m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00667)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NCALD
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LNCaP cell line | Homo sapiens |
|
Treatment: shMETTL3 LNCaP cells
Control: shControl LNCaP cells
|
GSE147884 | |
| Regulation |
![]() ![]() |
logFC: 1.15E+00 p-value: 3.16E-04 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between NCALD and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 8.03E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 dependent m6A methylation was upregulated in CRC to promote the processing of miR 181d 5p by DGCR8. This led to increased miR 181d 5p expression, which inhibited the 5 FU sensitivity of CRC cells by targeting Neurocalcin-delta (NCALD). | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Responsed Drug | Fluorouracil | Approved | ||
| In-vitro Model | HT29 | Colon cancer | Mus musculus | CVCL_A8EZ |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| In-vivo Model | A tumor-bearing model was established by subcutaneously injecting 100 ul HT29 cells (5×106) followed by an intravenous injection of CAFs-derived exosomes (50 ug/mouse every three days) into the tail vein of the mice. An intraperitoneal injection of 5-FU (50 mg/kg, every week) was administered on day 12. | |||
Colorectal cancer [ICD-11: 2B91]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 dependent m6A methylation was upregulated in CRC to promote the processing of miR 181d 5p by DGCR8. This led to increased miR 181d 5p expression, which inhibited the 5 FU sensitivity of CRC cells by targeting Neurocalcin-delta (NCALD). | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Fluorouracil | Approved | ||
| In-vitro Model | HT29 | Colon cancer | Mus musculus | CVCL_A8EZ |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| In-vivo Model | A tumor-bearing model was established by subcutaneously injecting 100 ul HT29 cells (5×106) followed by an intravenous injection of CAFs-derived exosomes (50 ug/mouse every three days) into the tail vein of the mice. An intraperitoneal injection of 5-FU (50 mg/kg, every week) was administered on day 12. | |||
Fluorouracil
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | METTL3 dependent m6A methylation was upregulated in CRC to promote the processing of miR 181d 5p by DGCR8. This led to increased miR 181d 5p expression, which inhibited the 5 FU sensitivity of CRC cells by targeting Neurocalcin-delta (NCALD). | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| In-vitro Model | HT29 | Colon cancer | Mus musculus | CVCL_A8EZ |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| In-vivo Model | A tumor-bearing model was established by subcutaneously injecting 100 ul HT29 cells (5×106) followed by an intravenous injection of CAFs-derived exosomes (50 ug/mouse every three days) into the tail vein of the mice. An intraperitoneal injection of 5-FU (50 mg/kg, every week) was administered on day 12. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03575 | ||
| Epigenetic Regulator | Histone acetyltransferase p300 (P300) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
| Drug | Fluorouracil | |
| Crosstalk ID: M6ACROT03620 | ||
| Epigenetic Regulator | N-lysine methyltransferase SMYD2 (SMYD2) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
| Drug | Fluorouracil | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00667)
| In total 14 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE002715 | Click to Show/Hide the Full List | ||
| mod site | chr8:101731391-101731392:- | [2] | |
| Sequence | TTATTGGAGAATTTACTGCAAAGAGGTTCTTCATGTCATTG | ||
