m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00715)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
eNOS
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Vascular diseases | ICD-11: BE2Z | ||
| Responsed Drug | Atorvastatin | Approved | ||
| In-vitro Model | THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 |
| HUVEC-C | Normal | Homo sapiens | CVCL_2959 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
Diseases of the circulatory system [ICD-11: BE2Z]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases. | |||
| Responsed Disease | Vascular diseases [ICD-11: BE2Z] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Atorvastatin | Approved | ||
| In-vitro Model | THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 |
| HUVEC-C | Normal | Homo sapiens | CVCL_2959 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
Atorvastatin
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of KLF2 and Constitutive NOS (eNOS), and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases. | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Vascular diseases | ICD-11: BE2Z | ||
| In-vitro Model | THP-1 | Childhood acute monocytic leukemia | Homo sapiens | CVCL_0006 |
| HUVEC-C | Normal | Homo sapiens | CVCL_2959 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00715)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE002396 | Click to Show/Hide the Full List | ||
| mod site | chr7:151003046-151003047:+ | [2] | |
| Sequence | TCTCTGAGGTGCCCCAGGCTAGGCTCATTTCTGAGTCTTAC | ||
| Transcript ID List | ENST00000297494.8; ENST00000484524.5; ENST00000467517.1; ENST00000461406.5 | ||
| External Link | RMBase: RNA-editing_site_128089 | ||
| mod ID: A2ISITE002397 | Click to Show/Hide the Full List | ||
| mod site | chr7:151011190-151011191:+ | [2] | |
| Sequence | CAGAGTTCTGCCCTGAAACTATAGCTCCCAGAGCCAGAGCT | ||
| Transcript ID List | ENST00000477227.1; ENST00000468293.5; ENST00000461406.5; ENST00000475017.1; ENST00000297494.8 | ||
| External Link | RMBase: RNA-editing_site_128090 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 26 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE083024 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991113-150991114:+ | [3] | |
| Sequence | GTTAAACTTTAAGATGAAGAACAAAGCTGAACATACTGATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782811 | ||
| mod ID: M6ASITE083025 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991123-150991124:+ | [3] | |
| Sequence | AAGATGAAGAACAAAGCTGAACATACTGATGCATTGGATCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782812 | ||
| mod ID: M6ASITE083026 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991161-150991162:+ | [3] | |
| Sequence | TCTTTGGAGAGGATCTCAGAACTCATTGTACTTAATTTACA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782813 | ||
| mod ID: M6ASITE083027 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991189-150991190:+ | [3] | |
| Sequence | TACTTAATTTACAGGCTAAAACCTTAGAAGAGGAATTTATT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782814 | ||
| mod ID: M6ASITE083028 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991224-150991225:+ | [3] | |
| Sequence | TTTATTATATCCTACACAAGACTCCAGGGAAGCACATGGCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782815 | ||
| mod ID: M6ASITE083029 | Click to Show/Hide the Full List | ||
| mod site | chr7:150991249-150991250:+ | [3] | |
| Sequence | AGGGAAGCACATGGCCTTGGACTGAAGGCTGGCATCTGGAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782816 | ||
| mod ID: M6ASITE083030 | Click to Show/Hide the Full List | ||
| mod site | chr7:150993955-150993956:+ | [4] | |
| Sequence | CTACTCCCACCAGCGCCAGAACACAGGTAAGGGCCAGGCAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | TIME; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000484524.5; ENST00000297494.8; ENST00000467517.1; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782817 | ||
| mod ID: M6ASITE083031 | Click to Show/Hide the Full List | ||
| mod site | chr7:150995261-150995262:+ | [4] | |
| Sequence | CAAGTTCCCTCGTGTGAAGAACTGGGAGGTGGGGAGCATCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000467517.1; ENST00000484524.5; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782818 | ||
| mod ID: M6ASITE083032 | Click to Show/Hide the Full List | ||
| mod site | chr7:151001252-151001253:+ | [5] | |
| Sequence | AGCCAAAGTCACCATCGTGGACCACCACGCCGCCACGGCCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000467517.1; ENST00000297494.8; ENST00000461406.5; ENST00000484524.5 | ||
| External Link | RMBase: m6A_site_782819 | ||
| mod ID: M6ASITE083033 | Click to Show/Hide the Full List | ||
| mod site | chr7:151007166-151007167:+ | [5] | |
| Sequence | CGCCTTTGCTCGTGCCGTGGACACACGGCTGGAGGAACTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782820 | ||
| mod ID: M6ASITE083034 | Click to Show/Hide the Full List | ||
| mod site | chr7:151008941-151008942:+ | [5] | |
| Sequence | TCCCGCAGGCCGCCTGTGAGACCTTCTGTGTGGGAGAGGAT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8; ENST00000473057.1; ENST00000475017.1 | ||
