m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00676)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ABCC10
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by FTO | ||
| Cell Line | Mouse hippocampus | Mus musculus |
|
Treatment: FTO knockout mice hippocampus
Control: Wild type hippocampus
|
GSE94098 | |
| Regulation |
![]() ![]() |
logFC: 6.58E-01 p-value: 2.09E-04 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Responsed Drug | Gefitinib | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Responsed Drug | Gefitinib | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
Lung cancer [ICD-11: 2C25]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Gefitinib | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Gefitinib | Approved | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
Gefitinib
[Approved]
| In total 2 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
| Experiment 2 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | Not only FTO knockdown enhanced the gefitinib sensitivity of GR cells but also FTO reduction in donor exosomes alleviated the acquired resistance of recipient non-small cell lung cancer PC9 cells. FTO/YTHDF2/ATP-binding cassette sub-family C member 10 (ABCC10) axis played a role in intercellular transmission of GR cell-derived exosome-mediated gefitinib resistance. | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Pathway Response | ABC transporters | hsa02010 | ||
| In-vitro Model | PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 |
| NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 | |
| In-vivo Model | Mice were randomized into three groups (n = 7/group), 1 × 107 PC9 cells absorbed exosomes were subcutaneously injected into the Bilateral groin of mice. Treatment began 1 week following injection, the mice were intraperitoneally injected with gefitinib (30 mg/kg/day). | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Fat mass and obesity-associated protein (FTO)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05240 | ||
| Epigenetic Regulator | hsa-miR-607 | |
| Regulated Target | FTO alpha-ketoglutarate dependent dioxygenase (FTO) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Non-small cell lung cancer | |
| Drug | Gefitinib | |
| Crosstalk ID: M6ACROT05254 | ||
| Epigenetic Regulator | hsa_circ_0072309 (Circ_LIFR) | |
| Regulated Target | hsa-miR-607 | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Non-small cell lung cancer | |
| Drug | Gefitinib | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00676)
| In total 14 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE001500 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429662-43429663:+ | [2] | |
| Sequence | GCCTGTAATGCCAGCACTGTAGGAGGCCAGGAGTTCGAGAC | ||
| Transcript ID List | ENST00000372515.8; ENST00000443426.2; ENST00000502549.1; ENST00000372530.9; rmsk_1934151 | ||
| External Link | RMBase: RNA-editing_site_116510 | ||
| mod ID: A2ISITE001501 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429700-43429701:+ | [2] | |
| Sequence | GACCAGCCTGCCAACGTGGCAGAATGCCATCTCTACTAAAA | ||
| Transcript ID List | rmsk_1934151; ENST00000372515.8; ENST00000443426.2; ENST00000372530.9; ENST00000502549.1 | ||
| External Link | RMBase: RNA-editing_site_116511 | ||
| mod ID: A2ISITE001502 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429815-43429816:+ | [2] | |
| Sequence | ACTGGAGGTCAGGAGTTTGAAACCAGCCTGGTCAACATGGT | ||
| Transcript ID List | ENST00000443426.2; ENST00000372515.8; rmsk_1934151; ENST00000502549.1; ENST00000372530.9 | ||
| External Link | RMBase: RNA-editing_site_116512 | ||
| mod ID: A2ISITE001503 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429816-43429817:+ | [3] | |
| Sequence | CTGGAGGTCAGGAGTTTGAAACCAGCCTGGTCAACATGGTG | ||
| Transcript ID List | rmsk_1934151; ENST00000443426.2; ENST00000372515.8; ENST00000502549.1; ENST00000372530.9 | ||
| External Link | RMBase: RNA-editing_site_116513 | ||
| mod ID: A2ISITE001504 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429871-43429872:+ | [2] | |
