m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00699)

Target Name	Centromere protein K (CENPK)
Synonyms	CENP-K; Interphase centromere complex protein 37; Protein AF-5alpha; p33 Click to Show/Hide
Gene Name	CENPK
Chromosomal Location	5q12.3
Family	CENP-K/MCM22 family
Function	Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. Acts in coordination with KNL1 to recruit the NDC80 complex to the outer kinetochore. Click to Show/Hide
Gene ID	64105
Uniprot ID	CENPK_HUMAN
HGNC ID	HGNC:29479
KEGG ID	hsa:64105

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CENPK can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Zinc finger CCCH domain-containing protein 13 (ZC3H13) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The study revealed firm links between m6A modification patterns and cervical cancer prognosis, especially through ZC3H13-mediated m6A modification of Centromere protein K (CENPK) mRNA.
Target Regulation	Up regulation
Responsed Disease	Cervical cancer		ICD-11: 2C77	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
	p53 signaling pathway			hsa04115
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
In-vivo Model	BALB/c-nu mice were grouped as follows to detect tumor growth: HeLa-sh-NC [mice inoculated with scramble shRNA-infected control HeLa cells (n = 5)] and HeLa-sh-CENPK [mice inoculated with CENPK-targeted shRNA-infected HeLa cells (n = 5)]. The mice were subcutaneously inoculated with 5 × 10⁶ cells/100 uL in the flank. The longest and the shortest diameters of the growing tumors were measured every 3 d with a caliper, and the tumor volume (V) was counted by the following equation: V = (the longest diameter × the shortest diameter2)/2. The mice were grouped as follows to evaluate the tumor-initiating frequency and were inoculated with a series of 5 × 10⁵, 2 × 10⁵, and 5 × 10⁴ cells subcutaneously: HeLa-sh-NC (n = 6); and HeLa-sh-CENPK (n = 6). The mice bearing subcutaneous xenograft tumors were grouped as follows to evaluate tumor chemoresistance: HeLa-sh-NC (n = 10); HeLa-sh-CENPK (n = 10); HeLa-sh-NC + cisplatin [mice inoculated with scramble shRNA-infected control HeLa cells and 3 mg/kg of cisplatin once a week intraperitoneally (ip) for 6 weeks (n = 10)].

Cervical cancer [ICD-11: 2C77]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The study revealed firm links between m6A modification patterns and cervical cancer prognosis, especially through ZC3H13-mediated m6A modification of Centromere protein K (CENPK) mRNA.
Responsed Disease	Cervical cancer [ICD-11: 2C77]
Target Regulator	Zinc finger CCCH domain-containing protein 13 (ZC3H13)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Wnt signaling pathway			hsa04310
	p53 signaling pathway			hsa04115
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
In-vivo Model	BALB/c-nu mice were grouped as follows to detect tumor growth: HeLa-sh-NC [mice inoculated with scramble shRNA-infected control HeLa cells (n = 5)] and HeLa-sh-CENPK [mice inoculated with CENPK-targeted shRNA-infected HeLa cells (n = 5)]. The mice were subcutaneously inoculated with 5 × 10⁶ cells/100 uL in the flank. The longest and the shortest diameters of the growing tumors were measured every 3 d with a caliper, and the tumor volume (V) was counted by the following equation: V = (the longest diameter × the shortest diameter2)/2. The mice were grouped as follows to evaluate the tumor-initiating frequency and were inoculated with a series of 5 × 10⁵, 2 × 10⁵, and 5 × 10⁴ cells subcutaneously: HeLa-sh-NC (n = 6); and HeLa-sh-CENPK (n = 6). The mice bearing subcutaneous xenograft tumors were grouped as follows to evaluate tumor chemoresistance: HeLa-sh-NC (n = 10); HeLa-sh-CENPK (n = 10); HeLa-sh-NC + cisplatin [mice inoculated with scramble shRNA-infected control HeLa cells and 3 mg/kg of cisplatin once a week intraperitoneally (ip) for 6 weeks (n = 10)].

