m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00689)

Target Name	Prominin-1 (CD133)
Synonyms	Antigen AC133; Prominin-like protein 1; CD133 Click to Show/Hide
Gene Name	CD133
Chromosomal Location	4p15.32
Family	Prominin family
Function	May play a role in cell differentiation, proliferation and apoptosis. Binds cholesterol in cholesterol-containing plasma membrane microdomains and may play a role in the organization of the apical plasma membrane in epithelial cells. During early retinal development acts as a key regulator of disk morphogenesis. Involved in regulation of MAPK and Akt signaling pathways. In neuroblastoma cells suppresses cell differentiation such as neurite outgrowth in a RET-dependent manner. Click to Show/Hide
Gene ID	8842
Uniprot ID	PROM1_HUMAN
HGNC ID	HGNC:9454
KEGG ID	hsa:8842

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CD133 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -7.09E-01 p-value: 5.71E-66
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL3 downregulated protein levels of SOX2, Prominin-1 (CD133) and CD44 in MCF-7 cells. METTL3 is upregulated in breast cancer, and it promotes the stemness and malignant progression of BCa through mediating m6A modification on SOX2 mRNA.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL3 downregulated protein levels of SOX2, Prominin-1 (CD133) and CD44 in MCF-7 cells. METTL3 is upregulated in breast cancer, and it promotes the stemness and malignant progression of BCa through mediating m6A modification on SOX2 mRNA.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00689)

Prominin-1 (CD133)

Adenosine-to-Inosine editing (A-to-I)

In total 17 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000279		Click to Show/Hide the Full List
mod site	chr4:15971839-15971840:-		[4]
Sequence	TTTCTAAAGTGAAAAACTTTAGAAGGAATGTCTTGCCTGGC
Transcript ID List	ENST00000510224.5; ENST00000513448.5; ENST00000447510.6; ENST00000505450.5; ENST00000513946.1; ENST00000508167.5; ENST00000540805.5; ENST00000539194.5; ENST00000503884.5
External Link	RMBase: RNA-editing_site_103334
mod ID: A2ISITE000280		Click to Show/Hide the Full List
mod site	chr4:15972366-15972367:-		[4]
Sequence	GCGTCATGAAAGCCCTCACCAGATGCCAGCACCAGGTTCTT
Transcript ID List	ENST00000540805.5; ENST00000513946.1; ENST00000510224.5; ENST00000503884.5; ENST00000447510.6; ENST00000505450.5; ENST00000539194.5; rmsk_1248289; ENST00000508167.5
External Link	RMBase: RNA-editing_site_103335
mod ID: A2ISITE000281		Click to Show/Hide the Full List
mod site	chr4:15973208-15973209:-		[5]
Sequence	AGTGATCTACCCAAATTGCTAGATTACAGGCATGAGCCACT
Transcript ID List	ENST00000447510.6; ENST00000539194.5; ENST00000540805.5; ENST00000510224.5; ENST00000505450.5; ENST00000503884.5; ENST00000513946.1; ENST00000508167.5
External Link	RMBase: RNA-editing_site_103336
mod ID: A2ISITE000282		Click to Show/Hide the Full List
mod site	chr4:15973297-15973298:-		[5]
Sequence	CACACCACCGTGCTCAGCTAATTTTTCTGTTATTAGTAGAG
Transcript ID List	ENST00000513946.1; ENST00000508167.5; ENST00000510224.5; ENST00000505450.5; ENST00000447510.6; ENST00000540805.5; ENST00000539194.5; ENST00000503884.5
External Link	RMBase: RNA-editing_site_103337
mod ID: A2ISITE000283		Click to Show/Hide the Full List
mod site	chr4:15973298-15973299:-		[5]
Sequence	ACACACCACCGTGCTCAGCTAATTTTTCTGTTATTAGTAGA
