS13C]: Lacks eNOS activity, dominant-negative form that may down-regulate eNOS activity by forming heterodimers with isoform 1.
    Click to Show/Hide
Gene ID 4846
Uniprot ID
NOS3_HUMAN
HGNC ID
HGNC:7876
KEGG ID
hsa:4846
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
eNOS can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulation Down regulation
Responsed Disease Vascular diseases ICD-11: BE2Z
Responsed Drug Atorvastatin Approved
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
HUVEC-C Normal Homo sapiens CVCL_2959
HEK293T Normal Homo sapiens CVCL_0063
Diseases of the circulatory system [ICD-11: BE2Z]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Responsed Disease Vascular diseases [ICD-11: BE2Z]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Down regulation
Responsed Drug Atorvastatin Approved
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
HUVEC-C Normal Homo sapiens CVCL_2959
HEK293T Normal Homo sapiens CVCL_0063
Atorvastatin [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Down regulation
Responsed Disease Vascular diseases ICD-11: BE2Z
In-vitro Model THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
HUVEC-C Normal Homo sapiens CVCL_2959
HEK293T Normal Homo sapiens CVCL_0063
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00715)
Constitutive NOS (eNOS)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002396 Click to Show/Hide the Full List
mod site chr7:151003046-151003047:+ [2]
Sequence TCTCTGAGGTGCCCCAGGCTAGGCTCATTTCTGAGTCTTAC
Transcript ID List ENST00000297494.8; ENST00000484524.5; ENST00000467517.1; ENST00000461406.5
External Link RMBase: RNA-editing_site_128089
mod ID: A2ISITE002397 Click to Show/Hide the Full List
mod site chr7:151011190-151011191:+ [2]
Sequence CAGAGTTCTGCCCTGAAACTATAGCTCCCAGAGCCAGAGCT
Transcript ID List ENST00000477227.1; ENST00000468293.5; ENST00000461406.5; ENST00000475017.1; ENST00000297494.8
External Link RMBase: RNA-editing_site_128090
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004246 Click to Show/Hide the Full List
mod site chr7:150993869-150993870:+
Sequence GCCTGGGGCTGGGGCTGGGCCTTGGGCTGTGCGGCAAGCAG
Cell/Tissue List spleen
Seq Type List Bisulfite-seq
Transcript ID List rmsk_2410504; ENST00000484524.5; ENST00000461406.5; ENST00000297494.8; ENST00000467517.1
External Link RMBase: m5C_site_40801
mod ID: M5CSITE004247 Click to Show/Hide the Full List
mod site chr7:151007113-151007114:+
Sequence CACCCCAGGTTCTGTGTGTTCGGGCTCGGCTCCCGGGCATA
Cell/Tissue List testis
Seq Type List Bisulfite-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5
External Link RMBase: m5C_site_40802
N6-methyladenosine (m6A)
In total 26 m6A sequence/site(s) in this target gene
mod ID: M6ASITE083024 Click to Show/Hide the Full List
mod site chr7:150991113-150991114:+ [3]
Sequence GTTAAACTTTAAGATGAAGAACAAAGCTGAACATACTGATG
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5
External Link RMBase: m6A_site_782811
mod ID: M6ASITE083025 Click to Show/Hide the Full List
mod site chr7:150991123-150991124:+ [3]
Sequence AAGATGAAGAACAAAGCTGAACATACTGATGCATTGGATCT
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5
External Link RMBase: m6A_site_782812
mod ID: M6ASITE083026 Click to Show/Hide the Full List
mod site chr7:150991161-150991162:+ [3]
Sequence TCTTTGGAGAGGATCTCAGAACTCATTGTACTTAATTTACA
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8
External Link RMBase: m6A_site_782813
mod ID: M6ASITE083027 Click to Show/Hide the Full List
mod site chr7:150991189-150991190:+ [3]