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00699)

Centromere protein K (CENPK)

Adenosine-to-Inosine editing (A-to-I)

In total 17 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000656		Click to Show/Hide the Full List
mod site	chr5:65532674-65532675:-		[2]
Sequence	TCAGGTGATCTGCCCGCCTCAGCCTCCGAAAGTCCTGGGAT
Transcript ID List	ENST00000510768.5; ENST00000514814.5; ENST00000515873.5; ENST00000502997.5; ENST00000506282.6; ENST00000242872.7; ENST00000515497.5; ENST00000505960.5; ENST00000508421.5; ENST00000509397.5; ENST00000511841.5; ENST00000510693.5; ENST00000396679.6
External Link	RMBase: RNA-editing_site_109311
mod ID: A2ISITE000657		Click to Show/Hide the Full List
mod site	chr5:65535104-65535105:-		[3]
Sequence	CCTACTTCAGCCTCCTGAGTAGCTGGGACTATGGGTGTGCA
Transcript ID List	ENST00000514814.5; ENST00000511841.5; ENST00000396679.6; ENST00000506282.6; ENST00000242872.7; ENST00000510693.5; ENST00000515873.5; ENST00000505960.5; ENST00000508421.5; ENST00000515497.5; ENST00000502997.5; ENST00000510768.5; ENST00000509397.5
External Link	RMBase: RNA-editing_site_109312
mod ID: A2ISITE000658		Click to Show/Hide the Full List
mod site	chr5:65535668-65535669:-		[2]
Sequence	GCACATGGGATAAGCTTACAAGAGTTCTTTCCCAGTAGAGT
Transcript ID List	ENST00000505960.5; ENST00000515873.5; ENST00000506282.6; ENST00000242872.7; ENST00000509397.5; ENST00000508421.5; ENST00000511841.5; ENST00000510768.5; ENST00000502997.5; ENST00000515497.5; ENST00000396679.6; ENST00000514814.5; ENST00000510693.5
External Link	RMBase: RNA-editing_site_109313
mod ID: A2ISITE000659		Click to Show/Hide the Full List
mod site	chr5:65535671-65535672:-		[2]
Sequence	AAGGCACATGGGATAAGCTTACAAGAGTTCTTTCCCAGTAG
Transcript ID List	ENST00000511841.5; ENST00000510768.5; ENST00000508421.5; ENST00000505960.5; ENST00000502997.5; ENST00000510693.5; ENST00000515497.5; ENST00000396679.6; ENST00000509397.5; ENST00000242872.7; ENST00000506282.6; ENST00000515873.5; ENST00000514814.5
External Link	RMBase: RNA-editing_site_109314
mod ID: A2ISITE000660		Click to Show/Hide the Full List
mod site	chr5:65535676-65535677:-		[2]
Sequence	AGGAAAAGGCACATGGGATAAGCTTACAAGAGTTCTTTCCC
Transcript ID List	ENST00000515497.5; ENST00000514814.5; ENST00000506282.6; ENST00000509397.5; ENST00000396679.6; ENST00000510768.5; ENST00000515873.5; ENST00000242872.7; ENST00000505960.5; ENST00000508421.5; ENST00000510693.5; ENST00000502997.5; ENST00000511841.5
External Link	RMBase: RNA-editing_site_109315
mod ID: A2ISITE000661		Click to Show/Hide the Full List
mod site	chr5:65535690-65535691:-		[2]
Sequence	ATTACAATGAACAAAGGAAAAGGCACATGGGATAAGCTTAC
Transcript ID List	ENST00000396679.6; ENST00000509397.5; ENST00000515873.5; ENST00000502997.5; ENST00000242872.7; ENST00000514814.5; ENST00000510768.5; ENST00000511841.5; ENST00000515497.5; ENST00000505960.5; ENST00000508421.5; ENST00000510693.5; ENST00000506282.6
External Link	RMBase: RNA-editing_site_109316
mod ID: A2ISITE000662		Click to Show/Hide the Full List
mod site	chr5:65535691-65535692:-		[2]
Sequence	CATTACAATGAACAAAGGAAAAGGCACATGGGATAAGCTTA
Transcript ID List	ENST00000509397.5; ENST00000242872.7; ENST00000515497.5; ENST00000508421.5; ENST00000510768.5; ENST00000510693.5; ENST00000511841.5; ENST00000506282.6; ENST00000514814.5; ENST00000515873.5; ENST00000502997.5; ENST00000396679.6; ENST00000505960.5