| Transcript ID List | ENST00000520346.1; ENST00000517531.5; ENST00000520425.5; ENST00000524137.5; ENST00000518661.5; ENST00000518166.5; ENST00000523645.5; ENST00000517822.5; ENST00000520690.5; ENST00000522078.5; ENST00000311028.4; ENST00000519098.5; ENST00000522951.5; ENST00000523923.5; ENST00000524209.5; ENST00000521599.5; ENST00000395923.5; ENST00000522448.5; ENST00000220931.11; ENST00000518727.5; ENST00000522252.5; ENST00000522206.5; ENST00000521964.5 | ||
| External Link | RMBase: RNA-editing_site_132342 | ||
| mod ID: A2ISITE002716 | Click to Show/Hide the Full List | ||
| mod site | chr8:101731392-101731393:- | [2] | |
| Sequence | CTTATTGGAGAATTTACTGCAAAGAGGTTCTTCATGTCATT | ||
| Transcript ID List | ENST00000524209.5; ENST00000524137.5; ENST00000522078.5; ENST00000517531.5; ENST00000518661.5; ENST00000520425.5; ENST00000520690.5; ENST00000519098.5; ENST00000220931.11; ENST00000522951.5; ENST00000521964.5; ENST00000520346.1; ENST00000522252.5; ENST00000522448.5; ENST00000523923.5; ENST00000522206.5; ENST00000517822.5; ENST00000311028.4; ENST00000523645.5; ENST00000518166.5; ENST00000518727.5; ENST00000395923.5; ENST00000521599.5 | ||
| External Link | RMBase: RNA-editing_site_132343 | ||
| mod ID: A2ISITE002717 | Click to Show/Hide the Full List | ||
| mod site | chr8:101843335-101843336:- | [2] | |
| Sequence | AGTTCTGATTCAGTAGGTCTAGCGTGAGGCCTGAGAATTTG | ||
| Transcript ID List | ENST00000311028.4; ENST00000521964.5; ENST00000517531.5; ENST00000521599.5; ENST00000518166.5; ENST00000524209.5; ENST00000518661.5; ENST00000523923.5; ENST00000522206.5; ENST00000517822.5; ENST00000520425.5; ENST00000395923.5; ENST00000518952.5; ENST00000520690.5; ENST00000522078.5; ENST00000518727.5 | ||
| External Link | RMBase: RNA-editing_site_132344 | ||
| mod ID: A2ISITE002718 | Click to Show/Hide the Full List | ||
| mod site | chr8:101872343-101872344:- | [3] | |
| Sequence | GTTTAATGAGGAGGATGAACATGCTATTGAAATGTACAGAT | ||
| Transcript ID List | ENST00000522206.5; ENST00000395923.5; ENST00000520425.5; ENST00000518727.5; ENST00000524209.5; ENST00000523923.5; ENST00000521599.5; ENST00000518952.5; ENST00000517531.5; ENST00000635554.1; ENST00000522078.5; ENST00000518661.5; ENST00000517822.5; ENST00000520690.5; ENST00000521964.5; ENST00000518166.5; ENST00000311028.4 | ||
| External Link | RMBase: RNA-editing_site_132345 | ||
| mod ID: A2ISITE002719 | Click to Show/Hide the Full List | ||
| mod site | chr8:102020431-102020432:- | [2] | |
| Sequence | AAAGAAATAGTGGCATATTAAAGTGTGATACAATGCTAAGA | ||
| Transcript ID List | ENST00000518952.5; ENST00000311028.4; ENST00000521964.5; ENST00000522078.5; ENST00000518166.5; ENST00000521599.5; ENST00000517822.5; ENST00000517639.5; ENST00000395923.5; ENST00000524209.5; ENST00000523923.5; ENST00000522206.5; ENST00000517531.5 | ||
| External Link | RMBase: RNA-editing_site_132346 | ||
| mod ID: A2ISITE002720 | Click to Show/Hide the Full List | ||
| mod site | chr8:102020432-102020433:- | [2] | |
| Sequence | TAAAGAAATAGTGGCATATTAAAGTGTGATACAATGCTAAG | ||
| Transcript ID List | ENST00000395923.5; ENST00000523923.5; ENST00000522078.5; ENST00000517531.5; ENST00000517639.5; ENST00000518952.5; ENST00000521599.5; ENST00000524209.5; ENST00000517822.5; ENST00000311028.4; ENST00000521964.5; ENST00000522206.5; ENST00000518166.5 | ||
| External Link | RMBase: RNA-editing_site_132347 | ||
| mod ID: A2ISITE002721 | Click to Show/Hide the Full List | ||
| mod site | chr8:102020454-102020455:- | [2] | |
| Sequence | AGAACCAATGTAGAACCAATAATAAAGAAATAGTGGCATAT | ||