Transcript ID List	ENST00000539194.5; ENST00000513946.1; ENST00000447510.6; ENST00000510224.5; ENST00000540805.5; ENST00000505450.5; ENST00000503884.5; ENST00000508167.5
External Link	RMBase: RNA-editing_site_103338
mod ID: A2ISITE000284		Click to Show/Hide the Full List
mod site	chr4:15973324-15973325:-		[5]
Sequence	CCTCCTGAGTAGCTGGGATTACAGGCACACACCACCGTGCT
Transcript ID List	ENST00000539194.5; ENST00000447510.6; ENST00000513946.1; ENST00000508167.5; ENST00000505450.5; ENST00000503884.5; ENST00000540805.5; ENST00000510224.5
External Link	RMBase: RNA-editing_site_103339
mod ID: A2ISITE000285		Click to Show/Hide the Full List
mod site	chr4:15973363-15973364:-		[5]
Sequence	ACCTCCACCTCCTGGGTTCAAGCGATTCTTGTGCTTCAGCC
Transcript ID List	ENST00000447510.6; ENST00000540805.5; ENST00000505450.5; ENST00000508167.5; ENST00000513946.1; ENST00000510224.5; ENST00000539194.5; ENST00000503884.5
External Link	RMBase: RNA-editing_site_103340
mod ID: A2ISITE000286		Click to Show/Hide the Full List
mod site	chr4:15973408-15973409:-		[5]
Sequence	TGTCACACAGGCTGGAATGCAGTGGTGTGATCTCAGCTCAC
Transcript ID List	ENST00000503884.5; ENST00000510224.5; ENST00000513946.1; ENST00000508167.5; ENST00000539194.5; ENST00000505450.5; ENST00000447510.6; ENST00000540805.5
External Link	RMBase: RNA-editing_site_103341
mod ID: A2ISITE000287		Click to Show/Hide the Full List
mod site	chr4:15973412-15973413:-		[5]
Sequence	ACTCTGTCACACAGGCTGGAATGCAGTGGTGTGATCTCAGC
Transcript ID List	ENST00000539194.5; ENST00000503884.5; ENST00000505450.5; ENST00000508167.5; ENST00000540805.5; ENST00000513946.1; ENST00000510224.5; ENST00000447510.6
External Link	RMBase: RNA-editing_site_103342
mod ID: A2ISITE000288		Click to Show/Hide the Full List
mod site	chr4:15976980-15976981:-		[4]
Sequence	TGGGCTAATCATTACAGATTAGCTAAGTCTTTGCACCCCCT
Transcript ID List	ENST00000505450.5; ENST00000447510.6; ENST00000510224.5; ENST00000508167.5; ENST00000513946.1; ENST00000503884.5; ENST00000540805.5; ENST00000539194.5
External Link	RMBase: RNA-editing_site_103343
mod ID: A2ISITE000289		Click to Show/Hide the Full List
mod site	chr4:15977891-15977892:-		[5]
Sequence	AAAAATCAAGTTCTTGGCCAAGCGCGGTGGCTCATGCCTGT
Transcript ID List	ENST00000513946.1; ENST00000447510.6; ENST00000503884.5; ENST00000508167.5; ENST00000505450.5; ENST00000540805.5; ENST00000539194.5; rmsk_1248300; ENST00000510224.5
External Link	RMBase: RNA-editing_site_103344
mod ID: A2ISITE000290		Click to Show/Hide the Full List
mod site	chr4:15977892-15977893:-		[5]
Sequence	AAAAAATCAAGTTCTTGGCCAAGCGCGGTGGCTCATGCCTG
Transcript ID List	ENST00000503884.5; rmsk_1248300; ENST00000508167.5; ENST00000510224.5; ENST00000540805.5; ENST00000539194.5; ENST00000505450.5; ENST00000513946.1; ENST00000447510.6
External Link	RMBase: RNA-editing_site_103345
mod ID: A2ISITE000291		Click to Show/Hide the Full List
mod site	chr4:15978233-15978234:-		[5]
Sequence	GAGTGCATTCCAGCTGCTATAATGAAATGCCTTAAACTGGG
Transcript ID List	ENST00000510224.5; ENST00000539194.5; ENST00000508167.5; ENST00000540805.5; ENST00000447510.6; ENST00000513946.1; ENST00000503884.5; ENST00000505450.5
External Link	RMBase: RNA-editing_site_103346
mod ID: A2ISITE000292		Click to Show/Hide the Full List
mod site	chr4:15978235-15978236:-		[5]
Sequence	CTGAGTGCATTCCAGCTGCTATAATGAAATGCCTTAAACTG
Transcript ID List	ENST00000513946.1; ENST00000540805.5; ENST00000510224.5; ENST00000503884.5; ENST00000505450.5; ENST00000447510.6; ENST00000539194.5; ENST00000508167.5
