m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00677)

Target Name	Zinc finger protein SNAI2 (Slug)
Synonyms	Neural crest transcription factor Slug; Protein snail homolog 2 Click to Show/Hide
Gene Name	Slug
Chromosomal Location	8q11.21
Family	Snail C2H2-type zinc-finger protein family
Function	Transcriptional repressor that modulates both activator-dependent and basal transcription. Involved in the generation and migration of neural crest cells. Plays a role in mediating RAF1-induced transcriptional repression of the TJ protein, occludin (OCLN) and subsequent oncogenic transformation of epithelial cells (By similarity). Represses BRCA2 expression by binding to its E2-box-containing silencer and recruiting CTBP1 and HDAC1 in breast cells. In epidermal keratinocytes, binds to the E-box in ITGA3 promoter and represses its transcription. Involved in the regulation of ITGB1 and ITGB4 expression and cell adhesion and proliferation in epidermal keratinocytes. Binds to E-box2 domain of BSG and activates its expression during TGFB1-induced epithelial-mesenchymal transition (EMT) in hepatocytes. Represses E-Cadherin/CDH1 transcription via E-box elements. Involved in osteoblast maturation. Binds to RUNX2 and SOC9 promoters and may act as a positive and negative transcription regulator, respectively, in osteoblasts. Binds to CXCL12 promoter via E-box regions in mesenchymal stem cells and osteoblasts. Plays an essential role in TWIST1-induced EMT and its ability to promote invasion and metastasis. Click to Show/Hide
Gene ID	6591
Uniprot ID	SNAI2_HUMAN
HGNC ID	HGNC:11094
KEGG ID	hsa:6591

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

Slug can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Mechanistic investigations revealed that Zinc finger protein SNAI2 (Slug), a key EMT-related transcriptional factor, is the direct target of IGF2BP2, and essential for IGF2BP2-regulated EMT and metastasis in HNSCC.
Target Regulation	Up regulation
Responsed Disease	Head and neck squamous carcinoma		ICD-11: 2B6E	Disease Info
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
In-vitro Model	FaDu	Hypopharyngeal squamous cell carcinoma	Homo sapiens	CVCL_1218
In-vivo Model	To construct the metastasis model, 5 × 10⁶ FaDu cells were transfected with sh-IGF2BP2-luc and sh-NC-luc, suspended in 60 uL PBS, and then injected into the footpads of the mice. Six weeks after injection, mice were subjected to bioluminescence imaging to evaluate lymphatic metastasis. For bioluminescence imaging, mice were anesthetized by inhaling 2% isoflurane for approximately 5 min, injected intraperitoneally with D-Luciferin potassium salt (200 uL, 150 ug/ml, ST196, Beyotime, Shanghai, China), and imaged with a bioluminescence system (NightOwl II LB983, Berthold Technologies, Germany).

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Mechanistic investigations revealed that Zinc finger protein SNAI2 (Slug), a key EMT-related transcriptional factor, is the direct target of IGF2BP2, and essential for IGF2BP2-regulated EMT and metastasis in HNSCC.
Responsed Disease	Head and neck squamous carcinoma [ICD-11: 2B6E]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Adherens junction			hsa04520
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
In-vitro Model	FaDu	Hypopharyngeal squamous cell carcinoma	Homo sapiens	CVCL_1218
In-vivo Model	To construct the metastasis model, 5 × 10⁶ FaDu cells were transfected with sh-IGF2BP2-luc and sh-NC-luc, suspended in 60 uL PBS, and then injected into the footpads of the mice. Six weeks after injection, mice were subjected to bioluminescence imaging to evaluate lymphatic metastasis. For bioluminescence imaging, mice were anesthetized by inhaling 2% isoflurane for approximately 5 min, injected intraperitoneally with D-Luciferin potassium salt (200 uL, 150 ug/ml, ST196, Beyotime, Shanghai, China), and imaged with a bioluminescence system (NightOwl II LB983, Berthold Technologies, Germany).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00677)

Zinc finger protein SNAI2 (Slug)

N6-methyladenosine (m6A)

