m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00712)

Target Name	Pro-epidermal growth factor (EGF)
Synonyms	EGF Click to Show/Hide
Gene Name	EGF
Chromosomal Location	4q25
Function	EGF stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. Magnesiotropic hormone that stimulates magnesium reabsorption in the renal distal convoluted tubule via engagement of EGFR and activation of the magnesium channel TRPM6. Can induce neurite outgrowth in motoneurons of the pond snail Lymnaea stagnalis in vitro. Click to Show/Hide
Gene ID	1950
Uniprot ID	EGF_HUMAN
HGNC ID	HGNC:3229
KEGG ID	hsa:1950

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

EGF can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HeLa cell line	Homo sapiens
Treatment: METTL3 knockdown HeLa cells Control: HeLa cells		GSE70061
Regulation		logFC: 2.08E+00 p-value: 3.08E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between EGF and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 7.98E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of Pro-epidermal growth factor (EGF)/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated RAD51 expression, resulting in enhanced HR activity.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of Pro-epidermal growth factor (EGF)/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated RAD51 expression, resulting in enhanced HR activity.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of Pro-epidermal growth factor (EGF)/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated RAD51 expression, resulting in enhanced HR activity.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00712)

Pro-epidermal growth factor (EGF)

2'-O-Methylation (2'-O-Me)

In total 6 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000345		Click to Show/Hide the Full List
mod site	chr4:109992370-109992371:+		[2]
Sequence	AAAATTGGAATGATACAGAGAAGATTAGCATGGCCCCTGCG
Transcript ID List	ENST00000509996.1; ENST00000652245.1; ENST00000503392.1; ENST00000265171.9; ENST00000384530.1; ENST00000509793.5; rmsk_1406810
External Link	RMBase: Nm_site_5260
mod ID: 2OMSITE000346		Click to Show/Hide the Full List
mod site	chr4:109992376-109992377:+		[3]
Sequence	GGAATGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGA
Cell/Tissue List	N.A.; HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000652245.1; ENST00000384530.1; ENST00000265171.9; ENST00000503392.1; ENST00000509793.5; ENST00000509996.1; rmsk_1406810
External Link	RMBase: Nm_site_5261
mod ID: 2OMSITE000348		Click to Show/Hide the Full List
mod site	chr4:109992383-109992384:+		[3]
Sequence	TACAGAGAAGATTAGCATGGCCCCTGCGCAAGGAGGACATG
Cell/Tissue List	N.A.; HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000509793.5; ENST00000509996.1; ENST00000503392.1; ENST00000265171.9; ENST00000652245.1; rmsk_1406810; ENST00000384530.1
External Link	RMBase: Nm_site_5263
mod ID: 2OMSITE000349		Click to Show/Hide the Full List
mod site	chr4:109992385-109992386:+		[3]
Sequence	CAGAGAAGATTAGCATGGCCCCTGCGCAAGGAGGACATGCA
Cell/Tissue List	N.A.; HEK293
Seq Type List	RiboMeth-seq
Transcript ID List	rmsk_1406810; ENST00000509996.1; ENST00000652245.1; ENST00000384530.1; ENST00000265171.9; ENST00000503392.1; ENST00000509793.5
External Link	RMBase: Nm_site_5264
mod ID: 2OMSITE000350		Click to Show/Hide the Full List
mod site	chr4:109992386-109992387:+		[3]
Sequence	AGAGAAGATTAGCATGGCCCCTGCGCAAGGAGGACATGCAA
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000503392.1; ENST00000652245.1; ENST00000509793.5; rmsk_1406810; ENST00000384530.1; ENST00000265171.9; ENST00000509996.1
External Link	RMBase: Nm_site_5265
mod ID: 2OMSITE000347		Click to Show/Hide the Full List
mod site	chr4:109992377-109992378:+		[3]
Sequence	GAATGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGAG
Seq Type List	RiboMeth-seq
Transcript ID List	ENST00000384530.1; ENST00000652245.1; ENST00000509996.1; ENST00000509793.5; ENST00000265171.9; ENST00000503392.1; rmsk_1406810
External Link	RMBase: Nm_site_5262

N6-methyladenosine (m6A)