External Link	RMBase: RNA-editing_site_103347
mod ID: A2ISITE000293		Click to Show/Hide the Full List
mod site	chr4:16009917-16009918:-		[5]
Sequence	TTTTGAGAGCGAGTCTTGCTATGTCACCCAGGCTGGAGTAC
Transcript ID List	ENST00000511153.5; ENST00000508167.5; ENST00000540805.5; ENST00000505450.5; ENST00000510224.5; ENST00000539194.5; ENST00000447510.6
External Link	RMBase: RNA-editing_site_103348
mod ID: A2ISITE000294		Click to Show/Hide the Full List
mod site	chr4:16042031-16042032:-		[5]
Sequence	CGTTTGAAGCCGGGGGTTTAAGACTAGCCTGGGCAACATTG
Transcript ID List	ENST00000511153.5; ENST00000539194.5; ENST00000508167.5; ENST00000510224.5; ENST00000540805.5; ENST00000505450.5; ENST00000447510.6; rmsk_1248424
External Link	RMBase: RNA-editing_site_103349
mod ID: A2ISITE000295		Click to Show/Hide the Full List
mod site	chr4:16042032-16042033:-		[5]
Sequence	TCGTTTGAAGCCGGGGGTTTAAGACTAGCCTGGGCAACATT
Transcript ID List	ENST00000505450.5; ENST00000540805.5; ENST00000508167.5; ENST00000511153.5; ENST00000447510.6; rmsk_1248424; ENST00000539194.5; ENST00000510224.5
External Link	RMBase: RNA-editing_site_103350

N6-methyladenosine (m6A)

In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE065307		Click to Show/Hide the Full List
mod site	chr4:15968338-15968339:-		[6]
Sequence	AGCAATGAAGAACTGGTCGGACAAAATTTAACGTTGATGTA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; fibroblasts
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000505450.5; ENST00000447510.6; ENST00000508167.5; ENST00000513448.5; ENST00000510224.5; ENST00000540805.5; ENST00000503884.5; ENST00000509331.1; ENST00000539194.5
External Link	RMBase: m6A_site_632485
mod ID: M6ASITE065308		Click to Show/Hide the Full List
mod site	chr4:15968347-15968348:-		[7]
Sequence	AAAGTGATCAGCAATGAAGAACTGGTCGGACAAAATTTAAC
Motif Score	3.373380952
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000508167.5; ENST00000540805.5; ENST00000513448.5; ENST00000539194.5; ENST00000510224.5; ENST00000509331.1; ENST00000503884.5; ENST00000505450.5; ENST00000447510.6
External Link	RMBase: m6A_site_632486
mod ID: M6ASITE065309		Click to Show/Hide the Full List
mod site	chr4:15968421-15968422:-		[6]
Sequence	CCCTAAATTTGCATGAAAGCACAAGGTAAATATTCATTTGC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000540805.5; ENST00000509331.1; ENST00000503884.5; ENST00000510224.5; ENST00000505450.5; ENST00000539194.5; ENST00000508167.5; ENST00000513448.5; ENST00000447510.6
External Link	RMBase: m6A_site_632487
mod ID: M6ASITE065310		Click to Show/Hide the Full List
mod site	chr4:15968490-15968491:-		[6]
Sequence	AAATATGAGAAGATCCTGTCACAATTCTTAGATCTGGTGTC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000539194.5; ENST00000447510.6; ENST00000503884.5; ENST00000509331.1; ENST00000508167.5; ENST00000540805.5; ENST00000513448.5; ENST00000510224.5; ENST00000505450.5
External Link	RMBase: m6A_site_632488
mod ID: M6ASITE065311		Click to Show/Hide the Full List
mod site	chr4:15968550-15968551:-		[6]
Sequence	CATTAATTGGAGTGCAGCTAACATGAGTATCATCAGACTAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000508167.5; ENST00000513448.5; ENST00000509331.1; ENST00000539194.5; ENST00000505450.5; ENST00000510224.5; ENST00000447510.6; ENST00000503884.5; ENST00000540805.5
External Link	RMBase: m6A_site_632489
mod ID: M6ASITE065312		Click to Show/Hide the Full List
mod site	chr4:15968917-15968918:-		[6]
