m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00706)

Target Name	Metalloreductase STEAP2 (STEAP2)
Synonyms	Prostate cancer-associated protein 1; Protein up-regulated in metastatic prostate cancer; PUMPCn; Six-transmembrane epithelial antigen of prostate 2; SixTransMembrane protein of prostate 1 Click to Show/Hide
Gene Name	STEAP2
Chromosomal Location	7q21.13
Family	STEAP family
Function	Metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+). Uses NAD(+) as acceptor (By similarity). Click to Show/Hide
Gene ID	261729
Uniprot ID	STEA2_HUMAN
HGNC ID	HGNC:17885
KEGG ID	hsa:261729

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

STEAP2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: 6.65E-01 p-value: 3.16E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Metalloreductase STEAP2 (STEAP2) overexpression inhibited papillary thyroid cancer cell proliferation, migration, and invasion in vitro and inhibited lung metastasis and tumorigenicity in vivo. METTL3 stabilized STEAP2 mRNA and regulated STEAP2 expression positively in an m6A-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Papillary thyroid cancer		ICD-11: 2D10.1	Disease Info
Pathway Response	Hedgehog signaling pathway			hsa04340
Cell Process	Epithelial-to-mesenchymal transition
	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	BCPAP cells (5×10⁶) were introduced into the mice by means of subcutaneous injection through the flank area. STEAP2-saRNA or NC-saRNA (n = 6 for each group) was given by intratumoral multipoint injection at an interval of 3 days (5 injections in total) using an in vivo transfection reagent (Entranster -in vivo, Engreen, China) as per the vendor-provided protocol. Tumor volume (V) was monitored and calculated as follows: V = (L×W2)/2. For the in vivo tumor metastasis assay, BCPAP cells (5×10⁶ cells) were administrated into mice through the tail vein. STEAP2-saRNA or NC-saRNA (n = 6 for each group) was given via tail vein injection at an interval of 3 days (8 injections in total).

Thyroid Cancer [ICD-11: 2D10]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Metalloreductase STEAP2 (STEAP2) overexpression inhibited papillary thyroid cancer cell proliferation, migration, and invasion in vitro and inhibited lung metastasis and tumorigenicity in vivo. METTL3 stabilized STEAP2 mRNA and regulated STEAP2 expression positively in an m6A-dependent manner.
Responsed Disease	Papillary thyroid cancer [ICD-11: 2D10.1]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Hedgehog signaling pathway			hsa04340
Cell Process	Epithelial-to-mesenchymal transition
	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	BCPAP cells (5×10⁶) were introduced into the mice by means of subcutaneous injection through the flank area. STEAP2-saRNA or NC-saRNA (n = 6 for each group) was given by intratumoral multipoint injection at an interval of 3 days (5 injections in total) using an in vivo transfection reagent (Entranster -in vivo, Engreen, China) as per the vendor-provided protocol. Tumor volume (V) was monitored and calculated as follows: V = (L×W2)/2. For the in vivo tumor metastasis assay, BCPAP cells (5×10⁶ cells) were administrated into mice through the tail vein. STEAP2-saRNA or NC-saRNA (n = 6 for each group) was given via tail vein injection at an interval of 3 days (8 injections in total).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00706)

Metalloreductase STEAP2 (STEAP2)

N6-methyladenosine (m6A)