In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE085049		Click to Show/Hide the Full List
mod site	chr8:48917810-48917811:-		[4]
Sequence	CAATGTTTCTTTTTTAAAAAACAATTTTCAAGTTTTTTTTA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_796981
mod ID: M6ASITE085050		Click to Show/Hide the Full List
mod site	chr8:48917852-48917853:-		[4]
Sequence	GTCTATAGCTATGTCTATAAACAACCTGAAGACTTGTGAAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_796982
mod ID: M6ASITE085051		Click to Show/Hide the Full List
mod site	chr8:48917979-48917980:-		[4]
Sequence	CATACCACAAATGCAATAATACAATACCCCTTCCAAGTGCC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_796983
mod ID: M6ASITE085052		Click to Show/Hide the Full List
mod site	chr8:48918133-48918134:-		[4]
Sequence	GAGGGAAAGATTAGCTTTGAACATTCCTGGCGCATGCTCCA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_796984
mod ID: M6ASITE085053		Click to Show/Hide the Full List
mod site	chr8:48918227-48918228:-		[4]
Sequence	AAAAAAATAACAAGAACAAAACACAGGAGAATGTATTAAAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_796985
mod ID: M6ASITE085054		Click to Show/Hide the Full List
mod site	chr8:48918238-48918239:-		[4]
Sequence	TAAAAGGGAGGAAAAAAATAACAAGAACAAAACACAGGAGA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_796986
mod ID: M6ASITE085055		Click to Show/Hide the Full List
mod site	chr8:48918284-48918285:-		[5]
Sequence	ACTAAAGCCTTTTTTTGATTACCTGTAGTGCTTTAAAGTAT
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000649776.1; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_796987
mod ID: M6ASITE085056		Click to Show/Hide the Full List
mod site	chr8:48918304-48918305:-		[5]
Sequence	TGTCTGGTTGCCATTGTTGAACTAAAGCCTTTTTTTGATTA
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_796988
mod ID: M6ASITE085057		Click to Show/Hide the Full List
mod site	chr8:48918334-48918335:-		[4]
Sequence	TATTCCAAGTTTACTCCATTACATGTCGGTTGTCTGGTTGC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1; ENST00000649776.1
External Link	RMBase: m6A_site_796989
mod ID: M6ASITE085058		Click to Show/Hide the Full List
mod site	chr8:48918373-48918374:-
Sequence	AAGAGATCTGCCAGACGCGAACTCAGGTGCCTTAAAAAGTA
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649776.1; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_796990
mod ID: M6ASITE085059		Click to Show/Hide the Full List
mod site	chr8:48918438-48918439:-		[6]
Sequence	AATCATTTCAACTGAAAAGAACAGTATTGCTTTGTAATAGA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hNPCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_796991
mod ID: M6ASITE085060		Click to Show/Hide the Full List
mod site	chr8:48918544-48918545:-		[6]
Sequence	CTAGATTGAGAGAATAAAAGACAGTAACCTTTCTCTTCAAA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hNPCs; A549; MSC
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1; ENST00000649776.1
External Link	RMBase: m6A_site_796992
mod ID: M6ASITE085061		Click to Show/Hide the Full List
mod site	chr8:48918691-48918692:-		[7]
Sequence	CAACCAAATAATATGTATAGACACACACACATATGCACACA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; hNPCs; fibroblasts; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000020945.4; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_796993
mod ID: M6ASITE085062		Click to Show/Hide the Full List
mod site	chr8:48918713-48918714:-		[5]
Sequence	AGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_796994
mod ID: M6ASITE085063		Click to Show/Hide the Full List
mod site	chr8:48918748-48918749:-		[4]
Sequence	CTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCAT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_796995
mod ID: M6ASITE085064		Click to Show/Hide the Full List
mod site	chr8:48918781-48918782:-		[7]
Sequence	CGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_796996
mod ID: M6ASITE085065		Click to Show/Hide the Full List
mod site	chr8:48918839-48918840:-		[7]
Sequence	AGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_796997
mod ID: M6ASITE085066		Click to Show/Hide the Full List
mod site	chr8:48918843-48918844:-		[4]
Sequence	CTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_796998
mod ID: M6ASITE085067		Click to Show/Hide the Full List
mod site	chr8:48918868-48918869:-		[7]
Sequence	AGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_796999
mod ID: M6ASITE085068		Click to Show/Hide the Full List
mod site	chr8:48918879-48918880:-		[7]
Sequence	AAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797000