Sequence	GTTACCACAGAGTTTTTTAAACAAATGAGTATTATAGGACT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000513448.5; ENST00000447510.6; ENST00000503884.5; ENST00000540805.5; ENST00000505450.5; ENST00000508167.5; ENST00000539194.5; ENST00000510224.5; ENST00000509331.1
External Link	RMBase: m6A_site_632490
mod ID: M6ASITE065313		Click to Show/Hide the Full List
mod site	chr4:15969055-15969056:-		[8]
Sequence	TTGGATGCATTTCTATCAAAACTCTATCAAATGTGATGGCT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000510224.5; ENST00000540805.5; ENST00000447510.6; ENST00000513448.5; ENST00000509331.1; ENST00000508167.5; ENST00000503884.5; ENST00000539194.5; ENST00000505450.5
External Link	RMBase: m6A_site_632491
mod ID: M6ASITE065314		Click to Show/Hide the Full List
mod site	chr4:15969105-15969106:-		[8]
Sequence	TACACTGAGTTTCTATTTAGACACTACAACATATGGGGTGT
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000540805.5; ENST00000539194.5; ENST00000513946.1; ENST00000505450.5; ENST00000503884.5; ENST00000513448.5; ENST00000509331.1; ENST00000508167.5; ENST00000510224.5; ENST00000447510.6
External Link	RMBase: m6A_site_632492
mod ID: M6ASITE065315		Click to Show/Hide the Full List
mod site	chr4:15969208-15969209:-		[9]
Sequence	GGGTAGTGCTTTAAGAATGAACACAATCACGTTATAGTCCA
Motif Score	2.951386905
Cell/Tissue List	HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000540805.5; ENST00000509331.1; ENST00000510224.5; ENST00000505450.5; ENST00000513448.5; ENST00000508167.5; ENST00000539194.5; ENST00000447510.6; ENST00000513946.1; ENST00000503884.5
External Link	RMBase: m6A_site_632493
mod ID: M6ASITE065316		Click to Show/Hide the Full List
mod site	chr4:15969307-15969308:-		[10]
Sequence	TAGTTTCTGGGTCTACAAGGACTTTCCAAATCCAGGAGCAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000513448.5; ENST00000509331.1; ENST00000540805.5; ENST00000505450.5; ENST00000510224.5; ENST00000508167.5; ENST00000513946.1; ENST00000447510.6; ENST00000539194.5; ENST00000503884.5
External Link	RMBase: m6A_site_632494
mod ID: M6ASITE065317		Click to Show/Hide the Full List
mod site	chr4:15984278-15984279:-		[6]
Sequence	TGATGTCTTTCTGTGTAGCTACATTATCGACCCCTTGGTAA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000503884.5; ENST00000508167.5; ENST00000510224.5; ENST00000539194.5; ENST00000540805.5; ENST00000447510.6; ENST00000505450.5; ENST00000513946.1
External Link	RMBase: m6A_site_632495
mod ID: M6ASITE065318		Click to Show/Hide the Full List
mod site	chr4:15985786-15985787:-		[6]
Sequence	ACAATAATAGGATATTTTGAACATTATCTGCAGTGGATCGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000539194.5; ENST00000513946.1; ENST00000505450.5; ENST00000540805.5; ENST00000508167.5; ENST00000447510.6; ENST00000511270.1; ENST00000510224.5
External Link	RMBase: m6A_site_632496
mod ID: M6ASITE065319		Click to Show/Hide the Full List
mod site	chr4:16018503-16018504:-		[11]
Sequence	AGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGC
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000508167.5; ENST00000540805.5; ENST00000511153.5; ENST00000505450.5; ENST00000502943.1; ENST00000447510.6; ENST00000510224.5; ENST00000539194.5
External Link	RMBase: m6A_site_632497
mod ID: M6ASITE065320		Click to Show/Hide the Full List
mod site	chr4:16018509-16018510:-		[12]
Sequence	GACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGA
Motif Score	2.951386905