In total 12 m6A sequence/site(s) in this target gene
mod ID: M6ASITE067097		Click to Show/Hide the Full List
mod site	chr4:109960917-109960918:+		[4]
Sequence	CTGTACTCTTGGGTGTAAAAACACCCCTGGATCCTATTACT
Motif Score	2.20572619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000652245.1; ENST00000509793.5; ENST00000504633.1; ENST00000265171.9; ENST00000503392.1
External Link	RMBase: m6A_site_647467
mod ID: M6ASITE067098		Click to Show/Hide the Full List
mod site	chr4:109983450-109983451:+		[5]
Sequence	TTGATCTAAAGAACCAAGTAACACCATTGGACATCTTGTCC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652245.1; ENST00000509793.5; ENST00000265171.9; ENST00000509996.1; ENST00000511228.5; ENST00000503392.1
External Link	RMBase: m6A_site_647468
mod ID: M6ASITE067099		Click to Show/Hide the Full List
mod site	chr4:110011344-110011345:+		[6]
Sequence	TTCATATGCCCTCCTATGGGACACAGACCCTTGAAGGGGGT
Motif Score	3.643047619
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000537316.5; ENST00000544918.1; ENST00000652245.1; ENST00000503392.1; ENST00000265171.9; ENST00000509996.1; ENST00000540840.1; ENST00000509793.5
External Link	RMBase: m6A_site_647469
mod ID: M6ASITE067100		Click to Show/Hide the Full List
mod site	chr4:110011350-110011351:+		[6]
Sequence	TGCCCTCCTATGGGACACAGACCCTTGAAGGGGGTGTCGAG
Motif Score	2.876744048
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000652245.1; ENST00000509793.5; ENST00000503392.1; ENST00000540840.1; ENST00000537316.5; ENST00000544918.1; ENST00000265171.9; ENST00000509996.1
External Link	RMBase: m6A_site_647470
mod ID: M6ASITE067101		Click to Show/Hide the Full List
mod site	chr4:110011423-110011424:+		[6]
Sequence	ATGGCAACAAAGGGCCCTGGACCCACCACACCAAATGGAGC
Motif Score	3.622404762
Cell/Tissue List	fibroblasts; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509996.1; ENST00000537316.5; ENST00000540840.1; ENST00000503392.1; ENST00000509793.5; ENST00000544918.1; ENST00000265171.9; ENST00000652245.1
External Link	RMBase: m6A_site_647471
mod ID: M6ASITE067102		Click to Show/Hide the Full List
mod site	chr4:110011457-110011458:+		[6]
Sequence	ATGGAGCTGACTCAGTGAAAACTGGAATTAAAAGGAAAGTC
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; Huh7; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509996.1; ENST00000509793.5; ENST00000540840.1; ENST00000537316.5; ENST00000652245.1; ENST00000544918.1; ENST00000503392.1; ENST00000265171.9
External Link	RMBase: m6A_site_647472
mod ID: M6ASITE067103		Click to Show/Hide the Full List
mod site	chr4:110011489-110011490:+		[6]
Sequence	AGGAAAGTCAAGAAGAATGAACTATGTCGATGCACAGTATC
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; Huh7; HEK293A-TOA; iSLK; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000540840.1; ENST00000509793.5; ENST00000265171.9; ENST00000503392.1; ENST00000544918.1; ENST00000652245.1; ENST00000509996.1; ENST00000537316.5
External Link	RMBase: m6A_site_647473
mod ID: M6ASITE067104		Click to Show/Hide the Full List
mod site	chr4:110011533-110011534:+		[6]
Sequence	TCTTTCAAAAGTAGAGCAAAACTATAGGTTTTGGTTCCACA
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; Huh7; HEK293A-TOA; iSLK; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509996.1; ENST00000509793.5; ENST00000652245.1; ENST00000265171.9; ENST00000540840.1; ENST00000544918.1
External Link	RMBase: m6A_site_647474
mod ID: M6ASITE067105		Click to Show/Hide the Full List
mod site	chr4:110011589-110011590:+		[7]
Sequence	CACCTACTCAATGCCTGGAGACAGATACGTAGTTGTGCTTT
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000265171.9; ENST00000540840.1; ENST00000544918.1; ENST00000652245.1; ENST00000509996.1; ENST00000509793.5
External Link	RMBase: m6A_site_647475
mod ID: M6ASITE067106		Click to Show/Hide the Full List
mod site	chr4:110013579-110013580:+		[7]
Sequence	TAAAAATTCAAGTTTTAAGAACAGCATTTTCATGTAAAAAC
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000652245.1
External Link	RMBase: m6A_site_647476
mod ID: M6ASITE067107		Click to Show/Hide the Full List
mod site	chr4:110013598-110013599:+		[7]
Sequence	AACAGCATTTTCATGTAAAAACTTGATTTGTGTTTTTTCCA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000652245.1
External Link	RMBase: m6A_site_647477
mod ID: M6ASITE067108		Click to Show/Hide the Full List
mod site	chr4:110013620-110013621:+		[7]
Sequence	TTGATTTGTGTTTTTTCCAGACTGAATACTTTTCCTCCCTA
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000652245.1
External Link	RMBase: m6A_site_647478

Ref 1	METTL3 promotes homologous recombination repair and modulates chemotherapeutic response in breast cancer by regulating the EGF/RAD51 axis. Elife. 2022 May 3;11:e75231. doi: 10.7554/eLife.75231.
Ref 2	snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D158-62. doi: 10.1093/nar/gkj002.
Ref 3	Substoichiometric ribose methylations in spliceosomal snRNAs. Org Biomol Chem. 2017 Oct 31;15(42):8872-8876. doi: 10.1039/c7ob02317k.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 7	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map