| Sequence | ATCGCTTGAACCCAGGAGGCAGAGGTTGTGGTGCGCCAAGA | ||
| Transcript ID List | ENST00000443426.2; ENST00000502549.1; ENST00000372515.8; ENST00000372530.9; rmsk_1934151 | ||
| External Link | RMBase: RNA-editing_site_116514 | ||
| mod ID: A2ISITE001505 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429888-43429889:+ | [2] | |
| Sequence | GGCAGAGGTTGTGGTGCGCCAAGATTGCACCACTGCACTCC | ||
| Transcript ID List | ENST00000502549.1; rmsk_1934151; ENST00000372515.8; ENST00000443426.2; ENST00000372530.9 | ||
| External Link | RMBase: RNA-editing_site_116515 | ||
| mod ID: A2ISITE001506 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429896-43429897:+ | [2] | |
| Sequence | TTGTGGTGCGCCAAGATTGCACCACTGCACTCCAGCCTGGA | ||
| Transcript ID List | ENST00000372530.9; ENST00000372515.8; ENST00000502549.1; rmsk_1934151; ENST00000443426.2 | ||
| External Link | RMBase: RNA-editing_site_116516 | ||
| mod ID: A2ISITE001507 | Click to Show/Hide the Full List | ||
| mod site | chr6:43429922-43429923:+ | [2] | |
| Sequence | GCACTCCAGCCTGGACGACAAAGCGAGACTCTGTCTCAAAA | ||
| Transcript ID List | ENST00000372515.8; rmsk_1934151; ENST00000372530.9; ENST00000502549.1; ENST00000443426.2 | ||
| External Link | RMBase: RNA-editing_site_116517 | ||
| mod ID: A2ISITE001508 | Click to Show/Hide the Full List | ||
| mod site | chr6:43430151-43430152:+ | [2] | |
| Sequence | CCAGGCTGGAGAGCAGTGGCACGATCTCGGCCCACTGCAAC | ||
| Transcript ID List | ENST00000443426.2; ENST00000372515.8; ENST00000502549.1; ENST00000372530.9 | ||
| External Link | RMBase: RNA-editing_site_116518 | ||
| mod ID: A2ISITE001509 | Click to Show/Hide the Full List | ||
| mod site | chr6:43430164-43430165:+ | [3] | |
| Sequence | CAGTGGCACGATCTCGGCCCACTGCAACCTCCACCTCTTGG | ||
| Transcript ID List | ENST00000443426.2; ENST00000372530.9; ENST00000372515.8; ENST00000502549.1 | ||
| External Link | RMBase: RNA-editing_site_116519 | ||
| mod ID: A2ISITE001510 | Click to Show/Hide the Full List | ||
| mod site | chr6:43430170-43430171:+ | [2] | |
| Sequence | CACGATCTCGGCCCACTGCAACCTCCACCTCTTGGGTTCAA | ||
| Transcript ID List | ENST00000443426.2; ENST00000372530.9; ENST00000502549.1; ENST00000372515.8 | ||
| External Link | RMBase: RNA-editing_site_116520 | ||
| mod ID: A2ISITE001511 | Click to Show/Hide the Full List | ||
| mod site | chr6:43430295-43430296:+ | [2] | |
| Sequence | AGATGGAGTTTCACTGTGTTACACAGGCTGGTCTTGAACTC | ||
| Transcript ID List | ENST00000443426.2; ENST00000372515.8; ENST00000502549.1; ENST00000372530.9 | ||
| External Link | RMBase: RNA-editing_site_116521 | ||
| mod ID: A2ISITE001512 | Click to Show/Hide the Full List | ||
| mod site | chr6:43430796-43430797:+ | [2] | |
| Sequence | CAGTGGCACGATCTCAGCTCACTGCAACCTCCGCCTCCCAG | ||
| Transcript ID List | ENST00000372530.9; ENST00000502549.1; ENST00000372515.8; ENST00000443426.2 | ||
| External Link | RMBase: RNA-editing_site_116522 | ||
| mod ID: A2ISITE001513 | Click to Show/Hide the Full List | ||
| mod site | chr6:43440426-43440427:+ | [3] | |
| Sequence | TGTTGTTCATCTCTTTCCTTAGTGCCTACAACAGTACCTAG | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9; rmsk_1934171; ENST00000469856.1; ENST00000372515.8 | ||
| External Link | RMBase: RNA-editing_site_116523 | ||
5-methylcytidine (m5C)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE004013 | Click to Show/Hide the Full List | ||
| mod site | chr6:43436196-43436197:+ | [4] | |
| Sequence | GAGCCTTGTTCTCCTGGGACCCAGTTGGAACCAGCCTGGAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000372515.8; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m5C_site_38156 | ||
| mod ID: M5CSITE004014 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438007-43438008:+ | [4] | |
| Sequence | GCTGCCATCGCTGGAGAGCTCCACAGGTAACCAACCTCCTA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000372530.9; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m5C_site_38157 | ||
N6-methyladenosine (m6A)
| In total 51 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE075212 | Click to Show/Hide the Full List | ||
