m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00677)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
Slug
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | Mechanistic investigations revealed that Zinc finger protein SNAI2 (Slug), a key EMT-related transcriptional factor, is the direct target of IGF2BP2, and essential for IGF2BP2-regulated EMT and metastasis in HNSCC. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Head and neck squamous carcinoma | ICD-11: 2B6E | ||
| Pathway Response | Adherens junction | hsa04520 | ||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | SCC-15 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1681 |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| In-vivo Model | To construct the metastasis model, 5 × 106 FaDu cells were transfected with sh-IGF2BP2-luc and sh-NC-luc, suspended in 60 uL PBS, and then injected into the footpads of the mice. Six weeks after injection, mice were subjected to bioluminescence imaging to evaluate lymphatic metastasis. For bioluminescence imaging, mice were anesthetized by inhaling 2% isoflurane for approximately 5 min, injected intraperitoneally with D-Luciferin potassium salt (200 uL, 150 ug/ml, ST196, Beyotime, Shanghai, China), and imaged with a bioluminescence system (NightOwl II LB983, Berthold Technologies, Germany). | |||
Head and neck squamous carcinoma [ICD-11: 2B6E]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | Mechanistic investigations revealed that Zinc finger protein SNAI2 (Slug), a key EMT-related transcriptional factor, is the direct target of IGF2BP2, and essential for IGF2BP2-regulated EMT and metastasis in HNSCC. | |||
| Responsed Disease | Head and neck squamous carcinoma [ICD-11: 2B6E] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Adherens junction | hsa04520 | ||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | SCC-15 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1681 |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| In-vivo Model | To construct the metastasis model, 5 × 106 FaDu cells were transfected with sh-IGF2BP2-luc and sh-NC-luc, suspended in 60 uL PBS, and then injected into the footpads of the mice. Six weeks after injection, mice were subjected to bioluminescence imaging to evaluate lymphatic metastasis. For bioluminescence imaging, mice were anesthetized by inhaling 2% isoflurane for approximately 5 min, injected intraperitoneally with D-Luciferin potassium salt (200 uL, 150 ug/ml, ST196, Beyotime, Shanghai, China), and imaged with a bioluminescence system (NightOwl II LB983, Berthold Technologies, Germany). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00677)
| In total 49 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE085049 | Click to Show/Hide the Full List | ||
| mod site | chr8:48917810-48917811:- | [4] | |
| Sequence | CAATGTTTCTTTTTTAAAAAACAATTTTCAAGTTTTTTTTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_796981 | ||
| mod ID: M6ASITE085050 | Click to Show/Hide the Full List | ||
| mod site | chr8:48917852-48917853:- | [4] | |
| Sequence | GTCTATAGCTATGTCTATAAACAACCTGAAGACTTGTGAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796982 | ||
| mod ID: M6ASITE085051 | Click to Show/Hide the Full List | ||
| mod site | chr8:48917979-48917980:- | [4] | |
| Sequence | CATACCACAAATGCAATAATACAATACCCCTTCCAAGTGCC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796983 | ||
| mod ID: M6ASITE085052 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918133-48918134:- | [4] | |
| Sequence | GAGGGAAAGATTAGCTTTGAACATTCCTGGCGCATGCTCCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796984 | ||
| mod ID: M6ASITE085053 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918227-48918228:- | [4] | |
| Sequence | AAAAAAATAACAAGAACAAAACACAGGAGAATGTATTAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796985 | ||
| mod ID: M6ASITE085054 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918238-48918239:- | [4] | |
| Sequence | TAAAAGGGAGGAAAAAAATAACAAGAACAAAACACAGGAGA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796986 | ||
| mod ID: M6ASITE085055 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918284-48918285:- | [5] | |
| Sequence | ACTAAAGCCTTTTTTTGATTACCTGTAGTGCTTTAAAGTAT | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_796987 | ||
| mod ID: M6ASITE085056 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918304-48918305:- | [5] | |
| Sequence | TGTCTGGTTGCCATTGTTGAACTAAAGCCTTTTTTTGATTA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796988 | ||
| mod ID: M6ASITE085057 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918334-48918335:- | [4] | |
| Sequence | TATTCCAAGTTTACTCCATTACATGTCGGTTGTCTGGTTGC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796989 | ||
| mod ID: M6ASITE085058 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918373-48918374:- | ||
| Sequence | AAGAGATCTGCCAGACGCGAACTCAGGTGCCTTAAAAAGTA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_796990 | ||
| mod ID: M6ASITE085059 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918438-48918439:- | [6] | |