Sequence TACTTAATTTACAGGCTAAAACCTTAGAAGAGGAATTTATT
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8
External Link RMBase: m6A_site_782814
mod ID: M6ASITE083028 Click to Show/Hide the Full List
mod site chr7:150991224-150991225:+ [3]
Sequence TTTATTATATCCTACACAAGACTCCAGGGAAGCACATGGCC
Motif Score 3.319380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8
External Link RMBase: m6A_site_782815
mod ID: M6ASITE083029 Click to Show/Hide the Full List
mod site chr7:150991249-150991250:+ [3]
Sequence AGGGAAGCACATGGCCTTGGACTGAAGGCTGGCATCTGGAA
Motif Score 4.065041667
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5
External Link RMBase: m6A_site_782816
mod ID: M6ASITE083030 Click to Show/Hide the Full List
mod site chr7:150993955-150993956:+ [4]
Sequence CTACTCCCACCAGCGCCAGAACACAGGTAAGGGCCAGGCAG
Motif Score 2.951386905
Cell/Tissue List TIME; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000484524.5; ENST00000297494.8; ENST00000467517.1; ENST00000461406.5
External Link RMBase: m6A_site_782817
mod ID: M6ASITE083031 Click to Show/Hide the Full List
mod site chr7:150995261-150995262:+ [4]
Sequence CAAGTTCCCTCGTGTGAAGAACTGGGAGGTGGGGAGCATCA
Motif Score 3.373380952
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000461406.5; ENST00000467517.1; ENST00000484524.5; ENST00000297494.8
External Link RMBase: m6A_site_782818
mod ID: M6ASITE083032 Click to Show/Hide the Full List
mod site chr7:151001252-151001253:+ [5]
Sequence AGCCAAAGTCACCATCGTGGACCACCACGCCGCCACGGCCT
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000467517.1; ENST00000297494.8; ENST00000461406.5; ENST00000484524.5
External Link RMBase: m6A_site_782819
mod ID: M6ASITE083033 Click to Show/Hide the Full List
mod site chr7:151007166-151007167:+ [5]
Sequence CGCCTTTGCTCGTGCCGTGGACACACGGCTGGAGGAACTGG
Motif Score 3.643047619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8
External Link RMBase: m6A_site_782820
mod ID: M6ASITE083034 Click to Show/Hide the Full List
mod site chr7:151008941-151008942:+ [5]
Sequence TCCCGCAGGCCGCCTGTGAGACCTTCTGTGTGGGAGAGGAT
Motif Score 2.876744048
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8; ENST00000473057.1; ENST00000475017.1
External Link RMBase: m6A_site_782821
mod ID: M6ASITE083035 Click to Show/Hide the Full List
mod site chr7:151008981-151008982:+ [5]
Sequence TGCCAAGGCCGCCGCCCGAGACATCTTCAGCCCCAAACGGA
Motif Score 2.897386905
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5; ENST00000475017.1; ENST00000473057.1
External Link RMBase: m6A_site_782822
mod ID: M6ASITE083036 Click to Show/Hide the Full List
mod site chr7:151009245-151009246:+ [5]
Sequence TACAATCCGCTCAGTGGAAAACCTGCAAAGCAGCAAGTCCA
Motif Score 2.185083333
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000475017.1; ENST00000461406.5; ENST00000473057.1; ENST00000297494.8
External Link RMBase: m6A_site_782823
mod ID: M6ASITE083037 Click to Show/Hide the Full List
mod site chr7:151009423-151009424:+ [5]
Sequence CACCATCCTGGTGCGCCTGGACACCGGAGGCCAGGAGGGGC
Motif Score 3.643047619
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000475017.1; ENST00000461406.5; ENST00000473057.1; ENST00000297494.8
External Link RMBase: m6A_site_782824
mod ID: M6ASITE083038 Click to Show/Hide the Full List
mod site chr7:151009462-151009463:+ [5]
Sequence GCTGCAGTACCAGCCGGGGGACCACATAGGTGTCTGCCCGC
Motif Score 3.622404762
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000297494.8; ENST00000473057.1; ENST00000475017.1; ENST00000461406.5
External Link RMBase: m6A_site_782825
