m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00680)

Target Name	Protein yippee-like 5 (YPEL5)
Gene Name	YPEL5
Chromosomal Location	2p23.1
Family	Yippee family
Function	Component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. Required for normal cell proliferation (By similarity). Click to Show/Hide
Gene ID	51646
Uniprot ID	YPEL5_HUMAN
HGNC ID	HGNC:18329
KEGG ID	hsa:51646

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

YPEL5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -6.48E-01 p-value: 2.75E-26
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-catalyzed m6A modification in CRC tumorigenesis, wherein it facilitates CRC tumor growth and metastasis through suppressing Protein yippee-like 5 (YPEL5) expression in an m6A-YTHDF2-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	For the xenograft model, METTL3 stable overexpressed SW620 cells (1 × 10⁷) or control cells were subcutaneously injected into the right axilla of the female anesthetized BALB/C nude mice (4-6 weeks old, 18-20 g, four mice per group), respectively. The body weight and tumor volumes (length × width2 × 0.5) were measured twice a week. After 21 days, all mice were sacrificed and tumors were surgically removed for hematoxylin-eosin (H&E) staining.For the metastasis model, MTTL3 stable overexpressed SW620 cells (1 × 10⁶) or control cells were injected into the exposed spleen of the anesthetized BALB/C nude mice, respectively. After 21 days, liver metastases were carefully detected using a fluorescent stereoscope and embedded for H&E staining.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Human umbilical cord blood CD34+ cells	Homo sapiens
Treatment: YTHDF2 knockdown UCB CD34+ cells Control: Wild type UCB CD34+ cells		GSE107956
Regulation		logFC: 7.11E-01 p-value: 1.04E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-catalyzed m6A modification in CRC tumorigenesis, wherein it facilitates CRC tumor growth and metastasis through suppressing Protein yippee-like 5 (YPEL5) expression in an m6A-YTHDF2-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	For the xenograft model, METTL3 stable overexpressed SW620 cells (1 × 10⁷) or control cells were subcutaneously injected into the right axilla of the female anesthetized BALB/C nude mice (4-6 weeks old, 18-20 g, four mice per group), respectively. The body weight and tumor volumes (length × width2 × 0.5) were measured twice a week. After 21 days, all mice were sacrificed and tumors were surgically removed for hematoxylin-eosin (H&E) staining.For the metastasis model, MTTL3 stable overexpressed SW620 cells (1 × 10⁶) or control cells were injected into the exposed spleen of the anesthetized BALB/C nude mice, respectively. After 21 days, liver metastases were carefully detected using a fluorescent stereoscope and embedded for H&E staining.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-catalyzed m6A modification in CRC tumorigenesis, wherein it facilitates CRC tumor growth and metastasis through suppressing Protein yippee-like 5 (YPEL5) expression in an m6A-YTHDF2-dependent manner.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	For the xenograft model, METTL3 stable overexpressed SW620 cells (1 × 10⁷) or control cells were subcutaneously injected into the right axilla of the female anesthetized BALB/C nude mice (4-6 weeks old, 18-20 g, four mice per group), respectively. The body weight and tumor volumes (length × width2 × 0.5) were measured twice a week. After 21 days, all mice were sacrificed and tumors were surgically removed for hematoxylin-eosin (H&E) staining.For the metastasis model, MTTL3 stable overexpressed SW620 cells (1 × 10⁶) or control cells were injected into the exposed spleen of the anesthetized BALB/C nude mice, respectively. After 21 days, liver metastases were carefully detected using a fluorescent stereoscope and embedded for H&E staining.