| External Link | RMBase: m6A_site_782821 | ||
| mod ID: M6ASITE083035 | Click to Show/Hide the Full List | ||
| mod site | chr7:151008981-151008982:+ | [5] | |
| Sequence | TGCCAAGGCCGCCGCCCGAGACATCTTCAGCCCCAAACGGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000461406.5; ENST00000475017.1; ENST00000473057.1 | ||
| External Link | RMBase: m6A_site_782822 | ||
| mod ID: M6ASITE083036 | Click to Show/Hide the Full List | ||
| mod site | chr7:151009245-151009246:+ | [5] | |
| Sequence | TACAATCCGCTCAGTGGAAAACCTGCAAAGCAGCAAGTCCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475017.1; ENST00000461406.5; ENST00000473057.1; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782823 | ||
| mod ID: M6ASITE083037 | Click to Show/Hide the Full List | ||
| mod site | chr7:151009423-151009424:+ | [5] | |
| Sequence | CACCATCCTGGTGCGCCTGGACACCGGAGGCCAGGAGGGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475017.1; ENST00000461406.5; ENST00000473057.1; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782824 | ||
| mod ID: M6ASITE083038 | Click to Show/Hide the Full List | ||
| mod site | chr7:151009462-151009463:+ | [5] | |
| Sequence | GCTGCAGTACCAGCCGGGGGACCACATAGGTGTCTGCCCGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000473057.1; ENST00000475017.1; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782825 | ||
| mod ID: M6ASITE083039 | Click to Show/Hide the Full List | ||
| mod site | chr7:151009528-151009529:+ | [5] | |
| Sequence | GCTGCTGAGCCGCGTGGAGGACCCGCCGGCGCCCACTGAGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8; ENST00000475017.1; ENST00000473057.1 | ||
| External Link | RMBase: m6A_site_782826 | ||
| mod ID: M6ASITE083040 | Click to Show/Hide the Full List | ||
| mod site | chr7:151010141-151010142:+ | [5] | |
| Sequence | TCCCCCCGGCTGGGTGCGGGACCCCCGGCTGCCCCCGTGCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8; ENST00000475017.1 | ||
| External Link | RMBase: m6A_site_782827 | ||
| mod ID: M6ASITE083041 | Click to Show/Hide the Full List | ||
| mod site | chr7:151010192-151010193:+ | [5] | |
| Sequence | GGCTCTCACCTTCTTCCTGGACATCACCTCCCCACCCAGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000475017.1; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782828 | ||
| mod ID: M6ASITE083042 | Click to Show/Hide the Full List | ||
| mod site | chr7:151010800-151010801:+ | [4] | |
| Sequence | TAGCTGTGCTGGCATACAGGACTCAGGGTGAGGCAACAAGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000477227.1; ENST00000468293.5; ENST00000461406.5; ENST00000475017.1; ENST00000297494.8 | ||
| External Link | RMBase: m6A_site_782829 | ||
| mod ID: M6ASITE083043 | Click to Show/Hide the Full List | ||
| mod site | chr7:151010851-151010852:+ | [4] | |
| Sequence | CTGGCCACAGCAGGGTTGGGACCGGCCCCTCTCTGGCCCCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000468293.5; ENST00000297494.8; ENST00000477227.1; ENST00000475017.1 | ||
| External Link | RMBase: m6A_site_782830 | ||
| mod ID: M6ASITE083044 | Click to Show/Hide the Full List | ||
| mod site | chr7:151013363-151013364:+ | [5] | |
| Sequence | CTCACCGCCTTCTCCCGGGAACCTGACAACCCCAAGGTGTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8; ENST00000468293.5; ENST00000475454.1; ENST00000477227.1 | ||
| External Link | RMBase: m6A_site_782836 | ||
| mod ID: M6ASITE083045 | Click to Show/Hide the Full List | ||
| mod site | chr7:151013386-151013387:+ | [5] | |
| Sequence | TGACAACCCCAAGGTGTGAGACCCTGAGGGCGCAATGGTAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000477227.1; ENST00000297494.8; ENST00000461406.5; ENST00000475454.1 | ||
| External Link | RMBase: m6A_site_782837 | ||
| mod ID: M6ASITE083046 | Click to Show/Hide the Full List | ||
| mod site | chr7:151013432-151013433:+ | [5] | |
| Sequence | AGATAGGGAGAGAGGGGAGGACTCGCGCTCTCCAGCGGGGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000477227.1; ENST00000475454.1; ENST00000297494.8; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782838 | ||
| mod ID: M6ASITE083047 | Click to Show/Hide the Full List | ||
| mod site | chr7:151013843-151013844:+ | [5] | |
| Sequence | TGGCAACCAACGTCCTGCAGACCGTGCAGCGCATCCTGGCG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000477227.1; ENST00000461406.5 | ||
| External Link | RMBase: m6A_site_782840 | ||
| mod ID: M6ASITE083048 | Click to Show/Hide the Full List | ||
| mod site | chr7:151014029-151014030:+ | [6] | |
| Sequence | TCAGCAACGCTACCACGAAGACATTTTCGGGCTCACGCTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000461406.5; ENST00000297494.8; ENST00000477227.1 | ||
| External Link | RMBase: m6A_site_782844 | ||
| mod ID: M6ASITE083049 | Click to Show/Hide the Full List | ||
| mod site | chr7:151014152-151014153:+ | [7] | |
| Sequence | GTTCGACCCTCCCGGCTCAGACACCAACAGCCCCTGAGAGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | H1A; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000297494.8; ENST00000461406.5; ENST00000477227.1 | ||
| External Link | RMBase: m6A_site_782845 | ||
References