mod ID: M6ASITE085069		Click to Show/Hide the Full List
mod site	chr8:48918913-48918914:-		[7]
Sequence	ATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_797001
mod ID: M6ASITE085070		Click to Show/Hide the Full List
mod site	chr8:48918942-48918943:-		[7]
Sequence	CTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hNPCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797002
mod ID: M6ASITE085071		Click to Show/Hide the Full List
mod site	chr8:48919028-48919029:-		[8]
Sequence	ACTTTATGTTTCCTCTAAAAACACTGACTGTCTTTCTTTTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1; ENST00000649776.1
External Link	RMBase: m6A_site_797003
mod ID: M6ASITE085072		Click to Show/Hide the Full List
mod site	chr8:48919684-48919685:-		[9]
Sequence	GGACTGCAAACAGCATGTAGACTTTGGAAAGTAGATTCAGA
Motif Score	3.319380952
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_797004
mod ID: M6ASITE085073		Click to Show/Hide the Full List
mod site	chr8:48919695-48919696:-		[9]
Sequence	CTCTGCTCCAGGGACTGCAAACAGCATGTAGACTTTGGAAA
Motif Score	2.20572619
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_797005
mod ID: M6ASITE085074		Click to Show/Hide the Full List
mod site	chr8:48919702-48919703:-		[9]
Sequence	TAACAACCTCTGCTCCAGGGACTGCAAACAGCATGTAGACT
Motif Score	4.065041667
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1; ENST00000649776.1
External Link	RMBase: m6A_site_797006
mod ID: M6ASITE085075		Click to Show/Hide the Full List
mod site	chr8:48919790-48919791:-		[9]
Sequence	CATAGTGCTTTTAATGATGGACAGTCATTGATAGCTACTTC
Motif Score	3.643047619
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797007
mod ID: M6ASITE085076		Click to Show/Hide the Full List
mod site	chr8:48919883-48919884:-		[7]
Sequence	CTCACACGGGTAAGAGAAAAACCATAGGCAGGAATGTTACT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; HepG2; GSC-11; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797008
mod ID: M6ASITE085077		Click to Show/Hide the Full List
mod site	chr8:48919904-48919905:-		[7]
Sequence	TGCTTCAAGGACACATTAGAACTCACACGGGTAAGAGAAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; GSC-11; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_797009
mod ID: M6ASITE085078		Click to Show/Hide the Full List
mod site	chr8:48919914-48919915:-		[7]
Sequence	AGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2; GSC-11; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_797010
mod ID: M6ASITE085079		Click to Show/Hide the Full List
mod site	chr8:48919932-48919933:-		[7]
Sequence	TGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797011
mod ID: M6ASITE085080		Click to Show/Hide the Full List
mod site	chr8:48919978-48919979:-		[4]
Sequence	GAAGATGCATATTCGGACCCACACATTACCTTGTGTTTGCA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642303.1; ENST00000649776.1; ENST00000020945.4
External Link	RMBase: m6A_site_797012
mod ID: M6ASITE085081		Click to Show/Hide the Full List
mod site	chr8:48919982-48919983:-		[7]
Sequence	CCCTGAAGATGCATATTCGGACCCACACATTACCTTGTGTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_797013
mod ID: M6ASITE085082		Click to Show/Hide the Full List
mod site	chr8:48920026-48920027:-		[4]
Sequence	TTTCAGCTGTAAATACTGTGACAAGGAATATGTGAGCCTGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_797014
mod ID: M6ASITE085083		Click to Show/Hide the Full List
mod site	chr8:48920085-48920086:-		[7]
Sequence	ACTTTTTCTGGGCTGGCCAAACATAAGCAGCTGCACTGCGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2; U2OS; hNPCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000020945.4; ENST00000642303.1; ENST00000649776.1
External Link	RMBase: m6A_site_797015
mod ID: M6ASITE085084		Click to Show/Hide the Full List
mod site	chr8:48920114-48920115:-		[7]
Sequence	AGTGCAATTTATGCAATAAGACCTATTCAACTTTTTCTGGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649776.1; ENST00000642303.1; ENST00000020945.4
External Link	RMBase: m6A_site_797016
mod ID: M6ASITE085085		Click to Show/Hide the Full List
mod site	chr8:48920164-48920165:-		[7]
Sequence	ACTACAGTCCAAGCTTTCAGACCCCCATGCCATTGAAGCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797017
mod ID: M6ASITE085086		Click to Show/Hide the Full List
mod site	chr8:48920184-48920185:-		[7]
Sequence	ATTAGTGATGAAGAGGAAAGACTACAGTCCAAGCTTTCAGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797018
mod ID: M6ASITE085087		Click to Show/Hide the Full List
mod site	chr8:48920227-48920228:-		[7]