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-catalyzed m6A modification in CRC tumorigenesis, wherein it facilitates CRC tumor growth and metastasis through suppressing Protein yippee-like 5 (YPEL5) expression in an m6A-YTHDF2-dependent manner.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	NCM460	Normal	Homo sapiens	CVCL_0460
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	For the xenograft model, METTL3 stable overexpressed SW620 cells (1 × 10⁷) or control cells were subcutaneously injected into the right axilla of the female anesthetized BALB/C nude mice (4-6 weeks old, 18-20 g, four mice per group), respectively. The body weight and tumor volumes (length × width2 × 0.5) were measured twice a week. After 21 days, all mice were sacrificed and tumors were surgically removed for hematoxylin-eosin (H&E) staining.For the metastasis model, MTTL3 stable overexpressed SW620 cells (1 × 10⁶) or control cells were injected into the exposed spleen of the anesthetized BALB/C nude mice, respectively. After 21 days, liver metastases were carefully detected using a fluorescent stereoscope and embedded for H&E staining.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03349		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03577		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03622		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00680)

Protein yippee-like 5 (YPEL5)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009485		Click to Show/Hide the Full List
mod site	chr2:30151360-30151361:+		[2]
Sequence	GGCAGAGATCCTAAAATGTTATTAATATTTCACCAGAGTCT
Transcript ID List	ENST00000492439.1; ENST00000261353.9; ENST00000490211.6; ENST00000379520.7; ENST00000402003.7; ENST00000470120.5; ENST00000379519.7; ENST00000402708.5
External Link	RMBase: RNA-editing_site_75051

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002289		Click to Show/Hide the Full List
mod site	chr2:30147553-30147554:+
Sequence	GCCCGGTCTCCGCCCCGAATCCAAGTCGGAACTTGACCGAG
Cell/Tissue List	testis
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000402708.5; ENST00000379519.7; ENST00000402003.7; ENST00000490211.6; ENST00000261353.9; ENST00000379520.7
External Link	RMBase: m5C_site_26285

N6-methyladenosine (m6A)

In total 55 m6A sequence/site(s) in this target gene
mod ID: M6ASITE043757		Click to Show/Hide the Full List
mod site	chr2:30146976-30146977:+		[3]
Sequence	CAAGGCCAGGGCCTGACTAAACCTGGAGACTCGGGTGGCCG
Motif Score	2.185083333
Cell/Tissue List	A549; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000490211.6
External Link	RMBase: m6A_site_466698
mod ID: M6ASITE043758		Click to Show/Hide the Full List
mod site	chr2:30146984-30146985:+		[3]
Sequence	GGGCCTGACTAAACCTGGAGACTCGGGTGGCCGAGGGGCTT
Motif Score	3.319380952
Cell/Tissue List	A549; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000490211.6
External Link	RMBase: m6A_site_466699
mod ID: M6ASITE043759		Click to Show/Hide the Full List
mod site	chr2:30147023-30147024:+		[4]
Sequence	TTCATACCAGCTGAAGAGCGACAAGCCGCTGGCAGCCGCGG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000490211.6; ENST00000402003.7; ENST00000261353.9
External Link	RMBase: m6A_site_466700
mod ID: M6ASITE043760		Click to Show/Hide the Full List
mod site	chr2:30147563-30147564:+		[3]
Sequence	CGCCCCGAATCCAAGTCGGAACTTGACCGAGTTGTTTGGGC