| Transcript ID List | ENST00000522206.5; ENST00000523923.5; ENST00000524209.5; ENST00000517639.5; ENST00000521964.5; ENST00000521599.5; ENST00000395923.5; ENST00000517531.5; ENST00000518166.5; ENST00000518952.5; ENST00000522078.5; ENST00000517822.5; ENST00000311028.4 | ||
| External Link | RMBase: RNA-editing_site_132348 | ||
| mod ID: A2ISITE002722 | Click to Show/Hide the Full List | ||
| mod site | chr8:102094087-102094088:- | [2] | |
| Sequence | GATAATTTTGGATATACAATAGGAAATGCCTTTCATCATGA | ||
| Transcript ID List | ENST00000518952.5; ENST00000517822.5; ENST00000311028.4; ENST00000521599.5; ENST00000521964.5; ENST00000523923.5; ENST00000517531.5; ENST00000522078.5; ENST00000517639.5; ENST00000524209.5; ENST00000522206.5; ENST00000395923.5; ENST00000518166.5 | ||
| External Link | RMBase: RNA-editing_site_132349 | ||
| mod ID: A2ISITE002723 | Click to Show/Hide the Full List | ||
| mod site | chr8:102094089-102094090:- | [2] | |
| Sequence | TTGATAATTTTGGATATACAATAGGAAATGCCTTTCATCAT | ||
| Transcript ID List | ENST00000521599.5; ENST00000517639.5; ENST00000518166.5; ENST00000517822.5; ENST00000522078.5; ENST00000518952.5; ENST00000521964.5; ENST00000517531.5; ENST00000311028.4; ENST00000523923.5; ENST00000522206.5; ENST00000395923.5; ENST00000524209.5 | ||
| External Link | RMBase: RNA-editing_site_132350 | ||
| mod ID: A2ISITE002724 | Click to Show/Hide the Full List | ||
| mod site | chr8:102094118-102094119:- | [2] | |
| Sequence | ATTTGAAGAGTGATCCTTTTAGAGTGTGATTGATAATTTTG | ||
| Transcript ID List | ENST00000522078.5; ENST00000517822.5; ENST00000311028.4; ENST00000517531.5; ENST00000517639.5; ENST00000518166.5; ENST00000523923.5; ENST00000522206.5; ENST00000524209.5; ENST00000521599.5; ENST00000518952.5; ENST00000395923.5; ENST00000521964.5 | ||
| External Link | RMBase: RNA-editing_site_132351 | ||
| mod ID: A2ISITE002725 | Click to Show/Hide the Full List | ||
| mod site | chr8:102110008-102110009:- | [2] | |
| Sequence | CAATAAAACATTGTCTACAAAGATTGCAGAATAAAAGATAA | ||
| Transcript ID List | ENST00000521964.5; ENST00000522078.5; ENST00000522206.5; ENST00000518952.5; ENST00000523923.5; ENST00000311028.4; ENST00000524209.5; ENST00000517531.5; ENST00000518166.5; ENST00000517822.5; ENST00000395923.5; ENST00000521599.5; ENST00000517639.5 | ||
| External Link | RMBase: RNA-editing_site_132352 | ||
| mod ID: A2ISITE002726 | Click to Show/Hide the Full List | ||
| mod site | chr8:102110023-102110024:- | [2] | |
| Sequence | GAAATATTATATATGCAATAAAACATTGTCTACAAAGATTG | ||
| Transcript ID List | ENST00000522206.5; ENST00000521964.5; ENST00000522078.5; ENST00000517531.5; ENST00000518952.5; ENST00000311028.4; ENST00000521599.5; ENST00000524209.5; ENST00000523923.5; ENST00000518166.5; ENST00000517822.5; ENST00000517639.5; ENST00000395923.5 | ||
| External Link | RMBase: RNA-editing_site_132353 | ||
| mod ID: A2ISITE002727 | Click to Show/Hide the Full List | ||
| mod site | chr8:102110024-102110025:- | [2] | |
| Sequence | TGAAATATTATATATGCAATAAAACATTGTCTACAAAGATT | ||
| Transcript ID List | ENST00000524209.5; ENST00000395923.5; ENST00000522078.5; ENST00000522206.5; ENST00000523923.5; ENST00000517639.5; ENST00000517822.5; ENST00000518952.5; ENST00000521599.5; ENST00000517531.5; ENST00000521964.5; ENST00000311028.4; ENST00000518166.5 | ||
| External Link | RMBase: RNA-editing_site_132354 | ||
| mod ID: A2ISITE002728 | Click to Show/Hide the Full List | ||
| mod site | chr8:102110031-102110032:- | [2] | |
| Sequence | ATTCAGATGAAATATTATATATGCAATAAAACATTGTCTAC | ||
| Transcript ID List | ENST00000524209.5; ENST00000521599.5; ENST00000311028.4; ENST00000395923.5; ENST00000522078.5; ENST00000521964.5; ENST00000523923.5; ENST00000522206.5; ENST00000517531.5; ENST00000517822.5; ENST00000518952.5; ENST00000517639.5; ENST00000518166.5 | ||
