m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00693)
Target Name Dapper homolog 1 (DACT1)
Synonyms
hDPR1; Dapper antagonist of catenin 1; Hepatocellular carcinoma novel gene 3 protein
    Click to Show/Hide
Gene Name DACT1
Chromosomal Location 14q23.1
Family Dapper family
Function
Involved in regulation of intracellular signaling pathways during development. Specifically thought to play a role in canonical and/or non-canonical Wnt signaling pathways through interaction with DSH (Dishevelled) family proteins. The activation/inhibition of Wnt signaling may depend on the phosphorylation status. Proposed to regulate the degradation of CTNNB1/beta-catenin, thereby modulating the transcriptional activation of target genes of the Wnt signaling pathway. Its function in stabilizing CTNNB1 may involve inhibition of GSK3B activity. Promotes the membrane localization of CTNNB1. The cytoplasmic form can induce DVL2 degradation via a lysosome-dependent mechanism; the function is inhibited by PKA-induced binding to 14-3-3 proteins, such as YWHAB. Seems to be involved in morphogenesis at the primitive streak by regulating VANGL2 and DVL2; the function seems to be independent of canonical Wnt signaling and rather involves the non-canonical Wnt/planar cell polarity (PCP) pathway (By similarity). The nuclear form may prevent the formation of LEF1:CTNNB1 complex and recruit HDAC1 to LEF1 at target gene promoters to repress transcription thus antagonizing Wnt signaling. May be involved in positive regulation of fat cell differentiation. During neuronal differentiation may be involved in excitatory synapse organization, and dendrite formation and establishment of spines.
    Click to Show/Hide
Gene ID 51339
Uniprot ID
DACT1_HUMAN
HGNC ID
HGNC:17748
KEGG ID
hsa:51339
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
DACT1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line Mouse liver Mus musculus
Treatment: FTO knockout mouse liver tissue
Control: Wild type mouse liver tissue
 GSE125785
Regulation
logFC: 1.21E+00
p-value: 4.60E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary FTO could reduce the mRNA stability of Dapper homolog 1 (DACT1) via m6A demethylation, which decreased DACT1 expression and further activated the Wnt signaling pathway. The oncogenic effect of FTO on osteosarcoma was dependent on DACT1.
Target Regulation Down regulation
Responsed Disease Osteosarcoma ICD-11: 2B51
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
Osteosarcoma [ICD-11: 2B51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary FTO could reduce the mRNA stability of Dapper homolog 1 (DACT1) via m6A demethylation, which decreased DACT1 expression and further activated the Wnt signaling pathway. The oncogenic effect of FTO on osteosarcoma was dependent on DACT1.
Responsed Disease Osteosarcoma [ICD-11: 2B51]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Wnt signaling pathway hsa04310
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00693)
Dapper homolog 1 (DACT1)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006369 Click to Show/Hide the Full List
mod site chr14:58644498-58644499:+ [2]
Sequence GGCCTCAGCCTTTTGGTGTTAGGATTGCAGGCGTGAGCCAT
Transcript ID List ENST00000541264.2; ENST00000421793.5; ENST00000335867.4; ENST00000395153.7; ENST00000555845.5; ENST00000556859.5
External Link RMBase: RNA-editing_site_38694
N6-methyladenosine (m6A)
In total 36 m6A sequence/site(s) in this target gene
mod ID: M6ASITE019768 Click to Show/Hide the Full List
mod site chr14:58634152-58634153:+ [3]
Sequence CCTGGCCTTCTTCAACAAAAACCTCTTTAACAGCACTAAAA
Motif Score 2.185083333
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000555845.5; ENST00000421793.5; ENST00000556859.5