Motif Score	3.373380952
Cell/Tissue List	A549; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000261353.9; ENST00000379520.7; ENST00000379519.7; ENST00000490211.6; ENST00000402003.7; ENST00000402708.5; ENST00000482474.1
External Link	RMBase: m6A_site_466701
mod ID: M6ASITE043761		Click to Show/Hide the Full List
mod site	chr2:30147605-30147606:+		[5]
Sequence	GCGATGACCGCACGGCGTGAACCGTCCTGAGCAGGGCCCAC
Motif Score	2.930744048
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000402708.5; ENST00000482474.1; ENST00000379519.7; ENST00000261353.9; ENST00000402003.7; ENST00000490211.6; ENST00000379520.7
External Link	RMBase: m6A_site_466702
mod ID: M6ASITE043762		Click to Show/Hide the Full List
mod site	chr2:30148437-30148438:+		[6]
Sequence	CTGCATTCCACCAAAGAGGAACCAAAAGGCCTGTGGTGTTC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379520.7; ENST00000470120.5; ENST00000402003.7; ENST00000492439.1; ENST00000490211.6; ENST00000379519.7; ENST00000261353.9; ENST00000402708.5
External Link	RMBase: m6A_site_466703
mod ID: M6ASITE043763		Click to Show/Hide the Full List
mod site	chr2:30156636-30156637:+		[7]
Sequence	TTTGCTCCTAGGTTTTTAGAACTTCAGCCATAAAAATGGGC
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000490211.6; ENST00000402708.5; ENST00000470120.5; ENST00000379519.7; ENST00000492439.1; ENST00000495673.1; ENST00000402003.7; ENST00000379520.7; ENST00000261353.9
External Link	RMBase: m6A_site_466704
mod ID: M6ASITE043764		Click to Show/Hide the Full List
mod site	chr2:30156706-30156707:+		[7]
Sequence	CCGTCTGTTTTCTTGTGCAAACTGTGATACGATCCTGACCA
Motif Score	2.627720238
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000402708.5; ENST00000379520.7; ENST00000379519.7; ENST00000490211.6; ENST00000470120.5; ENST00000261353.9; ENST00000495673.1; ENST00000492439.1; ENST00000402003.7
External Link	RMBase: m6A_site_466705
mod ID: M6ASITE043765		Click to Show/Hide the Full List
mod site	chr2:30156737-30156738:+		[7]
Sequence	ATCCTGACCAACCGCTCAGAACTCATCTCCACTCGTTTCAC
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000492439.1; ENST00000470120.5; ENST00000261353.9; ENST00000402003.7; ENST00000490211.6; ENST00000495673.1; ENST00000402708.5
External Link	RMBase: m6A_site_466706
mod ID: M6ASITE043766		Click to Show/Hide the Full List
mod site	chr2:30158673-30158674:+		[4]
Sequence	GGTCATGCTCACTGGCCGCCACATGGTTCGAGATGTGAGCT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000402003.7; ENST00000379519.7; ENST00000261353.9; ENST00000470120.5; ENST00000379520.7; ENST00000495673.1; ENST00000402708.5; ENST00000492439.1
External Link	RMBase: m6A_site_466707
mod ID: M6ASITE043767		Click to Show/Hide the Full List
mod site	chr2:30158700-30158701:+		[6]
Sequence	TCGAGATGTGAGCTGCAAAAACTGCAATAGCAAACTGGGAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; U2OS; hNPCs; fibroblasts; A549; CD8T; MM6; Huh7; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000492439.1; ENST00000470120.5; ENST00000379520.7; ENST00000379519.7; ENST00000402708.5; ENST00000261353.9; ENST00000495673.1; ENST00000402003.7
External Link	RMBase: m6A_site_466708
mod ID: M6ASITE043768		Click to Show/Hide the Full List
mod site	chr2:30158713-30158714:+		[6]
Sequence	TGCAAAAACTGCAATAGCAAACTGGGATGGATCTATGAGTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; U2OS; hNPCs; fibroblasts; A549; MM6; Huh7; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492439.1; ENST00000495673.1; ENST00000402003.7; ENST00000470120.5; ENST00000402708.5; ENST00000379520.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466709
mod ID: M6ASITE043769		Click to Show/Hide the Full List