| Sequence | AATCATTTCAACTGAAAAGAACAGTATTGCTTTGTAATAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; hNPCs | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796991 | ||
| mod ID: M6ASITE085060 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918544-48918545:- | [6] | |
| Sequence | CTAGATTGAGAGAATAAAAGACAGTAACCTTTCTCTTCAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hNPCs; A549; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796992 | ||
| mod ID: M6ASITE085061 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918691-48918692:- | [7] | |
| Sequence | CAACCAAATAATATGTATAGACACACACACATATGCACACA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; hNPCs; fibroblasts; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_796993 | ||
| mod ID: M6ASITE085062 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918713-48918714:- | [5] | |
| Sequence | AGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATA | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796994 | ||
| mod ID: M6ASITE085063 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918748-48918749:- | [4] | |
| Sequence | CTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796995 | ||
| mod ID: M6ASITE085064 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918781-48918782:- | [7] | |
| Sequence | CGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_796996 | ||
| mod ID: M6ASITE085065 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918839-48918840:- | [7] | |
| Sequence | AGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_796997 | ||
| mod ID: M6ASITE085066 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918843-48918844:- | [4] | |
| Sequence | CTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796998 | ||
| mod ID: M6ASITE085067 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918868-48918869:- | [7] | |
| Sequence | AGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_796999 | ||
| mod ID: M6ASITE085068 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918879-48918880:- | [7] | |
| Sequence | AAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; A549; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797000 | ||
| mod ID: M6ASITE085069 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918913-48918914:- | [7] | |
| Sequence | ATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797001 | ||
| mod ID: M6ASITE085070 | Click to Show/Hide the Full List | ||
| mod site | chr8:48918942-48918943:- | [7] | |
| Sequence | CTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797002 | ||
| mod ID: M6ASITE085071 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919028-48919029:- | [8] | |
| Sequence | ACTTTATGTTTCCTCTAAAAACACTGACTGTCTTTCTTTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; HeLa; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797003 | ||
| mod ID: M6ASITE085072 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919684-48919685:- | [9] | |
| Sequence | GGACTGCAAACAGCATGTAGACTTTGGAAAGTAGATTCAGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797004 | ||
| mod ID: M6ASITE085073 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919695-48919696:- | [9] | |
| Sequence | CTCTGCTCCAGGGACTGCAAACAGCATGTAGACTTTGGAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797005 | ||
| mod ID: M6ASITE085074 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919702-48919703:- | [9] | |
| Sequence | TAACAACCTCTGCTCCAGGGACTGCAAACAGCATGTAGACT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797006 | ||
| mod ID: M6ASITE085075 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919790-48919791:- | [9] | |
| Sequence | CATAGTGCTTTTAATGATGGACAGTCATTGATAGCTACTTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797007 | ||
| mod ID: M6ASITE085076 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919883-48919884:- | [7] | |
| Sequence | CTCACACGGGTAAGAGAAAAACCATAGGCAGGAATGTTACT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; GSC-11; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797008 | ||
| mod ID: M6ASITE085077 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919904-48919905:- | [7] | |
| Sequence | TGCTTCAAGGACACATTAGAACTCACACGGGTAAGAGAAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; GSC-11; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797009 | ||
| mod ID: M6ASITE085078 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919914-48919915:- | [7] | |
| Sequence | AGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; HepG2; GSC-11; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797010 | ||
| mod ID: M6ASITE085079 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919932-48919933:- | [7] | |
| Sequence | TGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797011 | ||
| mod ID: M6ASITE085080 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919978-48919979:- | [4] | |
| Sequence | GAAGATGCATATTCGGACCCACACATTACCTTGTGTTTGCA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000649776.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797012 | ||
| mod ID: M6ASITE085081 | Click to Show/Hide the Full List | ||
| mod site | chr8:48919982-48919983:- | [7] | |
| Sequence | CCCTGAAGATGCATATTCGGACCCACACATTACCTTGTGTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797013 | ||