External Link RMBase: m6A_site_249453
mod ID: M6ASITE019769 Click to Show/Hide the Full List
mod site chr14:58634172-58634173:+ [3]
Sequence ACCTCTTTAACAGCACTAAAACACAGCTAAAAGGTAACCTT
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000556859.5; ENST00000421793.5; ENST00000555845.5
External Link RMBase: m6A_site_249454
mod ID: M6ASITE019770 Click to Show/Hide the Full List
mod site chr14:58638314-58638315:+ [4]
Sequence GCGGGAGAAGGGCGAGGCAGACACCGAGCGGCAGCGCACCC
Motif Score 2.897386905
Cell/Tissue List U2OS; GSC-11; HEK293T
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000335867.4; ENST00000395153.7; ENST00000555845.5; ENST00000421793.5; ENST00000556859.5
External Link RMBase: m6A_site_249455
mod ID: M6ASITE019771 Click to Show/Hide the Full List
mod site chr14:58638521-58638522:+ [3]
Sequence GGAGAAGTTCTTGGAGGAGAACATCTTGCTGCTAAGAAAGC
Motif Score 2.951386905
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000421793.5; ENST00000556859.5; ENST00000555845.5; ENST00000395153.7; ENST00000335867.4
External Link RMBase: m6A_site_249456
mod ID: M6ASITE019772 Click to Show/Hide the Full List
mod site chr14:58645509-58645510:+ [5]
Sequence CAACCCTCTGAGGGAAGAGGACAGGCTTGGAAACCATGCCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000556859.5; ENST00000421793.5; ENST00000541264.2; ENST00000335867.4
External Link RMBase: m6A_site_249457
mod ID: M6ASITE019773 Click to Show/Hide the Full List
mod site chr14:58645521-58645522:+ [5]
Sequence GGAAGAGGACAGGCTTGGAAACCATGCCAGTGACATTTGCG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000541264.2; ENST00000556859.5; ENST00000395153.7; ENST00000421793.5
External Link RMBase: m6A_site_249458
mod ID: M6ASITE019774 Click to Show/Hide the Full List
mod site chr14:58645568-58645569:+ [5]
Sequence CTGAGCTAGATGCCGTCAAAACAGACAGTTCCTTACCGTCC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000541264.2; ENST00000335867.4; ENST00000556859.5; ENST00000421793.5
External Link RMBase: m6A_site_249459
mod ID: M6ASITE019775 Click to Show/Hide the Full List
mod site chr14:58645572-58645573:+ [6]
Sequence GCTAGATGCCGTCAAAACAGACAGTTCCTTACCGTCCCCAA
Motif Score 2.897386905
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000421793.5; ENST00000541264.2; ENST00000556859.5; ENST00000395153.7
External Link RMBase: m6A_site_249460
mod ID: M6ASITE019776 Click to Show/Hide the Full List
mod site chr14:58645670-58645671:+ [5]
Sequence TGAGCCTGGTCCAGAAAAAAACACACCCTGTAAGGACCAAC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000541264.2; ENST00000421793.5; ENST00000556859.5; ENST00000395153.7
External Link RMBase: m6A_site_249461
mod ID: M6ASITE019777 Click to Show/Hide the Full List
mod site chr14:58645685-58645686:+ [5]
Sequence AAAAAACACACCCTGTAAGGACCAACAAACCAAGAACCAGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000395153.7; ENST00000421793.5; ENST00000556859.5; ENST00000541264.2
External Link RMBase: m6A_site_249462
mod ID: M6ASITE019778 Click to Show/Hide the Full List
mod site chr14:58645693-58645694:+ [5]
Sequence CACCCTGTAAGGACCAACAAACCAAGAACCAGCGTGAACGC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556859.5; ENST00000335867.4; ENST00000421793.5; ENST00000541264.2; ENST00000395153.7
External Link RMBase: m6A_site_249463
mod ID: M6ASITE019779 Click to Show/Hide the Full List
mod site chr14:58645700-58645701:+ [5]
Sequence TAAGGACCAACAAACCAAGAACCAGCGTGAACGCTGACCCC
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556859.5; ENST00000541264.2; ENST00000421793.5; ENST00000395153.7; ENST00000335867.4
External Link RMBase: m6A_site_249464
mod ID: M6ASITE019780 Click to Show/Hide the Full List
mod site chr14:58645794-58645795:+ [5]
Sequence CTCACAGGGCAACAGTGTGAACCTTAAGAATTCGAAACAGG
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000541264.2; ENST00000421793.5; ENST00000335867.4; ENST00000556859.5
