m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00691)
Target Name Long intergenic non-protein coding RNA 1833 (LINC01833)
Synonyms
RP11-89; K21.1
    Click to Show/Hide
Gene Name LINC01833
Chromosomal Location 2p21
Gene ID 107985879
HGNC ID
HGNC:52644
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC01833 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line ARPE-19 cell line Homo sapiens
Treatment: shMETTL3 ARPE-19 cells
Control: shControl ARPE-19 cells
 GSE202017
Regulation
logFC: 1.55E+00
p-value: 2.63E-05
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between LINC01833 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 7.09E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A transferase METTL3-induced Long intergenic non-protein coding RNA 1833 (LINC01833) m6A methylation promotes NSCLC progression through modulating HNRNPA2B1 expression.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model NCI-H1650 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1483
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
BEAS-2B Normal Homo sapiens CVCL_0168
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
In-vivo Model For the tumorigenicity studies, 3 × 106 HCC827 cells stably expressing sh-LINC01833 or sh-NC were injected subcutaneously into the ventral side of male BALB/c nude mice in the according groups with five mice in each group. Five mice were sampled each time. Tumor size and weight were examined at 28 days after injection.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A transferase METTL3-induced Long intergenic non-protein coding RNA 1833 (LINC01833) m6A methylation promotes NSCLC progression through modulating HNRNPA2B1 expression.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell apoptosis
In-vitro Model NCI-H1650 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1483
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
BEAS-2B Normal Homo sapiens CVCL_0168
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
In-vivo Model For the tumorigenicity studies, 3 × 106 HCC827 cells stably expressing sh-LINC01833 or sh-NC were injected subcutaneously into the ventral side of male BALB/c nude mice in the according groups with five mice in each group. Five mice were sampled each time. Tumor size and weight were examined at 28 days after injection.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05620
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 1833 (LINC01833)
Regulated Target Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship m6A → ncRNA
Disease Non-small cell lung cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00691)
Long intergenic non-protein coding RNA 1833 (LINC01833)
N6-methyladenosine (m6A)
In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE044387 Click to Show/Hide the Full List
mod site chr2:44921584-44921585:- [2]
Sequence TGTTATAGCAGCCCAGATGGACTAGGCCACCACCATAGTCA
Motif Score 4.065041667
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List rmsk_527290; ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470747
mod ID: M6ASITE044388 Click to Show/Hide the Full List
mod site chr2:44921646-44921647:- [2]
Sequence AGTCTCCAGAACTGTGGGAAACACATTTCTGTTGTTTATGA
Motif Score 2.20572619
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List rmsk_527290; ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470748
mod ID: M6ASITE044389 Click to Show/Hide the Full List
mod site chr2:44921656-44921657:- [2]
Sequence CGGACTTCCCAGTCTCCAGAACTGTGGGAAACACATTTCTG
Motif Score 3.373380952
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List rmsk_527290; ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470749
mod ID: M6ASITE044391 Click to Show/Hide the Full List
mod site chr2:44922238-44922239:- [3]
Sequence AAAAAAAAAAGAAAAAGAAAACTGACTCTGAATCATAAATC
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000560399.1; ENST00000437916.2
External Link RMBase: m6A_site_470750
mod ID: M6ASITE044392 Click to Show/Hide the Full List
mod site chr2:44922510-44922511:- [3]
Sequence AAGCAGAAACCAAGGAGAAAACATTTGATATCAGCAAATTC
Motif Score 2.20572619
Cell/Tissue List Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000560399.1; ENST00000437916.2
External Link RMBase: m6A_site_470751
mod ID: M6ASITE044393 Click to Show/Hide the Full List
mod site chr2:44922522-44922523:- [3]
Sequence TCAGACCTGGGCAAGCAGAAACCAAGGAGAAAACATTTGAT
Motif Score 2.185083333
Cell/Tissue List Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000560399.1; ENST00000437916.2
External Link RMBase: m6A_site_470752
mod ID: M6ASITE044394 Click to Show/Hide the Full List
mod site chr2:44922538-44922539:- [3]
Sequence TTATAAGCTGCACCACTCAGACCTGGGCAAGCAGAAACCAA
Motif Score 2.876744048
Cell/Tissue List Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000560399.1; ENST00000437916.2
External Link RMBase: m6A_site_470753
mod ID: M6ASITE044395 Click to Show/Hide the Full List
mod site chr2:44922563-44922564:- [3]
Sequence CCACACTTCTGCAAGCAGAGACTAATTATAAGCTGCACCAC
Motif Score 3.319380952
Cell/Tissue List Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470754
mod ID: M6ASITE044396 Click to Show/Hide the Full List
mod site chr2:44922584-44922585:- [3]
Sequence TTAATCCTCAAGTCTTTGGAACCACACTTCTGCAAGCAGAG
Motif Score 2.930744048
Cell/Tissue List Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000560399.1; ENST00000437916.2