mod site	chr2:30158745-30158746:+		[6]
Sequence	CTATGAGTTTGCCACTGAAGACAGCCAGCGATATAAGGAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; A549; U2OS; hNPCs; fibroblasts; LCLs; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000402003.7; ENST00000470120.5; ENST00000379520.7; ENST00000261353.9; ENST00000402708.5; ENST00000492439.1; ENST00000495673.1; ENST00000379519.7
External Link	RMBase: m6A_site_466710
mod ID: M6ASITE043770		Click to Show/Hide the Full List
mod site	chr2:30158889-30158890:+		[6]
Sequence	CCAGGTCTCCTTCACTGAAAACAAAAATCTACTTACATACA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESC-HEK293T; BGC823; HepG2; U2OS; hNPCs; hESCs; fibroblasts; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000402003.7; ENST00000470120.5; ENST00000261353.9; ENST00000379519.7; ENST00000402708.5; ENST00000379520.7; ENST00000495673.1
External Link	RMBase: m6A_site_466711
mod ID: M6ASITE043771		Click to Show/Hide the Full List
mod site	chr2:30158903-30158904:+		[8]
Sequence	CTGAAAACAAAAATCTACTTACATACACTGTCACCTTAGCA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000261353.9; ENST00000495673.1; ENST00000402003.7; ENST00000379519.7; ENST00000379520.7; ENST00000470120.5; ENST00000402708.5
External Link	RMBase: m6A_site_466712
mod ID: M6ASITE043772		Click to Show/Hide the Full List
mod site	chr2:30158907-30158908:+		[4]
Sequence	AAACAAAAATCTACTTACATACACTGTCACCTTAGCATCAG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379520.7; ENST00000261353.9; ENST00000470120.5; ENST00000402708.5; ENST00000379519.7; ENST00000402003.7; ENST00000495673.1
External Link	RMBase: m6A_site_466713
mod ID: M6ASITE043773		Click to Show/Hide the Full List
mod site	chr2:30158942-30158943:+		[6]
Sequence	CATCAGAGTCGGATTAATGAACTGCGGAACAAGAGGTTGTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; BGC823; HepG2; U2OS; hNPCs; hESCs; fibroblasts; LCLs; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000495673.1; ENST00000470120.5; ENST00000402708.5; ENST00000402003.7; ENST00000379519.7; ENST00000261353.9; ENST00000379520.7
External Link	RMBase: m6A_site_466714
mod ID: M6ASITE043774		Click to Show/Hide the Full List
mod site	chr2:30158950-30158951:+		[6]
Sequence	TCGGATTAATGAACTGCGGAACAAGAGGTTGTGAGAATCTA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; BGC823; HepG2; U2OS; hNPCs; hESCs; fibroblasts; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000470120.5; ENST00000379519.7; ENST00000402003.7; ENST00000495673.1; ENST00000379520.7; ENST00000261353.9; ENST00000402708.5
External Link	RMBase: m6A_site_466715
mod ID: M6ASITE043775		Click to Show/Hide the Full List
mod site	chr2:30158978-30158979:+		[6]
Sequence	TTGTGAGAATCTAAGATGGAACCTTTCTTTCTTTCTTTCTT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; BGC823; U2OS; hNPCs; hESCs; fibroblasts; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000402708.5; ENST00000261353.9; ENST00000379519.7; ENST00000379520.7; ENST00000402003.7; ENST00000495673.1
External Link	RMBase: m6A_site_466716
mod ID: M6ASITE043776		Click to Show/Hide the Full List
mod site	chr2:30159027-30159028:+		[8]
Sequence	AATTTTGTATTTTCCATCCAACAGCAGTGTGTAGAGAGAAT
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000495673.1; ENST00000261353.9; ENST00000402003.7; ENST00000402708.5
External Link	RMBase: m6A_site_466717
mod ID: M6ASITE043777		Click to Show/Hide the Full List
mod site	chr2:30159084-30159085:+		[8]
Sequence	TAATTTTTTACCCTATGTTTACATCTTGAGGCAGCAGAGTC
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000495673.1; ENST00000402708.5; ENST00000402003.7; ENST00000261353.9; ENST00000379519.7; ENST00000379520.7