External Link	RMBase: RNA-editing_site_109317
mod ID: A2ISITE000663		Click to Show/Hide the Full List
mod site	chr5:65535696-65535697:-		[2]
Sequence	GAGAACATTACAATGAACAAAGGAAAAGGCACATGGGATAA
Transcript ID List	ENST00000506282.6; ENST00000514814.5; ENST00000509397.5; ENST00000510768.5; ENST00000242872.7; ENST00000511841.5; ENST00000510693.5; ENST00000502997.5; ENST00000515873.5; ENST00000505960.5; ENST00000396679.6; ENST00000508421.5; ENST00000515497.5
External Link	RMBase: RNA-editing_site_109318
mod ID: A2ISITE000664		Click to Show/Hide the Full List
mod site	chr5:65536527-65536528:-		[2]
Sequence	TCAAATGATCTTCCTGCCTTAGCTTCCCAAGTAGCTAGGAG
Transcript ID List	ENST00000242872.7; ENST00000502997.5; ENST00000506282.6; ENST00000509397.5; ENST00000505960.5; ENST00000508421.5; ENST00000511841.5; ENST00000396679.6; ENST00000515873.5; ENST00000515497.5; ENST00000510693.5; ENST00000514814.5; ENST00000510768.5
External Link	RMBase: RNA-editing_site_109319
mod ID: A2ISITE000665		Click to Show/Hide the Full List
mod site	chr5:65537202-65537203:-		[2]
Sequence	ACTAGGAAAGAACTCCTGTAAGCTTCTCCCATGTGCCTTTT
Transcript ID List	ENST00000510768.5; ENST00000515497.5; ENST00000506282.6; ENST00000514814.5; ENST00000502997.5; ENST00000515873.5; rmsk_1638676; ENST00000511841.5; ENST00000510693.5; ENST00000509397.5; ENST00000508421.5; ENST00000242872.7; ENST00000396679.6; ENST00000505960.5
External Link	RMBase: RNA-editing_site_109320
mod ID: A2ISITE000666		Click to Show/Hide the Full List
mod site	chr5:65537203-65537204:-		[2]
Sequence	TACTAGGAAAGAACTCCTGTAAGCTTCTCCCATGTGCCTTT
Transcript ID List	ENST00000510768.5; ENST00000396679.6; ENST00000508421.5; ENST00000506282.6; ENST00000514814.5; ENST00000242872.7; rmsk_1638676; ENST00000515873.5; ENST00000515497.5; ENST00000511841.5; ENST00000502997.5; ENST00000509397.5; ENST00000510693.5; ENST00000505960.5
External Link	RMBase: RNA-editing_site_109321
mod ID: A2ISITE000667		Click to Show/Hide the Full List
mod site	chr5:65537219-65537220:-		[2]
Sequence	CACATCTATGCAACTCTACTAGGAAAGAACTCCTGTAAGCT
Transcript ID List	ENST00000515873.5; ENST00000510693.5; ENST00000508421.5; ENST00000506282.6; ENST00000396679.6; ENST00000515497.5; ENST00000514814.5; ENST00000509397.5; ENST00000505960.5; ENST00000511841.5; ENST00000510768.5; ENST00000242872.7; rmsk_1638676; ENST00000502997.5
External Link	RMBase: RNA-editing_site_109322
mod ID: A2ISITE000668		Click to Show/Hide the Full List
mod site	chr5:65537227-65537228:-		[2]
Sequence	GAATTGAGCACATCTATGCAACTCTACTAGGAAAGAACTCC
Transcript ID List	ENST00000502997.5; ENST00000506282.6; ENST00000510768.5; ENST00000508421.5; ENST00000396679.6; ENST00000515497.5; rmsk_1638676; ENST00000505960.5; ENST00000511841.5; ENST00000514814.5; ENST00000242872.7; ENST00000509397.5; ENST00000510693.5; ENST00000515873.5
External Link	RMBase: RNA-editing_site_109323
mod ID: A2ISITE000669		Click to Show/Hide the Full List
mod site	chr5:65537238-65537239:-		[2]
Sequence	AGTTGTAGGGAGAATTGAGCACATCTATGCAACTCTACTAG
Transcript ID List	ENST00000508421.5; ENST00000514814.5; ENST00000396679.6; ENST00000515873.5; ENST00000511841.5; ENST00000505960.5; ENST00000506282.6; rmsk_1638676; ENST00000242872.7; ENST00000509397.5; ENST00000510693.5; ENST00000510768.5; ENST00000502997.5; ENST00000515497.5