| mod site | chr6:43427745-43427746:+ | [5] | |
| Sequence | GGAGAAACGGGAGGGGAAAAACAGATGGCAAGGTGGGTGAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000372530.9; ENST00000502549.1 | ||
| External Link | RMBase: m6A_site_718344 | ||
| mod ID: M6ASITE075213 | Click to Show/Hide the Full List | ||
| mod site | chr6:43427889-43427890:+ | [5] | |
| Sequence | GTTCCAGGGCGGGGCTGGAGACAGGGAGACCCGGCTGGGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000372515.8; ENST00000443426.2; ENST00000502549.1 | ||
| External Link | RMBase: m6A_site_718345 | ||
| mod ID: M6ASITE075214 | Click to Show/Hide the Full List | ||
| mod site | chr6:43427897-43427898:+ | [5] | |
| Sequence | GCGGGGCTGGAGACAGGGAGACCCGGCTGGGAAGTGCAGGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000443426.2; ENST00000502549.1; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718346 | ||
| mod ID: M6ASITE075215 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432227-43432228:+ | [5] | |
| Sequence | TTCCGTCTTCCCGCTGCTAGACCTTCTTCCAGTTGCTTTGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000443426.2; ENST00000372530.9; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718347 | ||
| mod ID: M6ASITE075216 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432267-43432268:+ | [5] | |
| Sequence | CCACCAGGGGCAGGCCCAGGACCCATAGGGCTAGAGGTGTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000443426.2; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718348 | ||
| mod ID: M6ASITE075217 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432561-43432562:+ | [5] | |
| Sequence | GGATGGGCAGCTCCTGGGGGACCACGAGAACCCTGGGCTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; BGC823; H1A; H1B; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000443426.2; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718349 | ||
| mod ID: M6ASITE075218 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432570-43432571:+ | [5] | |
| Sequence | GCTCCTGGGGGACCACGAGAACCCTGGGCTCAGGAGCCCCT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; BGC823; H1A; H1B; A549; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000372515.8; ENST00000244533.7; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718350 | ||
| mod ID: M6ASITE075219 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432609-43432610:+ | [5] | |
| Sequence | CTCCTGCCCGAGGATCAAGAACCTGAGGTGGCTGAAGATGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; H1A; H1B; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000244533.7; ENST00000372530.9; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718351 | ||
| mod ID: M6ASITE075220 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432716-43432717:+ | [5] | |
| Sequence | AGAGCTCCGGCAGCCTCAGGACATTTGCCGCCTCCCCCACA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000372530.9; ENST00000244533.7; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718352 | ||
| mod ID: M6ASITE075221 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432738-43432739:+ | [5] | |
| Sequence | ATTTGCCGCCTCCCCCACAGACTGCAGCCAACCTACCTGGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000443426.2; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718353 | ||
| mod ID: M6ASITE075222 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432846-43432847:+ | [5] | |
| Sequence | CGGTGCTATCTGGCACTTGGACTGCTGAAGCTGGTGGGGAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000443426.2; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718354 | ||
| mod ID: M6ASITE075223 | Click to Show/Hide the Full List | ||
| mod site | chr6:43432865-43432866:+ | [5] | |
| Sequence | GACTGCTGAAGCTGGTGGGGACCATGTTGGGATTCTCAGGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372515.8; ENST00000372530.9; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718355 | ||
| mod ID: M6ASITE075224 | Click to Show/Hide the Full List | ||
| mod site | chr6:43433061-43433062:+ | [5] | |