In total 26 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080725		Click to Show/Hide the Full List
mod site	chr7:90212324-90212325:+		[2]
Sequence	AGGAGAAAGAAGGCAAGGAGACATTGTCCCAGGTAGGATGT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000402625.6; ENST00000426158.1; ENST00000394626.5; ENST00000287908.7; ENST00000428074.5; ENST00000394632.5; ENST00000394621.7; ENST00000394622.6
External Link	RMBase: m6A_site_763965
mod ID: M6ASITE080726		Click to Show/Hide the Full List
mod site	chr7:90216145-90216146:+		[3]
Sequence	CTTCAAAAGAAAAGGTATAGACACTGTGGACATCACCTGGG
Motif Score	2.897386905
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000394621.7; ENST00000394629.2; ENST00000394626.5; ENST00000482369.1; ENST00000428074.5; ENST00000402625.6; ENST00000287908.7; ENST00000394622.6; ENST00000426158.1; ENST00000394632.5
External Link	RMBase: m6A_site_763966
mod ID: M6ASITE080727		Click to Show/Hide the Full List
mod site	chr7:90216154-90216155:+		[3]
Sequence	AAAAGGTATAGACACTGTGGACATCACCTGGGAGCTTGTGA
Motif Score	3.643047619
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000482369.1; ENST00000394626.5; ENST00000394632.5; ENST00000394629.2; ENST00000428074.5; ENST00000394622.6; ENST00000402625.6; ENST00000287908.7; ENST00000394621.7; ENST00000426158.1
External Link	RMBase: m6A_site_763967
mod ID: M6ASITE080728		Click to Show/Hide the Full List
mod site	chr7:90216205-90216206:+		[3]
Sequence	AATGTCTAACCTCCCTCTAGACCTAAAGAATCTGAGTGTGC
Motif Score	2.876744048
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000287908.7; ENST00000428074.5; ENST00000402625.6; ENST00000394629.2; ENST00000394622.6; ENST00000394626.5; ENST00000394621.7; rmsk_2300462; ENST00000394632.5; ENST00000482369.1; ENST00000426158.1
External Link	RMBase: m6A_site_763968
mod ID: M6ASITE080729		Click to Show/Hide the Full List
mod site	chr7:90225337-90225338:+		[4]
Sequence	ATGAAGATGCTCTCACAAAAACAAATATAATATTTGTTGCT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; hESCs; A549
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000482369.1; ENST00000394626.5; ENST00000402625.6; ENST00000428074.5; ENST00000426158.1; ENST00000394621.7; ENST00000394629.2; ENST00000394622.6; ENST00000394632.5; ENST00000287908.7
External Link	RMBase: m6A_site_763969
mod ID: M6ASITE080730		Click to Show/Hide the Full List
mod site	chr7:90225369-90225370:+		[5]
Sequence	TTTGTTGCTATACACAGAGAACATTATACCTCCCTGTGGGA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hESCs; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000394632.5; ENST00000402625.6; ENST00000428074.5; ENST00000394626.5; ENST00000394622.6; ENST00000394621.7; ENST00000287908.7; ENST00000482369.1; ENST00000394629.2
External Link	RMBase: m6A_site_763970
mod ID: M6ASITE080731		Click to Show/Hide the Full List
mod site	chr7:90225389-90225390:+		[5]
Sequence	ACATTATACCTCCCTGTGGGACCTGAGACATCTGCTTGTGG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; hESCs; A549
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000287908.7; ENST00000394622.6; ENST00000402625.6; ENST00000394632.5; ENST00000428074.5; ENST00000394629.2; ENST00000482369.1; ENST00000394621.7; ENST00000394626.5
External Link	RMBase: m6A_site_763971
mod ID: M6ASITE080732		Click to Show/Hide the Full List
mod site	chr7:90225396-90225397:+		[5]
Sequence	ACCTCCCTGTGGGACCTGAGACATCTGCTTGTGGGTAAAAT
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESCs; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000402625.6; ENST00000428074.5; ENST00000287908.7; ENST00000394629.2; ENST00000394621.7; ENST00000482369.1; ENST00000394626.5; ENST00000394632.5; ENST00000394622.6
External Link	RMBase: m6A_site_763972
mod ID: M6ASITE080733		Click to Show/Hide the Full List
mod site	chr7:90225449-90225450:+		[5]