| mod ID: M6ASITE085082 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920026-48920027:- | [4] | |
| Sequence | TTTCAGCTGTAAATACTGTGACAAGGAATATGTGAGCCTGG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797014 | ||
| mod ID: M6ASITE085083 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920085-48920086:- | [7] | |
| Sequence | ACTTTTTCTGGGCTGGCCAAACATAAGCAGCTGCACTGCGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; HepG2; U2OS; hNPCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000642303.1; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797015 | ||
| mod ID: M6ASITE085084 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920114-48920115:- | [7] | |
| Sequence | AGTGCAATTTATGCAATAAGACCTATTCAACTTTTTCTGGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000642303.1; ENST00000020945.4 | ||
| External Link | RMBase: m6A_site_797016 | ||
| mod ID: M6ASITE085085 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920164-48920165:- | [7] | |
| Sequence | ACTACAGTCCAAGCTTTCAGACCCCCATGCCATTGAAGCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797017 | ||
| mod ID: M6ASITE085086 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920184-48920185:- | [7] | |
| Sequence | ATTAGTGATGAAGAGGAAAGACTACAGTCCAAGCTTTCAGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797018 | ||
| mod ID: M6ASITE085087 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920227-48920228:- | [7] | |
| Sequence | ATCTGACACCTCCTCCAAGGACCACAGTGGCTCAGAAAGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; hNPCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797019 | ||
| mod ID: M6ASITE085088 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920242-48920243:- | [4] | |
| Sequence | GAGTCCCCCTCCTCCATCTGACACCTCCTCCAAGGACCACA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797020 | ||
| mod ID: M6ASITE085089 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920342-48920343:- | [7] | |
| Sequence | ACAGCCCCATCACTGTGTGGACTACCGCTGCTCCATTCCAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000020945.4; ENST00000642303.1; ENST00000396822.6 | ||
| External Link | RMBase: m6A_site_797021 | ||
| mod ID: M6ASITE085090 | Click to Show/Hide the Full List | ||
| mod site | chr8:48920391-48920392:- | [4] | |
| Sequence | TACTCCATGCCTGTCATACCACAACCAGAGATCCTCAGCTC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000396822.6; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797022 | ||
| mod ID: M6ASITE085091 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921197-48921198:- | [10] | |
| Sequence | GCCAAACTACAGCGAACTGGACACACATACAGGTAAAAAGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; U2OS; iSLK; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000020945.4; ENST00000396822.6; ENST00000649776.1; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797023 | ||
| mod ID: M6ASITE085092 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921202-48921203:- | [10] | |
| Sequence | AAAAAGCCAAACTACAGCGAACTGGACACACATACAGGTAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | U2OS; iSLK; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000649776.1; ENST00000396822.6 | ||
| External Link | RMBase: m6A_site_797024 | ||
| mod ID: M6ASITE085093 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921212-48921213:- | [10] | |
| Sequence | CAACGCCTCCAAAAAGCCAAACTACAGCGAACTGGACACAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | U2OS; iSLK; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000396822.6; ENST00000649776.1; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797025 | ||
| mod ID: M6ASITE085094 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921277-48921278:- | [10] | |
| Sequence | CCGCGCCGGGCGCCCGCCAGACCCGCTGGCAAGATGCCGCG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | U2OS; GSC-11; MSC; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000649776.1; ENST00000396822.6; ENST00000020945.4; ENST00000642303.1 | ||
| External Link | RMBase: m6A_site_797026 | ||
| mod ID: M6ASITE085095 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921305-48921306:- | [8] | |
| Sequence | CCGCCGTGTCCTCCCGCCGGACCGTTATCCGCGCCGGGCGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; GSC-11; MSC; TREX; iSLK; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000020945.4; ENST00000396822.6; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797027 | ||
| mod ID: M6ASITE085096 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921326-48921327:- | [11] | |
| Sequence | CCCGCCGCGATGCTGTAGGGACCGCCGTGTCCTCCCGCCGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; GSC-11; MSC; TREX; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000396822.6; ENST00000642303.1; ENST00000020945.4; ENST00000649776.1 | ||
| External Link | RMBase: m6A_site_797028 | ||
| mod ID: M6ASITE085097 | Click to Show/Hide the Full List | ||
| mod site | chr8:48921451-48921452:- | [7] | |
| Sequence | GCAAAAGAGAGGAAAAAAAAACCCTCCCAGCCAAAACGGGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; fibroblasts; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000642303.1; ENST00000396822.6 | ||
| External Link | RMBase: m6A_site_797029 | ||
References