External Link	RMBase: m6A_site_466718
mod ID: M6ASITE043778		Click to Show/Hide the Full List
mod site	chr2:30159216-30159217:+		[6]
Sequence	GTTAGGAGTATGGTTTTTAAACTTGGGCTTCATTTTAAACT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000402708.5; ENST00000379519.7; ENST00000379520.7; ENST00000261353.9; ENST00000402003.7
External Link	RMBase: m6A_site_466719
mod ID: M6ASITE043779		Click to Show/Hide the Full List
mod site	chr2:30159234-30159235:+		[6]
Sequence	AAACTTGGGCTTCATTTTAAACTTTTTTTTTTAAACCCAGT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000402708.5; ENST00000402003.7; ENST00000379520.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466720
mod ID: M6ASITE043780		Click to Show/Hide the Full List
mod site	chr2:30159248-30159249:+		[6]
Sequence	TTTTAAACTTTTTTTTTTAAACCCAGTTATTTCACTTGATT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379519.7; ENST00000402003.7; ENST00000261353.9; ENST00000379520.7; ENST00000402708.5
External Link	RMBase: m6A_site_466721
mod ID: M6ASITE043781		Click to Show/Hide the Full List
mod site	chr2:30159261-30159262:+		[8]
Sequence	TTTTTAAACCCAGTTATTTCACTTGATTTGCTAGCTTCAGA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379519.7; ENST00000402708.5; ENST00000261353.9; ENST00000402003.7; ENST00000379520.7
External Link	RMBase: m6A_site_466722
mod ID: M6ASITE043782		Click to Show/Hide the Full List
mod site	chr2:30159444-30159445:+		[9]
Sequence	ATTCCTAGTTATTTGTCACCACATAATTGGTGTTGATTGGA
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000379519.7; ENST00000402003.7; ENST00000379520.7; ENST00000402708.5; ENST00000261353.9
External Link	RMBase: m6A_site_466723
mod ID: M6ASITE043783		Click to Show/Hide the Full List
mod site	chr2:30159466-30159467:+		[8]
Sequence	ATAATTGGTGTTGATTGGAAACTTTTTCTGAGATGGGACAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402708.5; ENST00000261353.9; ENST00000379519.7; ENST00000379520.7; ENST00000402003.7
External Link	RMBase: m6A_site_466724
mod ID: M6ASITE043784		Click to Show/Hide the Full List
mod site	chr2:30159483-30159484:+		[9]
Sequence	GAAACTTTTTCTGAGATGGGACAGAACTGCTGGGTTGTCTT
Motif Score	3.643047619
Cell/Tissue List	liver; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000402003.7; ENST00000402708.5; ENST00000379520.7; ENST00000379519.7; ENST00000261353.9
External Link	RMBase: m6A_site_466725
mod ID: M6ASITE043785		Click to Show/Hide the Full List
mod site	chr2:30159514-30159515:+		[8]
Sequence	GGGTTGTCTTTTTCCATGTAACTTAAGCATAGTAATATAAA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402708.5; ENST00000379519.7; ENST00000402003.7; ENST00000379520.7; ENST00000261353.9
External Link	RMBase: m6A_site_466726
mod ID: M6ASITE043786		Click to Show/Hide the Full List
mod site	chr2:30159579-30159580:+		[8]
Sequence	GTCCTGTGTTGCTTTTAAAAACACCTTATAAAAGAGGAGAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000379520.7; ENST00000402003.7; ENST00000379519.7; ENST00000261353.9
External Link	RMBase: m6A_site_466727
mod ID: M6ASITE043787		Click to Show/Hide the Full List
mod site	chr2:30159649-30159650:+		[8]
Sequence	AGTTTTTTTTCATCTCTTAAACTAAATTGACCATGCATATA
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402003.7; ENST00000261353.9; ENST00000379520.7; ENST00000379519.7
External Link	RMBase: m6A_site_466728
mod ID: M6ASITE043788		Click to Show/Hide the Full List
mod site	chr2:30159658-30159659:+		[8]
Sequence	TCATCTCTTAAACTAAATTGACCATGCATATAATATTCTTT
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402003.7; ENST00000379520.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466729
mod ID: M6ASITE043789		Click to Show/Hide the Full List