mod ID: M6ASITE083039 Click to Show/Hide the Full List
mod site chr7:151009528-151009529:+ [5]
Sequence GCTGCTGAGCCGCGTGGAGGACCCGCCGGCGCCCACTGAGC
Motif Score 3.622404762
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8; ENST00000475017.1; ENST00000473057.1
External Link RMBase: m6A_site_782826
mod ID: M6ASITE083040 Click to Show/Hide the Full List
mod site chr7:151010141-151010142:+ [5]
Sequence TCCCCCCGGCTGGGTGCGGGACCCCCGGCTGCCCCCGTGCA
Motif Score 3.622404762
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8; ENST00000475017.1
External Link RMBase: m6A_site_782827
mod ID: M6ASITE083041 Click to Show/Hide the Full List
mod site chr7:151010192-151010193:+ [5]
Sequence GGCTCTCACCTTCTTCCTGGACATCACCTCCCCACCCAGCC
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000475017.1; ENST00000297494.8
External Link RMBase: m6A_site_782828
mod ID: M6ASITE083042 Click to Show/Hide the Full List
mod site chr7:151010800-151010801:+ [4]
Sequence TAGCTGTGCTGGCATACAGGACTCAGGGTGAGGCAACAAGC
Motif Score 4.065041667
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000477227.1; ENST00000468293.5; ENST00000461406.5; ENST00000475017.1; ENST00000297494.8
External Link RMBase: m6A_site_782829
mod ID: M6ASITE083043 Click to Show/Hide the Full List
mod site chr7:151010851-151010852:+ [4]
Sequence CTGGCCACAGCAGGGTTGGGACCGGCCCCTCTCTGGCCCCT
Motif Score 3.622404762
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000461406.5; ENST00000468293.5; ENST00000297494.8; ENST00000477227.1; ENST00000475017.1
External Link RMBase: m6A_site_782830
mod ID: M6ASITE083044 Click to Show/Hide the Full List
mod site chr7:151013363-151013364:+ [5]
Sequence CTCACCGCCTTCTCCCGGGAACCTGACAACCCCAAGGTGTG
Motif Score 2.930744048
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8; ENST00000468293.5; ENST00000475454.1; ENST00000477227.1
External Link RMBase: m6A_site_782836
mod ID: M6ASITE083045 Click to Show/Hide the Full List
mod site chr7:151013386-151013387:+ [5]
Sequence TGACAACCCCAAGGTGTGAGACCCTGAGGGCGCAATGGTAA
Motif Score 2.876744048
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000477227.1; ENST00000297494.8; ENST00000461406.5; ENST00000475454.1
External Link RMBase: m6A_site_782837
mod ID: M6ASITE083046 Click to Show/Hide the Full List
mod site chr7:151013432-151013433:+ [5]
Sequence AGATAGGGAGAGAGGGGAGGACTCGCGCTCTCCAGCGGGGC
Motif Score 4.065041667
Cell/Tissue List endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000477227.1; ENST00000475454.1; ENST00000297494.8; ENST00000461406.5
External Link RMBase: m6A_site_782838
mod ID: M6ASITE083047 Click to Show/Hide the Full List
mod site chr7:151013843-151013844:+ [5]
Sequence TGGCAACCAACGTCCTGCAGACCGTGCAGCGCATCCTGGCG
Motif Score 2.876744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000297494.8; ENST00000477227.1; ENST00000461406.5
External Link RMBase: m6A_site_782840
mod ID: M6ASITE083048 Click to Show/Hide the Full List
mod site chr7:151014029-151014030:+ [6]
Sequence TCAGCAACGCTACCACGAAGACATTTTCGGGCTCACGCTGC
Motif Score 2.897386905
Cell/Tissue List HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000461406.5; ENST00000297494.8; ENST00000477227.1
External Link RMBase: m6A_site_782844
mod ID: M6ASITE083049 Click to Show/Hide the Full List
mod site chr7:151014152-151014153:+ [7]
Sequence GTTCGACCCTCCCGGCTCAGACACCAACAGCCCCTGAGAGC
Motif Score 2.897386905
Cell/Tissue List H1A; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq
Transcript ID List ENST00000297494.8; ENST00000461406.5; ENST00000477227.1
External Link RMBase: m6A_site_782845