External Link	RMBase: RNA-editing_site_109324
mod ID: A2ISITE000670		Click to Show/Hide the Full List
mod site	chr5:65551187-65551188:-		[4]
Sequence	GCACAATCATGGCTCATTGCAGCCCCGATCTCCCGGGTTCA
Transcript ID List	ENST00000396679.6; ENST00000242872.7; ENST00000510768.5; ENST00000510693.5; ENST00000515873.5; ENST00000514814.5; ENST00000509397.5; ENST00000508421.5; ENST00000515497.5; ENST00000510354.1; ENST00000502997.5; ENST00000506282.6; ENST00000505960.5
External Link	RMBase: RNA-editing_site_109325
mod ID: A2ISITE000671		Click to Show/Hide the Full List
mod site	chr5:65551202-65551203:-		[4]
Sequence	GGCTGGAGTACAGTGGCACAATCATGGCTCATTGCAGCCCC
Transcript ID List	ENST00000510354.1; ENST00000515497.5; ENST00000515873.5; ENST00000396679.6; ENST00000510693.5; ENST00000508421.5; ENST00000505960.5; ENST00000502997.5; ENST00000510768.5; ENST00000509397.5; ENST00000242872.7; ENST00000514814.5; ENST00000506282.6
External Link	RMBase: RNA-editing_site_109326
mod ID: A2ISITE000672		Click to Show/Hide the Full List
mod site	chr5:65551203-65551204:-		[4]
Sequence	AGGCTGGAGTACAGTGGCACAATCATGGCTCATTGCAGCCC
Transcript ID List	ENST00000509397.5; ENST00000502997.5; ENST00000396679.6; ENST00000508421.5; ENST00000510693.5; ENST00000515497.5; ENST00000514814.5; ENST00000506282.6; ENST00000515873.5; ENST00000505960.5; ENST00000510354.1; ENST00000510768.5; ENST00000242872.7
External Link	RMBase: RNA-editing_site_109327

N6-methyladenosine (m6A)

In total 32 m6A sequence/site(s) in this target gene
mod ID: M6ASITE069168		Click to Show/Hide the Full List
mod site	chr5:65517839-65517840:-		[5]
Sequence	GATTCTGCTAATTATTACCAACAAAATTGTATTCATGACAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000242872.7; ENST00000396679.6; ENST00000508421.5; ENST00000514814.5
External Link	RMBase: m6A_site_670420
mod ID: M6ASITE069169		Click to Show/Hide the Full List
mod site	chr5:65518060-65518061:-		[6]
Sequence	ATGGGAAGGTCATTTAATTTACAGATGGTTTTAAAATTGAG
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000508421.5; ENST00000242872.7; ENST00000514814.5; ENST00000396679.6
External Link	RMBase: m6A_site_670421
mod ID: M6ASITE069170		Click to Show/Hide the Full List
mod site	chr5:65518139-65518140:-		[5]
Sequence	ATATTTTCTTAAAATATATAACAATATCTTTTATGCATTTT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000242872.7; ENST00000508421.5; ENST00000396679.6; ENST00000514814.5
External Link	RMBase: m6A_site_670422
mod ID: M6ASITE069171		Click to Show/Hide the Full List
mod site	chr5:65518228-65518229:-		[6]
Sequence	GATAATATTCTAGGCATAAAACATTTAATGTACCTTACCTC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000396679.6; ENST00000242872.7; ENST00000514814.5; ENST00000508421.5
External Link	RMBase: m6A_site_670423
mod ID: M6ASITE069172		Click to Show/Hide the Full List
mod site	chr5:65518394-65518395:-		[6]
Sequence	CAGGACTATTTGGATAAAAAACATTATTTGCAAATTAATGC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T; hNPCs; A549
Seq Type List	DART-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000508421.5; ENST00000242872.7; ENST00000514814.5; ENST00000510693.5; ENST00000396679.6
External Link	RMBase: m6A_site_670424