Cell/Tissue List	CD34; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000502943.1; ENST00000539194.5; ENST00000508167.5; ENST00000510224.5; ENST00000540805.5; ENST00000505450.5; ENST00000511153.5; ENST00000447510.6
External Link	RMBase: m6A_site_632498
mod ID: M6ASITE065321		Click to Show/Hide the Full List
mod site	chr4:16018528-16018529:-		[12]
Sequence	TTTCCATAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAAC
Motif Score	2.876744048
Cell/Tissue List	CD34; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000539194.5; ENST00000540805.5; ENST00000511153.5; ENST00000505450.5; ENST00000510224.5; ENST00000502943.1; ENST00000508167.5; ENST00000447510.6
External Link	RMBase: m6A_site_632499
mod ID: M6ASITE065322		Click to Show/Hide the Full List
mod site	chr4:16023371-16023372:-		[12]
Sequence	GGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCT
Motif Score	2.876744048
Cell/Tissue List	CD34; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000508167.5; ENST00000511153.5; ENST00000502943.1; ENST00000540805.5; ENST00000510224.5; ENST00000539194.5; ENST00000505450.5; ENST00000447510.6
External Link	RMBase: m6A_site_632500
mod ID: M6ASITE065323		Click to Show/Hide the Full List
mod site	chr4:16024296-16024297:-		[12]
Sequence	CAAGGCGTTCACAGATCTGAACAGTGAGTAAAATTTAAAGT
Motif Score	2.951386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000510224.5; ENST00000505450.5; ENST00000447510.6; ENST00000540805.5; ENST00000508167.5; ENST00000502943.1; ENST00000511153.5; ENST00000539194.5
External Link	RMBase: m6A_site_632501
mod ID: M6ASITE065324		Click to Show/Hide the Full List
mod site	chr4:16024317-16024318:-		[12]
Sequence	CCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGA
Motif Score	3.643047619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000511153.5; ENST00000447510.6; ENST00000508167.5; ENST00000505450.5; ENST00000539194.5; ENST00000502943.1; ENST00000510224.5; ENST00000540805.5
External Link	RMBase: m6A_site_632502
mod ID: M6ASITE065325		Click to Show/Hide the Full List
mod site	chr4:16025199-16025200:-		[12]
Sequence	TGCGAACTCTCTTGAATGAAACTCCAGAGGTAAAAACCATC
Motif Score	2.627720238
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000505450.5; ENST00000539194.5; ENST00000508167.5; ENST00000511153.5; ENST00000510224.5; ENST00000447510.6; ENST00000502943.1; ENST00000540805.5
External Link	RMBase: m6A_site_632503
mod ID: M6ASITE065326		Click to Show/Hide the Full List
mod site	chr4:16025214-16025215:-		[12]
Sequence	GCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCA
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000510224.5; ENST00000511153.5; ENST00000540805.5; ENST00000505450.5; ENST00000539194.5; ENST00000508167.5; ENST00000447510.6; ENST00000502943.1
External Link	RMBase: m6A_site_632504
mod ID: M6ASITE065327		Click to Show/Hide the Full List
mod site	chr4:16025222-16025223:-		[12]
Sequence	GGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATG
Motif Score	4.065041667
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000539194.5; ENST00000511153.5; ENST00000447510.6; ENST00000502943.1; ENST00000505450.5; ENST00000540805.5; ENST00000510224.5; ENST00000508167.5
External Link	RMBase: m6A_site_632505
mod ID: M6ASITE065328		Click to Show/Hide the Full List
mod site	chr4:16025245-16025246:-		[12]
Sequence	CGGATCAAAAGGAGTCGGAAACTGGCAGATAGCAATTTCAA
Motif Score	2.627720238