| Sequence | GGCACGGGGGGCTGTGCTGAACATCCTGTACTGCAAGGCTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1B; GM12878; peripheral-blood; HEK293A-TOA; MSC; TIME; TREX; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000443426.2; ENST00000372530.9; ENST00000372515.8; ENST00000244533.7 | ||
| External Link | RMBase: m6A_site_718356 | ||
| mod ID: M6ASITE075225 | Click to Show/Hide the Full List | ||
| mod site | chr6:43433124-43433125:+ | [5] | |
| Sequence | TCCTACTGGGGAGGCCCTGAACCTACTAGGCACTGACTCTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1B; GM12878; peripheral-blood; HEK293A-TOA; MSC; TIME; TREX; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000372515.8; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718357 | ||
| mod ID: M6ASITE075226 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434854-43434855:+ | [5] | |
| Sequence | TCACTGCCACCAAGGTGAGGACCAGGAAGGAAGGGGACCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000443426.2; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718358 | ||
| mod ID: M6ASITE075227 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434870-43434871:+ | [5] | |
| Sequence | GAGGACCAGGAAGGAAGGGGACCAGCATCAAGGAGACTTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000443426.2; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718359 | ||
| mod ID: M6ASITE075228 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434885-43434886:+ | [5] | |
| Sequence | AGGGGACCAGCATCAAGGAGACTTCAGCGAAGTGAAGACAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; GSC-11; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000244533.7; ENST00000372515.8; ENST00000443426.2 | ||
| External Link | RMBase: m6A_site_718360 | ||
| mod ID: M6ASITE075229 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434902-43434903:+ | [5] | |
| Sequence | GAGACTTCAGCGAAGTGAAGACAGAGGCTTGGGCCCTCAGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; GSC-11; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000244533.7; ENST00000443426.2; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718361 | ||
| mod ID: M6ASITE075230 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434979-43434980:+ | [5] | |
| Sequence | CATCTCTCAACCAAGGGAAAACTGAAGAAACCTTTTTGTGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; H1A; H1B; GSC-11; HEK293A-TOA; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000443426.2; ENST00000372515.8; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718362 | ||
| mod ID: M6ASITE075231 | Click to Show/Hide the Full List | ||
| mod site | chr6:43434988-43434989:+ | [5] | |
| Sequence | ACCAAGGGAAAACTGAAGAAACCTTTTTGTGGGGGCCTTGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; H1A; H1B; GSC-11; HEK293A-TOA; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000443426.2; ENST00000244533.7; ENST00000372530.9; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718363 | ||
| mod ID: M6ASITE075232 | Click to Show/Hide the Full List | ||
| mod site | chr6:43435847-43435848:+ | [5] | |
| Sequence | GGAGGCCAAAGTGTCCTTGGACCGGATCCAGCTTTTCCTCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000372515.8; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718364 | ||
| mod ID: M6ASITE075233 | Click to Show/Hide the Full List | ||
| mod site | chr6:43435877-43435878:+ | [5] | |
| Sequence | GCTTTTCCTCGACCTTCCAAACCACAACCCCCAGGCCTACT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372515.8; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718365 | ||
| mod ID: M6ASITE075234 | Click to Show/Hide the Full List | ||
| mod site | chr6:43436194-43436195:+ | [5] | |
| Sequence | TGGAGCCTTGTTCTCCTGGGACCCAGTTGGAACCAGCCTGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000463024.1; ENST00000244533.7; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718366 | ||
| mod ID: M6ASITE075235 | Click to Show/Hide the Full List | ||
| mod site | chr6:43436205-43436206:+ | [5] | |
| Sequence | TCTCCTGGGACCCAGTTGGAACCAGCCTGGAGACCTTCATC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000463024.1; ENST00000372530.9; ENST00000244533.7 | ||
| External Link | RMBase: m6A_site_718367 | ||