External Link RMBase: m6A_site_470755
mod ID: M6ASITE044397 Click to Show/Hide the Full List
mod site chr2:44922664-44922665:- [4]
Sequence CTGTGAAAAATCTTTAATGGACTAAGTGTAGCTTTTCATGT
Motif Score 4.065041667
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470756
mod ID: M6ASITE044398 Click to Show/Hide the Full List
mod site chr2:44922760-44922761:- [5]
Sequence TGTTTTGTTCTTCATAGCAAACTCCTTTCCGACACCCGTGC
Motif Score 2.627720238
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000437916.2; ENST00000560399.1
External Link RMBase: m6A_site_470757
mod ID: M6ASITE044399 Click to Show/Hide the Full List
mod site chr2:44923158-44923159:- [4]
Sequence CCAGAAAATATGTCTCAGAGACAGCCAGTGGCTGCACATAC
Motif Score 2.897386905
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470758
mod ID: M6ASITE044400 Click to Show/Hide the Full List
mod site chr2:44923180-44923181:- [4]
Sequence CAGCAAGCTGGTGTGGGAAAACCCAGAAAATATGTCTCAGA
Motif Score 2.185083333
Cell/Tissue List iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470759
mod ID: M6ASITE044402 Click to Show/Hide the Full List
mod site chr2:44923212-44923213:- [3]
Sequence GGGAGTAGAGGGGTCTGTAGACACAGCAAAAGCAGCAAGCT
Motif Score 2.897386905
Cell/Tissue List Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2
External Link RMBase: m6A_site_470760
mod ID: M6ASITE044403 Click to Show/Hide the Full List
mod site chr2:44923303-44923304:- [5]
Sequence TCTTTATATGGCATGTGAGGACTGCATCCCACGTCACATCT
Motif Score 4.065041667
Cell/Tissue List A549; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2
External Link RMBase: m6A_site_470761
mod ID: M6ASITE044404 Click to Show/Hide the Full List
mod site chr2:44923362-44923363:- [5]
Sequence ATTCTTTTCTTGAGTGAGAGACTGAAATTTTGGCTCAAGGG
Motif Score 3.319380952
Cell/Tissue List A549; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470762
mod ID: M6ASITE044405 Click to Show/Hide the Full List
mod site chr2:44923393-44923394:- [3]
Sequence ATTTTCACATTAACCAGGAGACACATTGAAAATTCTTTTCT
Motif Score 2.897386905
Cell/Tissue List Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470763
mod ID: M6ASITE044406 Click to Show/Hide the Full List
mod site chr2:44923438-44923439:- [6]
Sequence GGCCAGGGCACCAAGAATGAACCAGAAGCTGAGTCCATTAC
Motif Score 2.930744048
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470764
mod ID: M6ASITE044407 Click to Show/Hide the Full List
mod site chr2:44923509-44923510:- [6]
Sequence CCCAAGCTGAATTCTGAAGAACACTTGGCCCCATCTTCCAG
Motif Score 2.951386905
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2
External Link RMBase: m6A_site_470765
mod ID: M6ASITE044408 Click to Show/Hide the Full List
mod site chr2:44923538-44923539:- [6]
Sequence AGCTGAGGAGGAAGAAGGGAACATCTCAACCCAAGCTGAAT
Motif Score 2.951386905
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2
External Link RMBase: m6A_site_470766
mod ID: M6ASITE044409 Click to Show/Hide the Full List
mod site chr2:44923566-44923567:- [6]
Sequence CTCTGCAGGAAAGTCTGGAGACTCACCAAGCTGAGGAGGAA
Motif Score 3.319380952
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2
External Link RMBase: m6A_site_470767
mod ID: M6ASITE044410 Click to Show/Hide the Full List
mod site chr2:44931216-44931217:- [7]
Sequence GTCTTCTCTTTTGGGGGCAAACACTATGTCCTTTTCTTTTT
Motif Score 2.20572619
Cell/Tissue List H1B
Seq Type List m6A-seq
Transcript ID List ENST00000444871.2; ENST00000430847.2; ENST00000437916.2; ENST00000432125.2
External Link RMBase: m6A_site_470768
mod ID: M6ASITE044411 Click to Show/Hide the Full List
mod site chr2:44931260-44931261:- [7]
Sequence CAGATGTAGTTGCCCTAGAAACAGAAGAGTATGGGGGTGTG
Motif Score 2.20572619
Cell/Tissue List H1B; hESCs
Seq Type List m6A-seq
Transcript ID List ENST00000432125.2; ENST00000437916.2; ENST00000444871.2; ENST00000430847.2
External Link RMBase: m6A_site_470769
mod ID: M6ASITE044413 Click to Show/Hide the Full List
mod site chr2:44931291-44931292:- [8]
Sequence CCGGAAAACGCCACAGGAGGACATGTTTCTGCAGATGTAGT
Motif Score 3.643047619
Cell/Tissue List A549; H1B; hESCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000437916.2; ENST00000430847.2; ENST00000444871.2; ENST00000432125.2
External Link RMBase: m6A_site_470770
mod ID: M6ASITE044414 Click to Show/Hide the Full List
mod site chr2:44935466-44935467:- [7]
Sequence GATGAGGGGGGCGTTGGGGGACAGGGCAAAGTCGATCTTGG
Motif Score 3.643047619
Cell/Tissue List H1B; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000437916.2; ENST00000444871.2; ENST00000432125.2
External Link RMBase: m6A_site_470771
mod ID: M6ASITE044415 Click to Show/Hide the Full List
mod site chr2:44939120-44939121:- [7]
Sequence CTGAGGCAAGTGGGGCTGAGACTCTGGCGACACCCCCGCCC
Motif Score 3.319380952
Cell/Tissue List H1A; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000437916.2
External Link RMBase: m6A_site_470774
mod ID: M6ASITE044416 Click to Show/Hide the Full List
mod site chr2:44939141-44939142:- [7]
Sequence ACCATCGCCACTCAGGGAGAACTGAGGCAAGTGGGGCTGAG
Motif Score 3.373380952
Cell/Tissue List H1A; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000437916.2
External Link RMBase: m6A_site_470775
mod ID: M6ASITE044417 Click to Show/Hide the Full List
mod site chr2:44939161-44939162:- [7]
Sequence CGAAAGCGCTGAAATAAAAAACCATCGCCACTCAGGGAGAA
Motif Score 2.185083333
Cell/Tissue List H1A; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000437916.2
External Link RMBase: m6A_site_470776