External Link RMBase: m6A_site_249465
mod ID: M6ASITE019781 Click to Show/Hide the Full List
mod site chr14:58645810-58645811:+ [5]
Sequence GTGAACCTTAAGAATTCGAAACAGGCGTGTCTGCCCTCTGG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000395153.7; ENST00000421793.5; ENST00000556859.5; ENST00000335867.4
External Link RMBase: m6A_site_249466
mod ID: M6ASITE019782 Click to Show/Hide the Full List
mod site chr14:58645848-58645849:+ [5]
Sequence TGGCGGGATACCTTCTCTGAACAATGGGACATTCTCCCCAC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000556859.5; ENST00000395153.7; ENST00000541264.2; ENST00000421793.5
External Link RMBase: m6A_site_249467
mod ID: M6ASITE019783 Click to Show/Hide the Full List
mod site chr14:58645856-58645857:+ [5]
Sequence TACCTTCTCTGAACAATGGGACATTCTCCCCACCGAAGCAG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556859.5; ENST00000395153.7; ENST00000335867.4; ENST00000541264.2
External Link RMBase: m6A_site_249468
mod ID: M6ASITE019784 Click to Show/Hide the Full List
mod site chr14:58645900-58645901:+ [5]
Sequence TCGAAAGAATCAAAGGCCGAACAAGCCGAAAGCAAGAGGGT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000541264.2; ENST00000335867.4; ENST00000395153.7; ENST00000556859.5
External Link RMBase: m6A_site_249469
mod ID: M6ASITE019785 Click to Show/Hide the Full List
mod site chr14:58646008-58646009:+ [5]
Sequence GCCAAGCCAGCCTCGCAAGAACATGCTCGGTGTTCCGCCAT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000335867.4; ENST00000556859.5; ENST00000395153.7
External Link RMBase: m6A_site_249470
mod ID: M6ASITE019786 Click to Show/Hide the Full List
mod site chr14:58646033-58646034:+ [5]
Sequence CTCGGTGTTCCGCCATTGGGACAGGGGAGTCCCCTAAGGAA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000335867.4; ENST00000541264.2; ENST00000556859.5
External Link RMBase: m6A_site_249471
mod ID: M6ASITE019787 Click to Show/Hide the Full List
mod site chr14:58646121-58646122:+ [5]
Sequence CCCTGCCCCGCCGCAGGAGAACAAAGTTGTACAGCCCCTGA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hNPCs; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556859.5; ENST00000335867.4; ENST00000541264.2; ENST00000395153.7
External Link RMBase: m6A_site_249472
mod ID: M6ASITE019788 Click to Show/Hide the Full List
mod site chr14:58646160-58646161:+ [5]
Sequence GAAAAAGATGTCACAGAAAAACAGCCTGCAGGGCGTCCCCC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000556859.5; ENST00000541264.2; ENST00000395153.7
External Link RMBase: m6A_site_249473
mod ID: M6ASITE019789 Click to Show/Hide the Full List
mod site chr14:58646346-58646347:+ [5]
Sequence GCTCCACCGGGGCCACAGGAACATGGGCGTCGTGAAGAACT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; GM12878; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000556859.5; ENST00000395153.7; ENST00000541264.2
External Link RMBase: m6A_site_249474
mod ID: M6ASITE019790 Click to Show/Hide the Full List
mod site chr14:58646364-58646365:+ [5]
Sequence GAACATGGGCGTCGTGAAGAACTCCAGCCTGAAGCACCGCG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; GM12878; peripheral-blood; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000395153.7; ENST00000556859.5; ENST00000541264.2
External Link RMBase: m6A_site_249475
mod ID: M6ASITE019791 Click to Show/Hide the Full List
mod site chr14:58646491-58646492:+ [5]
Sequence GACTTGGATACAAATAAGAAACTCAAGAAAGCCTCCTCCAA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; fibroblasts; GM12878; H1299; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000556859.5; ENST00000395153.7; ENST00000335867.4
External Link RMBase: m6A_site_249476
mod ID: M6ASITE019792 Click to Show/Hide the Full List
mod site chr14:58646626-58646627:+ [5]
Sequence CGGGAGGCGGTGGTGGCCAAACCTAAGCACAAGCGAACTGA