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000502943.1; ENST00000540805.5; ENST00000510224.5; ENST00000447510.6; ENST00000505450.5; ENST00000539194.5; ENST00000511153.5; ENST00000508167.5
External Link	RMBase: m6A_site_632506
mod ID: M6ASITE065329		Click to Show/Hide the Full List
mod site	chr4:16025268-16025269:-		[12]
Sequence	TGGCAAATCACCAGGTAAGAACCCGGATCAAAAGGAGTCGG
Motif Score	2.930744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000540805.5; ENST00000511153.5; ENST00000502943.1; ENST00000539194.5; ENST00000510224.5; ENST00000505450.5; ENST00000508167.5; ENST00000447510.6
External Link	RMBase: m6A_site_632507
mod ID: M6ASITE065330		Click to Show/Hide the Full List
mod site	chr4:16038981-16038982:-		[13]
Sequence	GATACTTTGAGAAAATTCTTACAGAAGGCATATGAATCCAA
Motif Score	2.07285119
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000508167.5; ENST00000540805.5; ENST00000505450.5; ENST00000511153.5; ENST00000539194.5; ENST00000447510.6; ENST00000510224.5
External Link	RMBase: m6A_site_632508
mod ID: M6ASITE065331		Click to Show/Hide the Full List
mod site	chr4:16055280-16055281:-		[8]
Sequence	CAGCCTCCTGAGTAGCTGGAACTGTAGACGTAAGCCACCAT
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000540805.5; ENST00000511153.5; ENST00000508167.5; ENST00000539194.5; ENST00000447510.6; ENST00000510224.5; ENST00000505450.5
External Link	RMBase: m6A_site_632509
mod ID: M6ASITE065332		Click to Show/Hide the Full List
mod site	chr4:16055442-16055443:-		[9]
Sequence	CTTCCATTTTGTAGATGAGAACACAAAGGCCCAGATAGGAG
Motif Score	2.951386905
Cell/Tissue List	HepG2; fibroblasts; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000508167.5; ENST00000540805.5; ENST00000447510.6; ENST00000511153.5; ENST00000505450.5; ENST00000510224.5; ENST00000539194.5
External Link	RMBase: m6A_site_632510
mod ID: M6ASITE065333		Click to Show/Hide the Full List
mod site	chr4:16075708-16075709:-		[13]
Sequence	CATATCTTTCTCTATGTGGTACAGCCGCGTGATTTCCCAGA
Motif Score	2.856142857
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000505450.5; ENST00000510224.5; ENST00000540805.5; ENST00000508167.5; ENST00000539194.5; ENST00000447510.6; ENST00000511153.5
External Link	RMBase: m6A_site_632511
mod ID: M6ASITE065334		Click to Show/Hide the Full List
mod site	chr4:16075735-16075736:-		[9]
Sequence	CCCATTGGCATTCTCTTTGAACTAGTGCATATCTTTCTCTA
Motif Score	3.373380952
Cell/Tissue List	HepG2; hESCs; fibroblasts; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539194.5; ENST00000447510.6; ENST00000508167.5; ENST00000505450.5; ENST00000540805.5; ENST00000508322.1; ENST00000511153.5; ENST00000510224.5
External Link	RMBase: m6A_site_632512
mod ID: M6ASITE065335		Click to Show/Hide the Full List
mod site	chr4:16075756-16075757:-		[9]
Sequence	CAAGACTCCCATAAAGCTGGACCCATTGGCATTCTCTTTGA
Motif Score	3.622404762
Cell/Tissue List	HepG2; hESCs; fibroblasts; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510224.5; ENST00000539194.5; ENST00000508167.5; ENST00000447510.6; ENST00000511153.5; ENST00000505450.5; ENST00000540805.5; ENST00000508322.1
External Link	RMBase: m6A_site_632513
mod ID: M6ASITE065336		Click to Show/Hide the Full List
mod site	chr4:16075772-16075773:-		[9]
Sequence	AACAAATTATGAGACCCAAGACTCCCATAAAGCTGGACCCA
Motif Score	3.319380952