mod ID: M6ASITE069173		Click to Show/Hide the Full List
mod site	chr5:65518410-65518411:-		[7]
Sequence	AAGGATATTGGAACCACAGGACTATTTGGATAAAAAACATT
Motif Score	4.065041667
Cell/Tissue List	hNPCs; A549; CD8T
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000242872.7; ENST00000508421.5; ENST00000396679.6; ENST00000514814.5; ENST00000510693.5
External Link	RMBase: m6A_site_670425
mod ID: M6ASITE069174		Click to Show/Hide the Full List
mod site	chr5:65518418-65518419:-		[7]
Sequence	TATCATTCAAGGATATTGGAACCACAGGACTATTTGGATAA
Motif Score	2.930744048
Cell/Tissue List	hNPCs; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000396679.6; ENST00000242872.7; ENST00000514814.5; ENST00000510693.5; ENST00000508421.5
External Link	RMBase: m6A_site_670426
mod ID: M6ASITE069175		Click to Show/Hide the Full List
mod site	chr5:65518454-65518455:-		[5]
Sequence	AAAGGATGTTTTCTTTTTTCACACAGTAAAAATTCTTATCA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396679.6; ENST00000510693.5; ENST00000242872.7; ENST00000514814.5; ENST00000508421.5
External Link	RMBase: m6A_site_670427
mod ID: M6ASITE069176		Click to Show/Hide the Full List
mod site	chr5:65518522-65518523:-		[5]
Sequence	CGTAATGGAATTGCCTTGAGACATCCAGAAGATCCAACCCG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000508421.5; ENST00000510693.5; ENST00000396679.6; ENST00000514814.5; ENST00000242872.7
External Link	RMBase: m6A_site_670428
mod ID: M6ASITE069177		Click to Show/Hide the Full List
mod site	chr5:65518603-65518604:-		[5]
Sequence	AATAGATTATTTGATGTTCCACATGATCCATATGTCAAAAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000242872.7; ENST00000508421.5; ENST00000506282.6; ENST00000396679.6; ENST00000510693.5; ENST00000514814.5
External Link	RMBase: m6A_site_670429
mod ID: M6ASITE069178		Click to Show/Hide the Full List
mod site	chr5:65521494-65521495:-		[5]
Sequence	AATCATCTGTAAACCTGATAACACTGCATGAAATGTTAGAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000242872.7; ENST00000396679.6; ENST00000506282.6; ENST00000508421.5; ENST00000510693.5; ENST00000514814.5
External Link	RMBase: m6A_site_670430
mod ID: M6ASITE069179		Click to Show/Hide the Full List
mod site	chr5:65521523-65521524:-		[5]
Sequence	CACATTTCTCTTGAAGAAAAACATTCAAGAATCATCTGTAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000514814.5; ENST00000510693.5; ENST00000242872.7; ENST00000506282.6; ENST00000396679.6; ENST00000508421.5
External Link	RMBase: m6A_site_670431
mod ID: M6ASITE069180		Click to Show/Hide the Full List
mod site	chr5:65528491-65528492:-		[6]
Sequence	CTTGGGCGAGTTTCTAGAAGACCATTTTCCTCTGCCTGATA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; Huh7
Seq Type List	DART-seq; MeRIP-seq
Transcript ID List	ENST00000510693.5; ENST00000514814.5; ENST00000509397.5; ENST00000505960.5; ENST00000511841.5; ENST00000242872.7; ENST00000506282.6; ENST00000396679.6; ENST00000508421.5
External Link	RMBase: m6A_site_670432
mod ID: M6ASITE069181		Click to Show/Hide the Full List
mod site	chr5:65528523-65528524:-		[8]
Sequence	ATAAAAGAATATAAGGAGAAACTCTTGAGTACCTTGGGCGA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000505960.5; ENST00000514814.5; ENST00000511841.5; ENST00000396679.6; ENST00000510693.5; ENST00000509397.5; ENST00000508421.5; ENST00000242872.7; ENST00000506282.6