| External Link | RMBase: RNA-editing_site_132355 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 46 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE086336 | Click to Show/Hide the Full List | ||
| mod site | chr8:101686765-101686766:- | [4] | |
| Sequence | CAGCCTGTGATGTTCAAGGGACTGGAATAAAGTGGCTTACG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; GM12878; LCLs; Huh7; HEK293A-TOA; MSC; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000395923.5; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805397 | ||
| mod ID: M6ASITE086337 | Click to Show/Hide the Full List | ||
| mod site | chr8:101686787-101686788:- | [4] | |
| Sequence | CCTGTTCTGTCCCAAATAAAACCAGCCTGTGATGTTCAAGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; A549; GM12878; Huh7; HEK293A-TOA; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000311028.4; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805399 | ||
| mod ID: M6ASITE086338 | Click to Show/Hide the Full List | ||
| mod site | chr8:101686808-101686809:- | [4] | |
| Sequence | CAGGGACCTTTGGAAATAAAACCTGTTCTGTCCCAAATAAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; A549; GM12878; Huh7; HEK293A-TOA; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000220931.11; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805400 | ||
| mod ID: M6ASITE086339 | Click to Show/Hide the Full List | ||
| mod site | chr8:101686823-101686824:- | [4] | |
| Sequence | TGTCATTGCTGTGTTCAGGGACCTTTGGAAATAAAACCTGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; GM12878; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000395923.5; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805401 | ||
| mod ID: M6ASITE086340 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687594-101687595:- | [5] | |
| Sequence | CAGGAGAAAAATGTGACTAGACATGCTAACCTCCAGGTTTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000311028.4; ENST00000395923.5 | ||
| External Link | RMBase: m6A_site_805402 | ||
| mod ID: M6ASITE086341 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687624-101687625:- | [5] | |
| Sequence | GAGGAACCACAGAAAGAGAGACATCATGACCAGGAGAAAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000311028.4; ENST00000395923.5; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805403 | ||
| mod ID: M6ASITE086342 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687639-101687640:- | [5] | |
| Sequence | CCACTTGCCAAAGAAGAGGAACCACAGAAAGAGAGACATCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000311028.4; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805404 | ||
| mod ID: M6ASITE086343 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687713-101687714:- | [5] | |
| Sequence | CTCAAGGTTGTTGATGGGGAACTTGCCACTAAGAGAAGGCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000311028.4; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805405 | ||
| mod ID: M6ASITE086344 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687782-101687783:- | [6] | |
| Sequence | AGAGTAAAAATTTGCTGGTTACAGGCGAGTCATACTCTTGC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000311028.4; ENST00000395923.5; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805406 | ||
| mod ID: M6ASITE086345 | Click to Show/Hide the Full List | ||
| mod site | chr8:101687827-101687828:- | [5] | |
| Sequence | GTTTGGTCTGGTGACCTCAGACACACTAATTTGAATTGAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000311028.4; ENST00000395923.5 | ||
| External Link | RMBase: m6A_site_805407 | ||
| mod ID: M6ASITE086346 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688547-101688548:- | [7] | |