Sequence	GAGCAATAACATGAGGATAAACCAGTACCCAGAATCCAATG
Motif Score	2.185083333
Cell/Tissue List	HEK293T; hESCs; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000394626.5; ENST00000394632.5; ENST00000394621.7; ENST00000428074.5; ENST00000402625.6; ENST00000394629.2; ENST00000482369.1; ENST00000394622.6; ENST00000287908.7
External Link	RMBase: m6A_site_763973
mod ID: M6ASITE080734		Click to Show/Hide the Full List
mod site	chr7:90225552-90225553:+
Sequence	GCTTGGGCACTTCAGTTAGGACCTAAGGATGCCAGCCGGCA
Motif Score	3.622404762
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000394629.2; ENST00000394626.5; ENST00000428074.5; ENST00000402625.6; ENST00000482369.1; ENST00000287908.7; ENST00000394621.7; ENST00000394632.5; ENST00000394622.6
External Link	RMBase: m6A_site_763974
mod ID: M6ASITE080735		Click to Show/Hide the Full List
mod site	chr7:90227017-90227018:+
Sequence	GCGCGACAACAGGTTATTGAACTTGCCCGCCAGTTGAATTT
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000394621.7; ENST00000394629.2; ENST00000402625.6; ENST00000482369.1; ENST00000394622.6; ENST00000287908.7; ENST00000428074.5; ENST00000394632.5; ENST00000394626.5
External Link	RMBase: m6A_site_763975
mod ID: M6ASITE080736		Click to Show/Hide the Full List
mod site	chr7:90227202-90227203:+		[5]
Sequence	GATTCATCCATATGCTAGAAACCAACAGAGTGACTTTTACA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000394632.5; ENST00000394621.7; ENST00000394629.2; ENST00000394626.5; ENST00000394622.6; ENST00000287908.7; ENST00000402625.6
External Link	RMBase: m6A_site_763976
mod ID: M6ASITE080737		Click to Show/Hide the Full List
mod site	chr7:90227214-90227215:+		[6]
Sequence	TGCTAGAAACCAACAGAGTGACTTTTACAAAATTCCTATAG
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000394632.5; ENST00000394626.5; ENST00000394629.2; ENST00000394621.7; ENST00000402625.6; ENST00000394622.6; ENST00000287908.7
External Link	RMBase: m6A_site_763977
mod ID: M6ASITE080738		Click to Show/Hide the Full List
mod site	chr7:90227249-90227250:+		[5]
Sequence	CTATAGAGATTGTGAATAAAACCTTACCTATAGTTGCCATT
Motif Score	2.185083333
Cell/Tissue List	HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000402625.6; ENST00000394626.5; ENST00000287908.7; ENST00000394621.7; ENST00000394622.6; ENST00000394629.2; ENST00000394632.5
External Link	RMBase: m6A_site_763978
mod ID: M6ASITE080739		Click to Show/Hide the Full List
mod site	chr7:90230010-90230011:+		[7]
Sequence	TTCAGTGAGCAATGCTTTAAACTGGAGAGAATTCAGTTTTA
Motif Score	2.627720238
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000394629.2; ENST00000394626.5; ENST00000402625.6; ENST00000394632.5; ENST00000287908.7; ENST00000394621.7; ENST00000394622.6
External Link	RMBase: m6A_site_763979
mod ID: M6ASITE080740		Click to Show/Hide the Full List
mod site	chr7:90232442-90232443:+		[7]
Sequence	CAGATTTTATACACCACCAAACTTTGTTCTTGCTCTTGTTT
Motif Score	2.627720238
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000394629.2; ENST00000287908.7; ENST00000402625.6; ENST00000394632.5; ENST00000394621.7; ENST00000394626.5; ENST00000394622.6
External Link	RMBase: m6A_site_763980
mod ID: M6ASITE080741		Click to Show/Hide the Full List
mod site	chr7:90236772-90236773:+		[5]
Sequence	TTCATCCAAAATTAAGGCAGACTGTTTGGATTCTTCCAGTG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000402625.6; ENST00000394632.5; ENST00000394629.2; ENST00000287908.7; ENST00000394626.5; ENST00000394622.6; ENST00000394621.7
External Link	RMBase: m6A_site_763981
mod ID: M6ASITE080742		Click to Show/Hide the Full List
mod site	chr7:90236917-90236918:+		[5]
Sequence	GCAGCTTTGCAGATACCCAGACTGAGCTGGAACTGGAATTT
Motif Score	3.319380952
Cell/Tissue List	HEK293T; hESCs; A549; GM12878; Huh7; HEK293A-TOA; MSC
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000287908.7; ENST00000394622.6; ENST00000394621.7; ENST00000394629.2; ENST00000402625.6; ENST00000394632.5; ENST00000394626.5
