m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00687)

Target Name	Matrix metalloproteinase-24 (MMP24)
Synonyms	MMP-24; Membrane-type matrix metalloproteinase 5; MT-MMP 5; MTMMP5; Membrane-type-5 matrix metalloproteinase; MT5-MMP; MT5MMP Click to Show/Hide
Gene Name	MMP24
Chromosomal Location	20q11.22
Family	Peptidase M10A family
Function	Metalloprotease that mediates cleavage of N-cadherin (CDH2) and acts as a regulator of neuro-immune interactions and neural stem cell quiescence. Involved in cell-cell interactions between nociceptive neurites and mast cells, possibly by mediating cleavage of CDH2, thereby acting as a mediator of peripheral thermal nociception and inflammatory hyperalgesia. Key regulator of neural stem cells quiescence by mediating cleavage of CDH2, affecting CDH2-mediated anchorage of neural stem cells to ependymocytes in the adult subependymal zone, leading to modulate their quiescence. May play a role in axonal growth. Able to activate progelatinase A. May also be a proteoglycanase involved in degradation of proteoglycans, such as dermatan sulfate and chondroitin sulfate proteoglycans. Cleaves partially fibronectin, but not collagen type I, nor laminin (By similarity). Click to Show/Hide
Gene ID	10893
Uniprot ID	MMP24_HUMAN
HGNC ID	HGNC:7172
KEGG ID	hsa:10893

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MMP24 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	HEK293 cell line	Homo sapiens
Treatment: FTO knockdown HEK293T cells Control: HEK293T cells		GSE78040
Regulation		logFC: 8.43E-01 p-value: 7.94E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	FTO was colocalized with Matrix metalloproteinase-24 (MMP24) in spinal neurons and shown increased binding to the Mmp24 mRNA in the spinal cord after SNL. SNL promoted the m6A eraser FTO binding to the Mmp24 mRNA, which subsequently facilitated the translation of MMP24 in the spinal cord, and ultimately contributed to neuropathic pain genesis.
Target Regulation	Up regulation
Responsed Disease	Neuropathic Pain	ICD-11: 8E43.0	Disease Info
In-vivo Model	Mice were anesthetized with Nembutal. The lower back was dissected until the transverse lumbar process was exposed. After the process was removed, the underneath L4 spinal nerve was ligated with a silk 6-0 thread. A slight distal location was chosen for transection around the ligation site. Subsequent layers of muscle and skin were closed. The sham groups undertook identical procedures, but without the transection or ligature of the corresponding nerve. The intraspinal injection was performed as described previously. In short, after anesthetized with Nembutal, mice underwent hemilaminectomy at the L1-L2 vertebral segments. The intraspinal injection was carried out ipsilaterally on the left side. By using a glass micropipette, each animal received two injections (5 × 10⁵ TU per injection, 0.8 mm from the midline, 0.5 mm apart in rostrocaudal axis, 0.5 mm deep) of lentivirus following the L3-L4 dorsal root entry zone after exposure of spinal cord. The tip of glass micropipette should reach a depth of lamina II-IV of the spinal cord. Finally, the dorsal muscle and skin were sutured layer by layer.