Cell/Tissue List	HepG2; fibroblasts; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510224.5; ENST00000511153.5; ENST00000540805.5; ENST00000508167.5; ENST00000447510.6; ENST00000508322.1; ENST00000539194.5; ENST00000505450.5
External Link	RMBase: m6A_site_632514
mod ID: M6ASITE065337		Click to Show/Hide the Full List
mod site	chr4:16075779-16075780:-		[9]
Sequence	TGCCTGCAACAAATTATGAGACCCAAGACTCCCATAAAGCT
Motif Score	2.876744048
Cell/Tissue List	HepG2; fibroblasts; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000447510.6; ENST00000510224.5; ENST00000539194.5; ENST00000508322.1; ENST00000540805.5; ENST00000505450.5; ENST00000508167.5
External Link	RMBase: m6A_site_632515
mod ID: M6ASITE065338		Click to Show/Hide the Full List
mod site	chr4:16075859-16075860:-		[12]
Sequence	GCTGCTGGGGCTGTGCGGGAACTCCTTTTCAGGAGGGCAGC
Motif Score	3.373380952
Cell/Tissue List	CD34; HepG2; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000447510.6; ENST00000539194.5; ENST00000508940.1; ENST00000505450.5; ENST00000510224.5; ENST00000508167.5; ENST00000540805.5; ENST00000508322.1
External Link	RMBase: m6A_site_632516
mod ID: M6ASITE065339		Click to Show/Hide the Full List
mod site	chr4:16075990-16075991:-		[12]
Sequence	TGCTCCTCTTCTGCCCAGGAACACGCTTGCCTTCCCCAAGG
Motif Score	2.951386905
Cell/Tissue List	CD34; HepG2; H1A; H1B; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000505450.5; ENST00000510224.5; ENST00000514967.5; ENST00000508322.1; ENST00000508940.1; ENST00000447510.6; ENST00000508167.5; ENST00000504842.5; ENST00000540805.5; ENST00000539194.5
External Link	RMBase: m6A_site_632517
mod ID: M6ASITE065340		Click to Show/Hide the Full List
mod site	chr4:16076039-16076040:-		[12]
Sequence	AAGCCAGCCTCAGACAGAAAACTGAAGATTCAGCAGATCCA
Motif Score	2.627720238
Cell/Tissue List	CD34; HepG2; H1A; H1B; hESCs; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000508322.1; ENST00000513108.1; ENST00000510224.5; ENST00000540805.5; ENST00000508940.1; ENST00000539194.5; ENST00000505450.5; ENST00000504842.5; ENST00000508167.5; ENST00000447510.6; ENST00000514967.5
External Link	RMBase: m6A_site_632518
mod ID: M6ASITE065341		Click to Show/Hide the Full List
mod site	chr4:16076046-16076047:-		[12]
Sequence	TCGCCTCAAGCCAGCCTCAGACAGAAAACTGAAGATTCAGC
Motif Score	2.897386905
Cell/Tissue List	CD34; HepG2; H1A; H1B; hESCs; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000514967.5; ENST00000508940.1; ENST00000508322.1; ENST00000508167.5; ENST00000510224.5; ENST00000505450.5; ENST00000539194.5; ENST00000513108.1; ENST00000540805.5; ENST00000504842.5; ENST00000447510.6
External Link	RMBase: m6A_site_632519
mod ID: M6ASITE065342		Click to Show/Hide the Full List
mod site	chr4:16076083-16076084:-		[9]
Sequence	GTGAATGACCCCCTTGGAGAACATTCTTCCGCATCCCTCGC
Motif Score	2.951386905
Cell/Tissue List	HepG2; H1A; H1B; hESCs; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000513108.1; ENST00000508167.5; ENST00000508322.1; ENST00000502501.1; ENST00000539194.5; ENST00000510224.5; ENST00000514967.5; ENST00000508940.1; ENST00000505450.5; ENST00000447510.6; ENST00000540805.5; ENST00000504842.5
External Link	RMBase: m6A_site_632520
mod ID: M6ASITE065343		Click to Show/Hide the Full List
mod site	chr4:16076443-16076444:-		[9]
Sequence	CTATCTATGAAGCATGGAGAACAGTGCCTGGAAGATAGTAA
Motif Score	2.951386905
Cell/Tissue List	HepG2; H1A; H1B; hESCs; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000508167.5; ENST00000505450.5; ENST00000508322.1; rmsk_1248494; ENST00000508940.1; ENST00000514967.5; ENST00000514693.5; ENST00000510224.5; ENST00000502501.1; ENST00000504842.5; ENST00000513108.1