External Link	RMBase: m6A_site_670433
mod ID: M6ASITE069182		Click to Show/Hide the Full List
mod site	chr5:65528558-65528559:-		[6]
Sequence	GAATCTTTAATGAACTGAAAACTAAAATGCTTAATATAAAA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; Huh7
Seq Type List	DART-seq; MeRIP-seq
Transcript ID List	ENST00000515873.5; ENST00000510693.5; ENST00000505960.5; ENST00000506282.6; ENST00000515497.5; ENST00000514814.5; ENST00000242872.7; ENST00000508421.5; ENST00000509397.5; ENST00000510768.5; ENST00000396679.6; ENST00000511841.5
External Link	RMBase: m6A_site_670434
mod ID: M6ASITE069183		Click to Show/Hide the Full List
mod site	chr5:65528565-65528566:-		[6]
Sequence	TCTATTAGAATCTTTAATGAACTGAAAACTAAAATGCTTAA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; Huh7
Seq Type List	DART-seq; MeRIP-seq
Transcript ID List	ENST00000506282.6; ENST00000514814.5; ENST00000505960.5; ENST00000509397.5; ENST00000242872.7; ENST00000515497.5; ENST00000508421.5; ENST00000510693.5; ENST00000511841.5; ENST00000396679.6; ENST00000515873.5; ENST00000510768.5
External Link	RMBase: m6A_site_670435
mod ID: M6ASITE069184		Click to Show/Hide the Full List
mod site	chr5:65528934-65528935:-		[9]
Sequence	AATTGAAAAATAAGGTTGAAACATTTTCTGAATCAAGGTAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hNPCs; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000509397.5; ENST00000511841.5; ENST00000242872.7; ENST00000396679.6; ENST00000515497.5; ENST00000510693.5; ENST00000510768.5; ENST00000505960.5; ENST00000514814.5; ENST00000508421.5; ENST00000506282.6; ENST00000515873.5
External Link	RMBase: m6A_site_670436
mod ID: M6ASITE069185		Click to Show/Hide the Full List
mod site	chr5:65528995-65528996:-		[9]
Sequence	GAACAACGGTGGTTGGATGAACAGCAACAGATAATGGAATC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hNPCs; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000515497.5; ENST00000515873.5; ENST00000396679.6; ENST00000510768.5; ENST00000242872.7; ENST00000514814.5; ENST00000513951.1; ENST00000502997.5; ENST00000510693.5; ENST00000505960.5; ENST00000506282.6; ENST00000511841.5; ENST00000509397.5; ENST00000508421.5
External Link	RMBase: m6A_site_670437
mod ID: M6ASITE069186		Click to Show/Hide the Full List
mod site	chr5:65529013-65529014:-		[9]
Sequence	TTTTTCCATGTCGAAAGGGAACAACGGTGGTTGGATGAACA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; hNPCs; Huh7; peripheral-blood
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000510768.5; ENST00000242872.7; ENST00000510693.5; ENST00000508421.5; ENST00000509397.5; ENST00000513951.1; ENST00000514814.5; ENST00000515873.5; ENST00000506282.6; ENST00000511841.5; ENST00000515497.5; ENST00000505960.5; ENST00000396679.6; ENST00000502997.5
External Link	RMBase: m6A_site_670438
mod ID: M6ASITE069187		Click to Show/Hide the Full List
mod site	chr5:65529125-65529126:-		[9]
Sequence	GAATGAAAAGTTAAAGGAAGACTTAGAAAGGTTTGTTTATG
Motif Score	3.319380952
Cell/Tissue List	HeLa; hNPCs; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000502997.5; ENST00000242872.7; ENST00000510768.5; ENST00000509397.5; ENST00000511841.5; ENST00000510693.5; ENST00000505960.5; ENST00000508421.5; ENST00000513951.1; ENST00000396679.6; ENST00000515497.5; ENST00000514814.5; ENST00000506282.6; ENST00000515873.5