mod site	chr2:30159704-30159705:+		[6]
Sequence	AATGAAAGCATACTGTTGAAACCCGCAGTGTTGCATTTAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000402003.7; ENST00000261353.9
External Link	RMBase: m6A_site_466730
mod ID: M6ASITE043790		Click to Show/Hide the Full List
mod site	chr2:30159727-30159728:+		[6]
Sequence	CGCAGTGTTGCATTTAGAAAACAGTTGAACAGAATGTCAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000261353.9; ENST00000402003.7; ENST00000379520.7; ENST00000379519.7
External Link	RMBase: m6A_site_466731
mod ID: M6ASITE043791		Click to Show/Hide the Full List
mod site	chr2:30159735-30159736:+		[6]
Sequence	TGCATTTAGAAAACAGTTGAACAGAATGTCAATGTGCATTC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379519.7; ENST00000402003.7; ENST00000379520.7; ENST00000261353.9
External Link	RMBase: m6A_site_466732
mod ID: M6ASITE043792		Click to Show/Hide the Full List
mod site	chr2:30159766-30159767:+		[6]
Sequence	ATGTGCATTCATGCAAAAAAACATTTAATCTGCATCTGTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000402003.7; ENST00000379520.7; ENST00000379519.7; ENST00000261353.9
External Link	RMBase: m6A_site_466733
mod ID: M6ASITE043793		Click to Show/Hide the Full List
mod site	chr2:30159809-30159810:+		[8]
Sequence	GAAAAGGGGGAAATGAAGCAACTTGTCTAAAAATACTGCTT
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379519.7; ENST00000261353.9; ENST00000402003.7; ENST00000379520.7
External Link	RMBase: m6A_site_466734
mod ID: M6ASITE043794		Click to Show/Hide the Full List
mod site	chr2:30159831-30159832:+		[8]
Sequence	TTGTCTAAAAATACTGCTTTACAAAGCATTTCAGCCTTTCC
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000402003.7; ENST00000379520.7; ENST00000379519.7; ENST00000261353.9
External Link	RMBase: m6A_site_466735
mod ID: M6ASITE043795		Click to Show/Hide the Full List
mod site	chr2:30159877-30159878:+		[8]
Sequence	AGTTTTGCATTGATTTTTTGACAAGTCTGTAGAGCCTAATA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000261353.9; ENST00000402003.7; ENST00000379519.7; ENST00000379520.7
External Link	RMBase: m6A_site_466736
mod ID: M6ASITE043796		Click to Show/Hide the Full List
mod site	chr2:30159970-30159971:+		[8]
Sequence	TCAGAAGTTCAGCTGTTGAAACGAAAACTGTACTTTGTACC
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379520.7; ENST00000261353.9; ENST00000402003.7; ENST00000379519.7
External Link	RMBase: m6A_site_466737
mod ID: M6ASITE043797		Click to Show/Hide the Full List
mod site	chr2:30159976-30159977:+		[6]
Sequence	GTTCAGCTGTTGAAACGAAAACTGTACTTTGTACCCTCACA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000261353.9; ENST00000379520.7; ENST00000379519.7; ENST00000402003.7
External Link	RMBase: m6A_site_466738
mod ID: M6ASITE043798		Click to Show/Hide the Full List
mod site	chr2:30159981-30159982:+		[8]
Sequence	GCTGTTGAAACGAAAACTGTACTTTGTACCCTCACATACAA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379520.7; ENST00000402003.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466739
mod ID: M6ASITE043799		Click to Show/Hide the Full List
mod site	chr2:30159994-30159995:+		[8]
Sequence	AAACTGTACTTTGTACCCTCACATACAAAGGGATCAAATTT
Motif Score	2.047297619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000379520.7; ENST00000402003.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466740
mod ID: M6ASITE043800		Click to Show/Hide the Full List
mod site	chr2:30159998-30159999:+		[4]
Sequence	TGTACTTTGTACCCTCACATACAAAGGGATCAAATTTGACC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379519.7; ENST00000379520.7; ENST00000402003.7; ENST00000261353.9
External Link	RMBase: m6A_site_466741
mod ID: M6ASITE043801		Click to Show/Hide the Full List
mod site	chr2:30160016-30160017:+		[8]