External Link	RMBase: m6A_site_632521
mod ID: M6ASITE065344		Click to Show/Hide the Full List
mod site	chr4:16076472-16076473:-		[14]
Sequence	TAATGCCTTAAACAAGGAGGACCTTGTTTCTATCTATGAAG
Motif Score	3.622404762
Cell/Tissue List	H1B; hESCs; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000508940.1; ENST00000505450.5; ENST00000514693.5; ENST00000504842.5; ENST00000508167.5; ENST00000502501.1; rmsk_1248494; ENST00000514967.5; ENST00000513108.1; ENST00000510224.5; ENST00000508322.1
External Link	RMBase: m6A_site_632522
mod ID: M6ASITE065345		Click to Show/Hide the Full List
mod site	chr4:16076481-16076482:-		[14]
Sequence	AAAATGGAATAATGCCTTAAACAAGGAGGACCTTGTTTCTA
Motif Score	2.20572619
Cell/Tissue List	H1B; hESCs; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000514967.5; ENST00000514693.5; ENST00000508167.5; ENST00000513108.1; rmsk_1248494; ENST00000508940.1; ENST00000504842.5; ENST00000510224.5; ENST00000505450.5; ENST00000508322.1; ENST00000502501.1
External Link	RMBase: m6A_site_632523
mod ID: M6ASITE065346		Click to Show/Hide the Full List
mod site	chr4:16083415-16083416:-		[11]
Sequence	CCGGTGCCCGTCCAACCCAAACTTTTTAGTCTGAGTGGTGG
Motif Score	2.627720238
Cell/Tissue List	endometrial; GSCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000510224.5; ENST00000508940.1; ENST00000505450.5; ENST00000508167.5; ENST00000508322.1; ENST00000502501.1
External Link	RMBase: m6A_site_632524
mod ID: M6ASITE065347		Click to Show/Hide the Full List
mod site	chr4:16083458-16083459:-		[11]
Sequence	AGCGGCTGGGGGCCAGAGGAACTGCGGGGAGAGCGTGGTGG
Motif Score	3.373380952
Cell/Tissue List	endometrial; GSCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000510224.5; ENST00000502501.1; ENST00000508322.1; ENST00000508940.1; ENST00000505450.5; ENST00000508167.5
External Link	RMBase: m6A_site_632525
mod ID: M6ASITE065348		Click to Show/Hide the Full List
mod site	chr4:16083480-16083481:-		[11]
Sequence	AGCAGGTGGTGCGGGCCCGGACAGCGGCTGGGGGCCAGAGG
Motif Score	3.643047619
Cell/Tissue List	endometrial; GSCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000502501.1; ENST00000505450.5; ENST00000508167.5; ENST00000510224.5
External Link	RMBase: m6A_site_632526
mod ID: M6ASITE065349		Click to Show/Hide the Full List
mod site	chr4:16084254-16084255:-		[8]
Sequence	TCTAATGCGGCCGGGATGAGACAGGAGAGTTTTTAGGAGGG
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000505450.5
External Link	RMBase: m6A_site_632527

Ref 1	The m6A methyltransferase METTL3 promotes the stemness and malignant progression of breast cancer by mediating m6A modification on SOX2. J BUON. 2021 Mar-Apr;26(2):444-449.
Ref 2	DrugBank 5.0: a major update to the DrugBank database for 2018. Nucleic Acids Res. 2018 Jan 4;46(D1):D1074-D1082. (ID: DB11760)
Ref 3	P-glycoprotein Mediates Ceritinib Resistance in Anaplastic Lymphoma Kinase-rearranged Non-small Cell Lung Cancer. EBioMedicine. 2015 Dec 12;3:54-66. doi: 10.1016/j.ebiom.2015.12.009. eCollection 2016 Jan.
Ref 4	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 5	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 12	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 13	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 14	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map