m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00686)

Target Name	Tyrosine-protein kinase receptor Tie-1 (TIE1)
Gene Name	TIE1
Chromosomal Location	1p34.2
Family	Protein kinase superfamily, Tyr protein kinase family, Tie subfamily
Function	Transmembrane tyrosine-protein kinase that may modulate TEK/TIE2 activity and contribute to the regulation of angiogenesis. Click to Show/Hide
Gene ID	7075
Uniprot ID	TIE1_HUMAN
HGNC ID	HGNC:11809
KEGG ID	hsa:7075

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

TIE1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: -1.32E+00 p-value: 5.08E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The overexpression of miR-4729 in vascular endothelial cells decreased the global mRNA methylation and TIE1 mRNA 3'UTR-specific site methylation by silencing METTL14 expression, reducing Tyrosine-protein kinase receptor Tie-1 (TIE1) mRNA stability, down-regulating the TIE1/VEGFA signal molecular loop expression, and weakening angiogenesis ability. MiR-4729 regulates TIE1 mRNA m6A modification and angiogenesis in hemorrhoids by targeting METTL14.
Target Regulation	Up regulation
Responsed Disease	Haemorrhoids		ICD-11: DB60	Disease Info
Pathway Response	VEGF signaling pathway			hsa04370
Cell Process	Cell proliferation
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959

Haemorrhoids [ICD-11: DB60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The overexpression of miR-4729 in vascular endothelial cells decreased the global mRNA methylation and TIE1 mRNA 3'UTR-specific site methylation by silencing METTL14 expression, reducing Tyrosine-protein kinase receptor Tie-1 (TIE1) mRNA stability, down-regulating the TIE1/VEGFA signal molecular loop expression, and weakening angiogenesis ability. MiR-4729 regulates TIE1 mRNA m6A modification and angiogenesis in hemorrhoids by targeting METTL14.
Responsed Disease	Haemorrhoids [ICD-11: DB60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	VEGF signaling pathway			hsa04370
Cell Process	Cell proliferation
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00686)

Tyrosine-protein kinase receptor Tie-1 (TIE1)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007113		Click to Show/Hide the Full List
mod site	chr1:43317378-43317379:+		[2]
Sequence	TGATCAAGAAGGACGGGCTGAAGATGAACGCAGCCATCAAA
Transcript ID List	ENST00000372476.8; ENST00000473014.1
External Link	RMBase: RNA-editing_site_4839

N6-methyladenosine (m6A)

In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE021669		Click to Show/Hide the Full List
mod site	chr1:43302456-43302457:+		[3]
Sequence	GGGAAGAGGGCTAAACAGGGACAGACACAGGAGCTCTAGAG
Motif Score	3.643047619
Cell/Tissue List	HepG2; CD4T; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372476.8; ENST00000485125.1; ENST00000538015.1
External Link	RMBase: m6A_site_26483
mod ID: M6ASITE021670		Click to Show/Hide the Full List
mod site	chr1:43304862-43304863:+		[3]
Sequence	GGCCCCAGGCGCGGCGGTGGACCTGACGCTGCTGGCCAACC
Motif Score	3.622404762
Cell/Tissue List	HepG2; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000538015.1; ENST00000485125.1; ENST00000372476.8
External Link	RMBase: m6A_site_26484
mod ID: M6ASITE021671		Click to Show/Hide the Full List
mod site	chr1:43304895-43304896:+		[4]
Sequence	GGCCAACCTGCGGCTCACGGACCCCCAGCGCTTCTTCCTGA
Motif Score	3.622404762
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000538015.1; ENST00000485125.1; ENST00000372476.8
External Link	RMBase: m6A_site_26485
mod ID: M6ASITE021672		Click to Show/Hide the Full List
mod site	chr1:43307268-43307269:+		[5]
Sequence	TTCACTGGCACCCGCTGTGAACAGGGTAAGGAGGAGGGGAG
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372476.8; ENST00000538015.1; ENST00000480269.1
External Link	RMBase: m6A_site_26486
mod ID: M6ASITE021673		Click to Show/Hide the Full List
mod site	chr1:43307518-43307519:+		[5]
Sequence	CCTCACCTTCTGCCTCCCAGACCCCTATGGCTGCTCTTGTG
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000480269.1; ENST00000538015.1; ENST00000372476.8
External Link	RMBase: m6A_site_26487
mod ID: M6ASITE021674		Click to Show/Hide the Full List
mod site	chr1:43312500-43312501:+		[5]
Sequence	CGCACTGCCCTCCTGACGGGACTCACGCCTGGCACCCACTA
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372476.8; ENST00000488437.1
External Link	RMBase: m6A_site_26488
mod ID: M6ASITE021675		Click to Show/Hide the Full List
mod site	chr1:43313386-43313387:+		[5]
Sequence	CAGCATTCAGGGGCTCGGGGACTGGAGCAACACAGTAGAAG
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000461061.1; ENST00000473014.1; ENST00000372476.8; ENST00000471187.1
External Link	RMBase: m6A_site_26489
mod ID: M6ASITE021676		Click to Show/Hide the Full List
mod site	chr1:43317316-43317317:+		[5]
Sequence	GGAGGACATCACCTTTGAGGACCTCATCGGGGAGGGGAACT
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372476.8; ENST00000473014.1
External Link	RMBase: m6A_site_26490
mod ID: M6ASITE021677		Click to Show/Hide the Full List
mod site	chr1:43317334-43317335:+		[5]
Sequence	GGACCTCATCGGGGAGGGGAACTTCGGCCAGGTCATCCGGG
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000473014.1; ENST00000372476.8
External Link	RMBase: m6A_site_26491
mod ID: M6ASITE021678		Click to Show/Hide the Full List
mod site	chr1:43322798-43322799:+		[6]
Sequence	CTGTGACCAGTCTGACCCTTACAGCCTCTGACTTAAGCTGC
Motif Score	2.07285119
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000372476.8
External Link	RMBase: m6A_site_26492

Ref 1	MiR-4729 regulates TIE1 mRNA m6A modification and angiogenesis in hemorrhoids by targeting METTL14. Ann Transl Med. 2021 Feb;9(3):232. doi: 10.21037/atm-20-3399.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 4	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map