External Link	RMBase: m6A_site_763982
mod ID: M6ASITE080743		Click to Show/Hide the Full List
mod site	chr7:90236928-90236929:+		[5]
Sequence	GATACCCAGACTGAGCTGGAACTGGAATTTGTCTTCCTATT
Motif Score	3.373380952
Cell/Tissue List	HEK293T; hESCs; A549; GM12878; Huh7; HEK293A-TOA; MSC
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000287908.7; ENST00000394622.6; ENST00000394629.2; ENST00000402625.6; ENST00000394626.5; ENST00000394632.5; ENST00000394621.7
External Link	RMBase: m6A_site_763983
mod ID: M6ASITE080744		Click to Show/Hide the Full List
mod site	chr7:90237177-90237178:+		[8]
Sequence	AAGAGTAAGGCAGATTAGAGACCAGAAAGACCTTGACTACT
Motif Score	2.876744048
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000394621.7; ENST00000287908.7; ENST00000394622.6; ENST00000402625.6; ENST00000394632.5; ENST00000394629.2; ENST00000394626.5
External Link	RMBase: m6A_site_763984
mod ID: M6ASITE080745		Click to Show/Hide the Full List
mod site	chr7:90237186-90237187:+		[8]
Sequence	GCAGATTAGAGACCAGAAAGACCTTGACTACTTCCCTACTT
Motif Score	2.876744048
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000287908.7; ENST00000394621.7; ENST00000394629.2; ENST00000394632.5; ENST00000402625.6; ENST00000394626.5; ENST00000394622.6
External Link	RMBase: m6A_site_763985
mod ID: M6ASITE080746		Click to Show/Hide the Full List
mod site	chr7:90237310-90237311:+		[4]
Sequence	CTTTATCCTGATACCATTTAACACTGTCTGAATTAACTAGA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394626.5; ENST00000394632.5; ENST00000394621.7; ENST00000402625.6; ENST00000287908.7; ENST00000394629.2; ENST00000394622.6
External Link	RMBase: m6A_site_763986
mod ID: M6ASITE080747		Click to Show/Hide the Full List
mod site	chr7:90237330-90237331:+		[9]
Sequence	ACACTGTCTGAATTAACTAGACTGCAATAATTCTTTCTTTT
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000402625.6; ENST00000394621.7; ENST00000394626.5; ENST00000394632.5; ENST00000394622.6; ENST00000287908.7; ENST00000394629.2
External Link	RMBase: m6A_site_763987
mod ID: M6ASITE080748		Click to Show/Hide the Full List
mod site	chr7:90237380-90237381:+		[4]
Sequence	TAAAGGATAATGTGCAATTCACATTAAAATTGATTTTCCAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394629.2; ENST00000394622.6; ENST00000394621.7; ENST00000402625.6; ENST00000287908.7; ENST00000394626.5; ENST00000394632.5
External Link	RMBase: m6A_site_763988
mod ID: M6ASITE080749		Click to Show/Hide the Full List
mod site	chr7:90237508-90237509:+		[9]
Sequence	TGTAATTGGTAATTACTAAAACTCTGTAATCTCCAAAATAT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000394622.6; ENST00000402625.6; ENST00000394629.2; ENST00000394626.5; ENST00000394621.7; ENST00000394632.5; ENST00000287908.7
External Link	RMBase: m6A_site_763989
mod ID: M6ASITE080750		Click to Show/Hide the Full List
mod site	chr7:90237583-90237584:+		[9]
Sequence	CTCATAGATCTGCCTTATAAACATTTAAATAAAAAGTACTA
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000402625.6; ENST00000394632.5; ENST00000287908.7; ENST00000394626.5; ENST00000394629.2; ENST00000394621.7; ENST00000394622.6
External Link	RMBase: m6A_site_763990

Ref 1	METTL3-mediated m6A modification of STEAP2 mRNA inhibits papillary thyroid cancer progress by blocking the Hedgehog signaling pathway and epithelial-to-mesenchymal transition. Cell Death Dis. 2022 Apr 18;13(4):358. doi: 10.1038/s41419-022-04817-6.
Ref 2	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 3	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 6	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 7	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 8	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 9	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map