Sequence	ATACAAAGGGATCAAATTTGACCTGGTGTTATTTTAGCCCC
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379519.7; ENST00000402003.7; ENST00000379520.7; ENST00000261353.9
External Link	RMBase: m6A_site_466742
mod ID: M6ASITE043802		Click to Show/Hide the Full List
mod site	chr2:30160046-30160047:+		[4]
Sequence	ATTTTAGCCCCAAATTTATGACATTACACAATATTAAAATG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379520.7; ENST00000379519.7; ENST00000261353.9; ENST00000402003.7
External Link	RMBase: m6A_site_466743
mod ID: M6ASITE043803		Click to Show/Hide the Full List
mod site	chr2:30160086-30160087:+		[6]
Sequence	GTAAATGTTTCTTTACCCAAACTACTTCTAGATATTCTAGT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000261353.9; ENST00000379519.7; ENST00000379520.7; ENST00000402003.7
External Link	RMBase: m6A_site_466744
mod ID: M6ASITE043804		Click to Show/Hide the Full List
mod site	chr2:30160089-30160090:+		[8]
Sequence	AATGTTTCTTTACCCAAACTACTTCTAGATATTCTAGTATT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402003.7; ENST00000379520.7; ENST00000379519.7; ENST00000261353.9
External Link	RMBase: m6A_site_466745
mod ID: M6ASITE043805		Click to Show/Hide the Full List
mod site	chr2:30160267-30160268:+		[8]
Sequence	TGTCGTTGATATTAAAAGTGACTTCTGAGTACAGTTAAGTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000402003.7; ENST00000379520.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466746
mod ID: M6ASITE043806		Click to Show/Hide the Full List
mod site	chr2:30160301-30160302:+		[8]
Sequence	TTAAGTTCCTCCTATTTGCCACTGGGCTGTTGGTTAGAAGC
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379520.7; ENST00000402003.7; ENST00000261353.9; ENST00000379519.7
External Link	RMBase: m6A_site_466747
mod ID: M6ASITE043807		Click to Show/Hide the Full List
mod site	chr2:30160329-30160330:+		[8]
Sequence	GTTGGTTAGAAGCATAGGTAACTGATTAAGTAGGTATGATA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000379520.7; ENST00000261353.9; ENST00000402003.7; ENST00000379519.7
External Link	RMBase: m6A_site_466748
mod ID: M6ASITE043808		Click to Show/Hide the Full List
mod site	chr2:30160369-30160370:+		[6]
Sequence	ACTGCATTTGAAATAAGTGGACACAAACTATCCTTTCTCCA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000402003.7; ENST00000261353.9; ENST00000379519.7; ENST00000379520.7
External Link	RMBase: m6A_site_466749
mod ID: M6ASITE043809		Click to Show/Hide the Full List
mod site	chr2:30160375-30160376:+		[6]
Sequence	TTTGAAATAAGTGGACACAAACTATCCTTTCTCCACCATGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD8T
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000402003.7; ENST00000261353.9; ENST00000379519.7; ENST00000379520.7
External Link	RMBase: m6A_site_466750
mod ID: M6ASITE043810		Click to Show/Hide the Full List
mod site	chr2:30160396-30160397:+		[6]
Sequence	CTATCCTTTCTCCACCATGGACTCAATCTGAGAACAACAGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD8T; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000261353.9; ENST00000379519.7; ENST00000379520.7; ENST00000402003.7
External Link	RMBase: m6A_site_466751
mod ID: M6ASITE043811		Click to Show/Hide the Full List
mod site	chr2:30160409-30160410:+		[6]
Sequence	ACCATGGACTCAATCTGAGAACAACAGCATTCATTTCCATT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000261353.9; ENST00000402003.7; ENST00000379519.7; ENST00000379520.7
External Link	RMBase: m6A_site_466752

Ref 1	METTL3/YTHDF2 m6A axis accelerates colorectal carcinogenesis through epigenetically suppressing YPEL5. Mol Oncol. 2021 Aug;15(8):2172-2184. doi: 10.1002/1878-0261.12898. Epub 2021 Jan 25.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map