External Link	RMBase: m6A_site_670439
mod ID: M6ASITE069188		Click to Show/Hide the Full List
mod site	chr5:65529184-65529185:-		[5]
Sequence	TTCTAGTTCCAAAAGCTGAGACAAGATCTTGAAATGGTACT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; BGC823; hNPCs; Huh7
Seq Type List	MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510768.5; ENST00000502997.5; ENST00000511841.5; ENST00000509397.5; ENST00000515497.5; ENST00000510693.5; ENST00000506282.6; ENST00000242872.7; ENST00000514814.5; ENST00000396679.6; ENST00000513951.1; ENST00000508421.5; ENST00000515873.5; ENST00000505960.5
External Link	RMBase: m6A_site_670440
mod ID: M6ASITE069189		Click to Show/Hide the Full List
mod site	chr5:65529231-65529232:-		[10]
Sequence	AAATAAAACTGGGATTAAAGACCAAGCAATTAATTTGAATT
Motif Score	2.876744048
Cell/Tissue List	BGC823; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000511841.5; ENST00000506282.6; ENST00000513951.1; ENST00000502997.5; ENST00000242872.7; ENST00000509397.5; ENST00000510768.5; ENST00000508421.5; ENST00000515873.5; ENST00000510693.5; ENST00000396679.6; ENST00000515497.5; ENST00000514814.5; ENST00000505960.5
External Link	RMBase: m6A_site_670441
mod ID: M6ASITE069190		Click to Show/Hide the Full List
mod site	chr5:65529244-65529245:-		[10]
Sequence	GACTATCGTTCAGAAATAAAACTGGGATTAAAGACCAAGCA
Motif Score	2.627720238
Cell/Tissue List	BGC823; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000515873.5; ENST00000514814.5; ENST00000513951.1; ENST00000396679.6; ENST00000510768.5; ENST00000509397.5; ENST00000508421.5; ENST00000506282.6; ENST00000502997.5; ENST00000510693.5; ENST00000515497.5; ENST00000242872.7; ENST00000511841.5; ENST00000505960.5
External Link	RMBase: m6A_site_670442
mod ID: M6ASITE069191		Click to Show/Hide the Full List
mod site	chr5:65551572-65551573:-		[6]
Sequence	TCAGTCAATGGCAGAAAAAAACACCTGAAAGTAAGATTCTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000510768.5; ENST00000502997.5; ENST00000242872.7; ENST00000515497.5; ENST00000510354.1; ENST00000508421.5; ENST00000514814.5; ENST00000505960.5; ENST00000510693.5; ENST00000515873.5; ENST00000396679.6; ENST00000506282.6
External Link	RMBase: m6A_site_670443
mod ID: M6ASITE069192		Click to Show/Hide the Full List
mod site	chr5:65552515-65552516:-		[9]
Sequence	TATCACTTATTGGAACTGAAACACTCACCGATTCAAATGCT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000514814.5; ENST00000515497.5; ENST00000515873.5; ENST00000242872.7; ENST00000510354.1; ENST00000506282.6; ENST00000502997.5; ENST00000505960.5; ENST00000510768.5; ENST00000508421.5; ENST00000396679.6; ENST00000510693.5
External Link	RMBase: m6A_site_670444
mod ID: M6ASITE069193		Click to Show/Hide the Full List
mod site	chr5:65552521-65552522:-		[9]
Sequence	ATAAATTATCACTTATTGGAACTGAAACACTCACCGATTCA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000510354.1; ENST00000502997.5; ENST00000515497.5; ENST00000515873.5; ENST00000510768.5; ENST00000514814.5; ENST00000510693.5; ENST00000505960.5; ENST00000396679.6; ENST00000242872.7; ENST00000508421.5; ENST00000506282.6
External Link	RMBase: m6A_site_670445
mod ID: M6ASITE069194		Click to Show/Hide the Full List
mod site	chr5:65554855-65554856:-		[6]