Pain disorders [ICD-11: 8E43]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	FTO was colocalized with Matrix metalloproteinase-24 (MMP24) in spinal neurons and shown increased binding to the Mmp24 mRNA in the spinal cord after SNL. SNL promoted the m6A eraser FTO binding to the Mmp24 mRNA, which subsequently facilitated the translation of MMP24 in the spinal cord, and ultimately contributed to neuropathic pain genesis.
Responsed Disease	Neuropathic Pain [ICD-11: 8E43.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Up regulation
In-vivo Model	Mice were anesthetized with Nembutal. The lower back was dissected until the transverse lumbar process was exposed. After the process was removed, the underneath L4 spinal nerve was ligated with a silk 6-0 thread. A slight distal location was chosen for transection around the ligation site. Subsequent layers of muscle and skin were closed. The sham groups undertook identical procedures, but without the transection or ligature of the corresponding nerve. The intraspinal injection was performed as described previously. In short, after anesthetized with Nembutal, mice underwent hemilaminectomy at the L1-L2 vertebral segments. The intraspinal injection was carried out ipsilaterally on the left side. By using a glass micropipette, each animal received two injections (5 × 10⁵ TU per injection, 0.8 mm from the midline, 0.5 mm apart in rostrocaudal axis, 0.5 mm deep) of lentivirus following the L3-L4 dorsal root entry zone after exposure of spinal cord. The tip of glass micropipette should reach a depth of lamina II-IV of the spinal cord. Finally, the dorsal muscle and skin were sutured layer by layer.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00687)

Matrix metalloproteinase-24 (MMP24)

N6-methyladenosine (m6A)