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; H1299; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000395153.7; ENST00000556859.5; ENST00000335867.4
External Link RMBase: m6A_site_249477
mod ID: M6ASITE019793 Click to Show/Hide the Full List
mod site chr14:58646642-58646643:+ [5]
Sequence CCAAACCTAAGCACAAGCGAACTGACTACCGGCGGTGGAAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; H1299; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000648996.1; ENST00000541264.2; ENST00000395153.7; ENST00000556859.5
External Link RMBase: m6A_site_249478
mod ID: M6ASITE019794 Click to Show/Hide the Full List
mod site chr14:58646841-58646842:+ [5]
Sequence GTTCCACTCCACCGTGGTGGACACCAGTGAGGACGAGCAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000556859.5; ENST00000648996.1; ENST00000335867.4; ENST00000395153.7
External Link RMBase: m6A_site_249479
mod ID: M6ASITE019795 Click to Show/Hide the Full List
mod site chr14:58646889-58646890:+ [5]
Sequence CACCACCAACTGCTTCGGGGACAGCGAGTCGAGTGTGAGCG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000648996.1; ENST00000335867.4; ENST00000395153.7; ENST00000556859.5; ENST00000541264.2
External Link RMBase: m6A_site_249480
mod ID: M6ASITE019796 Click to Show/Hide the Full List
mod site chr14:58646990-58646991:+ [5]
Sequence TTTGGTCCCAGTTTGTCCAGACTCTGCCCATTCAAACGGTA
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000335867.4; ENST00000648996.1; ENST00000541264.2; ENST00000556859.5
External Link RMBase: m6A_site_249481
mod ID: M6ASITE019797 Click to Show/Hide the Full List
mod site chr14:58647021-58647022:+ [5]
Sequence TCAAACGGTAACGGCCCCAGACCTTCACAACCACCCCGCAA
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000335867.4; ENST00000541264.2; ENST00000648996.1; ENST00000556859.5; ENST00000395153.7
External Link RMBase: m6A_site_249482
mod ID: M6ASITE019798 Click to Show/Hide the Full List
mod site chr14:58647027-58647028:+ [7]
Sequence GGTAACGGCCCCAGACCTTCACAACCACCCCGCAAAAACCT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000541264.2; ENST00000395153.7; ENST00000335867.4; ENST00000556859.5; ENST00000648996.1
External Link RMBase: m6A_site_249483
mod ID: M6ASITE019799 Click to Show/Hide the Full List
mod site chr14:58647044-58647045:+ [5]
Sequence TTCACAACCACCCCGCAAAAACCTTTGTCAAAATTAAGGCC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541264.2; ENST00000395153.7; ENST00000648996.1; ENST00000556859.5; ENST00000335867.4
External Link RMBase: m6A_site_249484
mod ID: M6ASITE019800 Click to Show/Hide the Full List
mod site chr14:58647067-58647068:+ [7]
Sequence TTTGTCAAAATTAAGGCCTCACATAACCTCAAGAAGAAGAT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000335867.4; ENST00000395153.7; ENST00000556859.5; ENST00000648996.1; ENST00000541264.2
External Link RMBase: m6A_site_249485
mod ID: M6ASITE019801 Click to Show/Hide the Full List
mod site chr14:58647115-58647116:+ [5]
Sequence TTTCGGTCTGGCTCTTTGAAACTGATGACGACGGTTTGAGT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; H1B; H1A; hNPCs; fibroblasts; GM12878; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000395153.7; ENST00000541264.2; ENST00000335867.4; ENST00000556859.5; ENST00000648996.1
External Link RMBase: m6A_site_249486
mod ID: M6ASITE019802 Click to Show/Hide the Full List
mod site chr14:58647570-58647571:+ [7]
Sequence CCTGTTGAGGGGCACCACATACAATAGTGTGAAGTAGGTAT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395153.7; ENST00000648996.1
External Link RMBase: m6A_site_249487
mod ID: M6ASITE019803 Click to Show/Hide the Full List
mod site chr14:58647632-58647633:+ [7]
Sequence ATAGTTTTTTTATGTAGTCTACATTTCTCAGATGTATCCCC
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395153.7; ENST00000648996.1
External Link RMBase: m6A_site_249488