Sequence	ATCTGACACCTCCTCCAAGGACCACAGTGGCTCAGAAAGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649776.1; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_797019
mod ID: M6ASITE085088		Click to Show/Hide the Full List
mod site	chr8:48920242-48920243:-		[4]
Sequence	GAGTCCCCCTCCTCCATCTGACACCTCCTCCAAGGACCACA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000649776.1; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_797020
mod ID: M6ASITE085089		Click to Show/Hide the Full List
mod site	chr8:48920342-48920343:-		[7]
Sequence	ACAGCCCCATCACTGTGTGGACTACCGCTGCTCCATTCCAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; U2OS; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649776.1; ENST00000020945.4; ENST00000642303.1; ENST00000396822.6
External Link	RMBase: m6A_site_797021
mod ID: M6ASITE085090		Click to Show/Hide the Full List
mod site	chr8:48920391-48920392:-		[4]
Sequence	TACTCCATGCCTGTCATACCACAACCAGAGATCCTCAGCTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000020945.4; ENST00000396822.6; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_797022
mod ID: M6ASITE085091		Click to Show/Hide the Full List
mod site	chr8:48921197-48921198:-		[10]
Sequence	GCCAAACTACAGCGAACTGGACACACATACAGGTAAAAAGA
Motif Score	3.643047619
Cell/Tissue List	HEK293T; U2OS; iSLK; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000020945.4; ENST00000396822.6; ENST00000649776.1; ENST00000642303.1
External Link	RMBase: m6A_site_797023
mod ID: M6ASITE085092		Click to Show/Hide the Full List
mod site	chr8:48921202-48921203:-		[10]
Sequence	AAAAAGCCAAACTACAGCGAACTGGACACACATACAGGTAA
Motif Score	3.373380952
Cell/Tissue List	U2OS; iSLK; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000649776.1; ENST00000396822.6
External Link	RMBase: m6A_site_797024
mod ID: M6ASITE085093		Click to Show/Hide the Full List
mod site	chr8:48921212-48921213:-		[10]
Sequence	CAACGCCTCCAAAAAGCCAAACTACAGCGAACTGGACACAC
Motif Score	2.627720238
Cell/Tissue List	U2OS; iSLK; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000396822.6; ENST00000649776.1; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_797025
mod ID: M6ASITE085094		Click to Show/Hide the Full List
mod site	chr8:48921277-48921278:-		[10]
Sequence	CCGCGCCGGGCGCCCGCCAGACCCGCTGGCAAGATGCCGCG
Motif Score	2.876744048
Cell/Tissue List	U2OS; GSC-11; MSC; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649776.1; ENST00000396822.6; ENST00000020945.4; ENST00000642303.1
External Link	RMBase: m6A_site_797026
mod ID: M6ASITE085095		Click to Show/Hide the Full List
mod site	chr8:48921305-48921306:-		[8]
Sequence	CCGCCGTGTCCTCCCGCCGGACCGTTATCCGCGCCGGGCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; GSC-11; MSC; TREX; iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000642303.1; ENST00000020945.4; ENST00000396822.6; ENST00000649776.1
External Link	RMBase: m6A_site_797027
mod ID: M6ASITE085096		Click to Show/Hide the Full List
mod site	chr8:48921326-48921327:-		[11]
Sequence	CCCGCCGCGATGCTGTAGGGACCGCCGTGTCCTCCCGCCGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; GSC-11; MSC; TREX; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000396822.6; ENST00000642303.1; ENST00000020945.4; ENST00000649776.1
External Link	RMBase: m6A_site_797028
mod ID: M6ASITE085097		Click to Show/Hide the Full List
mod site	chr8:48921451-48921452:-		[7]
Sequence	GCAAAAGAGAGGAAAAAAAAACCCTCCCAGCCAAAACGGGC
Motif Score	2.185083333
Cell/Tissue List	HeLa; fibroblasts; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000642303.1; ENST00000396822.6
External Link	RMBase: m6A_site_797029

Ref 1	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 2	RNA N6-methyladenosine reader IGF2BP2 promotes lymphatic metastasis and epithelial-mesenchymal transition of head and neck squamous carcinoma cells via stabilizing slug mRNA in an m6A-dependent manner. J Exp Clin Cancer Res. 2022 Jan 3;41(1):6. doi: 10.1186/s13046-021-02212-1.
Ref 3	L-type calcium channel blockers reverse docetaxel and vincristine-induced multidrug resistance independent of ABCB1 expression in human lung cancer cell lines. Toxicol Lett. 2010 Feb 15;192(3):408-18. doi: 10.1016/j.toxlet.2009.11.018. Epub 2009 Nov 26.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 9	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 10	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.
Ref 11	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map