In total 24 m6A sequence/site(s) in this target gene
mod ID: M6ASITE052253		Click to Show/Hide the Full List
mod site	chr20:35263839-35263840:+		[2]
Sequence	GAGCTGGGCCACGCGCTGGGACTGGAGCACTCCAGCGACCC
Motif Score	4.065041667
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528666
mod ID: M6ASITE052254		Click to Show/Hide the Full List
mod site	chr20:35267286-35267287:+		[3]
Sequence	CACTCACCATCGGAGAGGAAACACGAGCGCCAGCCCAGGCC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528667
mod ID: M6ASITE052255		Click to Show/Hide the Full List
mod site	chr20:35267327-35267328:+		[3]
Sequence	CCCTCGGCCGCCCCTCGGGGACCGGCCATCCACACCAGGCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528668
mod ID: M6ASITE052256		Click to Show/Hide the Full List
mod site	chr20:35267352-35267353:+		[3]
Sequence	CCATCCACACCAGGCACCAAACCCAACATCTGTGACGGCAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528669
mod ID: M6ASITE052257		Click to Show/Hide the Full List
mod site	chr20:35271683-35271684:+		[3]
Sequence	GACACAGCTCTGCGCTGGGAACCTGTGGGCAAGACCTACTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528672
mod ID: M6ASITE052258		Click to Show/Hide the Full List
mod site	chr20:35271696-35271697:+		[3]
Sequence	GCTGGGAACCTGTGGGCAAGACCTACTTTTTCAAAGGCGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528673
mod ID: M6ASITE052259		Click to Show/Hide the Full List
mod site	chr20:35271754-35271755:+		[3]
Sequence	CGAGGAGCGGCGGGCCACGGACCCTGGCTACCCTAAGCCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528674
mod ID: M6ASITE052260		Click to Show/Hide the Full List
mod site	chr20:35274298-35274299:+		[3]
Sequence	CTATTTCTACAAGGGCCGGGACTACTGGAAGTTTGACAACC
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528675
mod ID: M6ASITE052261		Click to Show/Hide the Full List
mod site	chr20:35274323-35274324:+		[3]
Sequence	TGGAAGTTTGACAACCAGAAACTGAGCGTGGAGCCAGGCTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; H1B; H1A; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528676
mod ID: M6ASITE052262		Click to Show/Hide the Full List
mod site	chr20:35274433-35274434:+		[3]
Sequence	GCTGCCCCAGGACGACGTGGACATCATGGTGACCATCAACG
Motif Score	3.643047619
Cell/Tissue List	HeLa; A549; H1A; H1B; hESCs; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528677
mod ID: M6ASITE052263		Click to Show/Hide the Full List
mod site	chr20:35274550-35274551:+		[3]
Sequence	CACCATCTTCCAGTTCAAGAACAAGACAGGCCCTCAGCCTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528678
mod ID: M6ASITE052264		Click to Show/Hide the Full List
mod site	chr20:35274555-35274556:+		[3]
Sequence	TCTTCCAGTTCAAGAACAAGACAGGCCCTCAGCCTGTCACC
Motif Score	2.897386905
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528679
mod ID: M6ASITE052265		Click to Show/Hide the Full List
mod site	chr20:35275348-35275349:+		[3]
Sequence	CTGCTTGAGGCTTTAGGTGAACTAGAGGTGACTGTCTTGGT
Motif Score	3.373380952
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528680
mod ID: M6ASITE052266		Click to Show/Hide the Full List
mod site	chr20:35275358-35275359:+		[4]
Sequence	CTTTAGGTGAACTAGAGGTGACTGTCTTGGTGATGAGGCCA
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528681
mod ID: M6ASITE052267		Click to Show/Hide the Full List
mod site	chr20:35275408-35275409:+		[3]
Sequence	CCCTCCCCCAGGCGACAAGGACCAAGGTGCTGCTAAGGCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1A; H1B; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528682
mod ID: M6ASITE052268		Click to Show/Hide the Full List
mod site	chr20:35275442-35275443:+		[3]
Sequence	AAGGCCACTCTAGCGCCCAGACACCCCAGTAGCTGAGCTCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; A549; H1A; H1B
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528683
mod ID: M6ASITE052269		Click to Show/Hide the Full List
mod site	chr20:35276403-35276404:+		[5]
Sequence	CACCTGTCCACTCACATGAAACTCGTGTTAGGCCCTGGGAG
Motif Score	2.627720238
Cell/Tissue List	peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528685
mod ID: M6ASITE052270		Click to Show/Hide the Full List
mod site	chr20:35276526-35276527:+		[3]
Sequence	TCTTGTGTCCCCATCTGTGGACCCCTCTAGGGTCTGAGATG
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1A; H1B; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528688
mod ID: M6ASITE052271		Click to Show/Hide the Full List
mod site	chr20:35276710-35276711:+		[3]
Sequence	GGCAGGCCAGCTGAGAATGAACAGGAGATGGAGGCAGGCAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; H1A; H1B; MM6; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528693
mod ID: M6ASITE052272		Click to Show/Hide the Full List
mod site	chr20:35276841-35276842:+		[3]
Sequence	TGTTTGTCCATCACCCCAGGACAGGGCAGACAGAGGGGCAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; kidney; H1A; H1B; fibroblasts; A549; MM6; Jurkat; peripheral-blood; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528696
mod ID: M6ASITE052273		Click to Show/Hide the Full List
mod site	chr20:35276850-35276851:+		[3]
Sequence	ATCACCCCAGGACAGGGCAGACAGAGGGGCAAAGCACTGGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; H1A; H1B; fibroblasts; A549; MM6; Jurkat; peripheral-blood; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528697
mod ID: M6ASITE052274		Click to Show/Hide the Full List
mod site	chr20:35276905-35276906:+		[3]
Sequence	GCTTCCCCTCAGCCTGGGGGACATCACAGCATTTCAGTGTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; H1A; H1B; hNPCs; fibroblasts; A549; MM6; Jurkat; peripheral-blood; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528698
mod ID: M6ASITE052275		Click to Show/Hide the Full List
mod site	chr20:35276939-35276940:+		[3]
Sequence	CAGTGTCAGTCACATTTTAAACTGATCAGCCTTTGTATAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; H1A; H1B; hESCs; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528701
mod ID: M6ASITE052276		Click to Show/Hide the Full List
mod site	chr20:35276985-35276986:+		[3]
Sequence	TTAAATCATTTCTAAATAAAACAGAAATACAGAGTGTGTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESCs; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000246186.8
External Link	RMBase: m6A_site_528704

Ref 1	MMP24 Contributes to Neuropathic Pain in an FTO-Dependent Manner in the Spinal Cord Neurons. Front Pharmacol. 2021 Apr 29;12:673831. doi: 10.3389/fphar.2021.673831. eCollection 2021.
Ref 2	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 5	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map