| mod ID: M6ASITE075236 | Click to Show/Hide the Full List | ||
| mod site | chr6:43436217-43436218:+ | [5] | |
| Sequence | CAGTTGGAACCAGCCTGGAGACCTTCATCAGTCATCTCGAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000372530.9; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718368 | ||
| mod ID: M6ASITE075237 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438060-43438061:+ | [5] | |
| Sequence | CTTACTTTGTCCTTTAGCAAACACTGAGCCCCTCTTATGTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718369 | ||
| mod ID: M6ASITE075238 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438085-43438086:+ | [5] | |
| Sequence | GAGCCCCTCTTATGTGTTGGACACCTTTTGGGGGTCAGGGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000372530.9; ENST00000244533.7; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718370 | ||
| mod ID: M6ASITE075239 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438683-43438684:+ | [5] | |
| Sequence | TTTGGCCTGGCCACCCAGGAACCCTGGATCCAGTTTGCCAC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000372530.9; ENST00000463024.1; ENST00000244533.7 | ||
| External Link | RMBase: m6A_site_718371 | ||
| mod ID: M6ASITE075240 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438712-43438713:+ | [5] | |
| Sequence | CCAGTTTGCCACCATCCGAGACAACATCCTCTTTGGGAAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000469856.1; ENST00000372515.8; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718372 | ||
| mod ID: M6ASITE075241 | Click to Show/Hide the Full List | ||
| mod site | chr6:43438732-43438733:+ | [5] | |
| Sequence | ACAACATCCTCTTTGGGAAGACATTTGATGCACAGCTGTAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000244533.7; ENST00000469856.1; ENST00000463024.1; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718373 | ||
| mod ID: M6ASITE075242 | Click to Show/Hide the Full List | ||
| mod site | chr6:43441877-43441878:+ | [5] | |
| Sequence | TCAGATCCTGCCTGCTGGAGACCAGACAGAGGTGGGGGAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000372530.9; ENST00000469856.1; ENST00000372515.8 | ||
| External Link | RMBase: m6A_site_718374 | ||
| mod ID: M6ASITE075243 | Click to Show/Hide the Full List | ||
| mod site | chr6:43441882-43441883:+ | [5] | |
| Sequence | TCCTGCCTGCTGGAGACCAGACAGAGGTGGGGGAGAAGGGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372515.8; ENST00000244533.7; ENST00000372530.9; ENST00000469856.1; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718375 | ||
| mod ID: M6ASITE075244 | Click to Show/Hide the Full List | ||
| mod site | chr6:43441920-43441921:+ | [5] | |
| Sequence | GGTGTCACCCTTAGCGGAGGACAGCGTGCCCGGATTGCCCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000469856.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718376 | ||
| mod ID: M6ASITE075245 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443228-43443229:+ | [5] | |
| Sequence | CAGGGGATTGTGAAGTACAGACTCTGCCCCCTGCTGCATGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718377 | ||
| mod ID: M6ASITE075246 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443289-43443290:+ | [5] | |
| Sequence | CTGCCTCCCGCCTTCACAGAACTGGTGTGAGGAACTGGGAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000244533.7; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718378 | ||
| mod ID: M6ASITE075247 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443302-43443303:+ | [5] | |
| Sequence | TCACAGAACTGGTGTGAGGAACTGGGAGAACAGGAGGGAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000463024.1; ENST00000244533.7 | ||
| External Link | RMBase: m6A_site_718379 | ||
| mod ID: M6ASITE075248 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443311-43443312:+ | [5] | |
| Sequence | TGGTGTGAGGAACTGGGAGAACAGGAGGGAAAAGGAGTACG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718380 | ||
| mod ID: M6ASITE075249 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443890-43443891:+ | [6] | |
| Sequence | CTGAGAAAGGCATAGTATAGACTCAGAACAGTCCTCTCCCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Jurkat; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718381 | ||