Sequence	CTACAGATGTGGGAGATGTTACAAATACTGAAGAAGAACTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000506282.6; ENST00000242872.7; ENST00000510693.5; ENST00000502997.5; ENST00000508421.5; ENST00000505960.5; ENST00000510768.5; ENST00000396679.6; ENST00000514814.5; ENST00000515873.5; ENST00000515497.5; ENST00000510354.1
External Link	RMBase: m6A_site_670446
mod ID: M6ASITE069195		Click to Show/Hide the Full List
mod site	chr5:65554921-65554922:-		[5]
Sequence	TCTTATAAGGCTAAAAATTCACAAAGCATATATCAATGAAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000514814.5; ENST00000502997.5; ENST00000510354.1; ENST00000508421.5; ENST00000506282.6; ENST00000510693.5; ENST00000396679.6; ENST00000515873.5; ENST00000515497.5; ENST00000510768.5; ENST00000505960.5; ENST00000242872.7
External Link	RMBase: m6A_site_670447
mod ID: M6ASITE069196		Click to Show/Hide the Full List
mod site	chr5:65561024-65561025:-		[8]
Sequence	TTCATTTTATAGGAAAGGAAACTGAGGCATAGAAAGTTTAA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000515873.5; ENST00000510354.1; ENST00000515497.5; ENST00000396679.6; ENST00000510693.5; ENST00000508421.5; ENST00000514814.5; ENST00000504508.1; ENST00000510768.5; ENST00000506282.6; ENST00000505960.5
External Link	RMBase: m6A_site_670448
mod ID: M6ASITE069197		Click to Show/Hide the Full List
mod site	chr5:65561481-65561482:-		[5]
Sequence	TTCCAGGTTACATACAGCTTACATCTTGCATCCTCAAGCGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000514814.5; ENST00000505960.5; ENST00000508421.5; ENST00000396679.6; ENST00000506282.6; ENST00000510693.5; ENST00000515873.5; ENST00000508311.1; ENST00000510354.1; ENST00000515497.5; ENST00000510768.5; ENST00000504508.1
External Link	RMBase: m6A_site_670449
mod ID: M6ASITE069198		Click to Show/Hide the Full List
mod site	chr5:65561492-65561493:-		[5]
Sequence	TGATGACCCTCTTCCAGGTTACATACAGCTTACATCTTGCA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000508311.1; ENST00000510693.5; ENST00000505960.5; ENST00000510354.1; ENST00000515497.5; ENST00000504508.1; ENST00000396679.6; ENST00000510768.5; ENST00000508421.5; ENST00000506282.6; ENST00000514814.5; ENST00000515873.5
External Link	RMBase: m6A_site_670450
mod ID: M6ASITE069199		Click to Show/Hide the Full List
mod site	chr5:65562853-65562854:-		[9]
Sequence	TTTCCTTTCAGATGCACTAAACATGTTTTCTCTCCTGACCT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000514814.5; ENST00000510693.5; ENST00000506282.6; ENST00000515873.5; ENST00000396679.6; ENST00000508421.5; ENST00000508311.1; ENST00000510768.5; ENST00000515497.5; ENST00000504508.1
External Link	RMBase: m6A_site_670451

Ref 1	N(6)-methyladenosine modification of CENPK mRNA by ZC3H13 promotes cervical cancer stemness and chemoresistance. Mil Med Res. 2022 Apr 14;9(1):19. doi: 10.1186/s40779-022-00378-z.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 4	Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nat Biotechnol. 2004 Aug;22(8):1001-5. doi: 10.1038/nbt996. Epub 2004 Jul 18.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 7	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 10	METTL3-mediated N6-methyladenosine modification is critical for epithelial-mesenchymal transition and metastasis of gastric cancer. Mol Cancer. 2019 Oct 13;18(1):142. doi: 10.1186/s12943-019-1065-4.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map