| mod ID: M6ASITE075250 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443897-43443898:+ | [7] | |
| Sequence | AGGCATAGTATAGACTCAGAACAGTCCTCTCCCAATCTCCC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718382 | ||
| mod ID: M6ASITE075251 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443933-43443934:+ | [6] | |
| Sequence | CTCCCCTTCTACCCTCCAGGACCTCCCTCTGAGATTCTGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | CD4T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718383 | ||
| mod ID: M6ASITE075252 | Click to Show/Hide the Full List | ||
| mod site | chr6:43443993-43443994:+ | [5] | |
| Sequence | AAAGCCTGGGCTGAGAATGGACAAGAGTCTGACTCAGGTAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; MM6; CD4T; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718384 | ||
| mod ID: M6ASITE075253 | Click to Show/Hide the Full List | ||
| mod site | chr6:43444179-43444180:+ | [5] | |
| Sequence | CACAGCCCAGTCAGTACAGAACCCAGAGAAAACAAAGGAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; CD4T; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718385 | ||
| mod ID: M6ASITE075254 | Click to Show/Hide the Full List | ||
| mod site | chr6:43444190-43444191:+ | [5] | |
| Sequence | CAGTACAGAACCCAGAGAAAACAAAGGAGGGGCTGGAGGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; CD4T; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000463024.1; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718386 | ||
| mod ID: M6ASITE075255 | Click to Show/Hide the Full List | ||
| mod site | chr6:43444931-43444932:+ | [5] | |
| Sequence | GCTCCTCTTTTCCCCTGGAAACCTCTAGTGAGTGGCTGGGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718387 | ||
| mod ID: M6ASITE075256 | Click to Show/Hide the Full List | ||
| mod site | chr6:43446290-43446291:+ | [5] | |
| Sequence | CCCTAGGTTTGAGGAGGAGAACCTGCGACTCCTTGAGCTAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372530.9; ENST00000244533.7; ENST00000463024.1; ENST00000372512.2 | ||
| External Link | RMBase: m6A_site_718388 | ||
| mod ID: M6ASITE075257 | Click to Show/Hide the Full List | ||
| mod site | chr6:43446311-43446312:+ | [5] | |
| Sequence | CCTGCGACTCCTTGAGCTAAACCAGAGGTGCCAGTTTGCCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000372512.2; ENST00000372530.9; ENST00000463024.1; ENST00000244533.7 | ||
| External Link | RMBase: m6A_site_718389 | ||
| mod ID: M6ASITE075258 | Click to Show/Hide the Full List | ||
| mod site | chr6:43446356-43446357:+ | [5] | |
| Sequence | TGCCACAATGCAGTGGCTGGACATTCGGCTACAGCTCATGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372512.2; ENST00000372530.9 | ||
| External Link | RMBase: m6A_site_718390 | ||
| mod ID: M6ASITE075259 | Click to Show/Hide the Full List | ||
| mod site | chr6:43447324-43447325:+ | [5] | |
| Sequence | TGGTGAGCAGCTTCACACAGACAGAGGCCATGCTGGTGAGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372512.2; ENST00000372530.9; ENST00000437104.3; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718391 | ||
| mod ID: M6ASITE075260 | Click to Show/Hide the Full List | ||
| mod site | chr6:43447386-43447387:+ | [5] | |
| Sequence | ACCTGTGACCTGCCCCAGGAACCCCAGGGCCAGCCACTGCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463024.1; ENST00000244533.7; ENST00000372530.9; ENST00000372512.2; ENST00000437104.3 | ||
| External Link | RMBase: m6A_site_718392 | ||
| mod ID: M6ASITE075261 | Click to Show/Hide the Full List | ||
| mod site | chr6:43449967-43449968:+ | [8] | |
| Sequence | TCAGACCGGGTGCTGGTGCTACAAGCGGGGAGAGTGGTAGA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000505344.1; ENST00000244533.7; ENST00000372530.9; ENST00000463024.1 | ||
| External Link | RMBase: m6A_site_718393 | ||
| mod ID: M6ASITE075262 | Click to Show/Hide the Full List | ||
| mod site | chr6:43450283-43450284:+ | [5] | |
| Sequence | CATCCTGAGGCTTCCCCAGAACCAGGCCTCTGCTCTGGCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244533.7; ENST00000372530.9; ENST00000463024.1; ENST00000505344.1 | ||
| External Link | RMBase: m6A_site_718394 | ||
References