| Sequence | TAACATATTGGGTAATGCAGACCAAATTAAGTGTTTTGCCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000311028.4; ENST00000522754.1; ENST00000521599.5; ENST00000395923.5; ENST00000220931.11; ENST00000519508.6; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805408 | ||
| mod ID: M6ASITE086347 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688613-101688614:- | [8] | |
| Sequence | GTAACATATTCCAAAACCAGACCCATCTTGTTGCCTATTGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000522951.5; ENST00000519508.6; ENST00000311028.4; ENST00000395923.5; ENST00000521599.5; ENST00000220931.11; ENST00000522754.1 | ||
| External Link | RMBase: m6A_site_805409 | ||
| mod ID: M6ASITE086348 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688618-101688619:- | [8] | |
| Sequence | AAATGGTAACATATTCCAAAACCAGACCCATCTTGTTGCCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000522951.5; ENST00000220931.11; ENST00000521599.5; ENST00000522754.1; ENST00000395923.5; ENST00000519508.6; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805410 | ||
| mod ID: M6ASITE086349 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688642-101688643:- | [8] | |
| Sequence | TGCGTGTCTTTGGAAATTAAACACAAATGGTAACATATTCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hNPCs; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000522448.5; ENST00000522951.5; ENST00000395923.5; ENST00000521599.5; ENST00000522754.1; ENST00000519508.6; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805411 | ||
| mod ID: M6ASITE086350 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688743-101688744:- | [6] | |
| Sequence | CTGTAGTTTCTAAGCTGTGAACATTTCAAGATAAATTAACA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | brain; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | m6A-REF-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000522754.1; ENST00000521599.5; ENST00000519508.6; ENST00000220931.11; ENST00000522448.5; ENST00000311028.4; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805412 | ||
| mod ID: M6ASITE086351 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688806-101688807:- | [8] | |
| Sequence | GGCTATTCCAGCGAGCTGGGACATTTCCCCATGGGGGCCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000522448.5; ENST00000519508.6; ENST00000522754.1; ENST00000522951.5; ENST00000395923.5; ENST00000521599.5; ENST00000220931.11; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805413 | ||
| mod ID: M6ASITE086352 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688847-101688848:- | [4] | |
| Sequence | GGATGCTGGATTCCCCAAGAACAAGTTACCCTCTGGGGTGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000521599.5; ENST00000522754.1; ENST00000519508.6; ENST00000220931.11; ENST00000522448.5; ENST00000311028.4; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805414 | ||
| mod ID: M6ASITE086353 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688920-101688921:- | [4] | |
| Sequence | GCTTTTGTTTGAAAGACAAAACTCCCCACCTGAATCTGTTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000521599.5; ENST00000311028.4; ENST00000395923.5; ENST00000522951.5; ENST00000522754.1; ENST00000522448.5; ENST00000519508.6; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805415 | ||
| mod ID: M6ASITE086354 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688925-101688926:- | [4] | |
| Sequence | AAGGGGCTTTTGTTTGAAAGACAAAACTCCCCACCTGAATC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000522448.5; ENST00000521599.5; ENST00000519508.6; ENST00000522951.5; ENST00000522754.1; ENST00000220931.11; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805416 | ||
| mod ID: M6ASITE086355 | Click to Show/Hide the Full List | ||
| mod site | chr8:101688979-101688980:- | [8] | |
| Sequence | GTTGGGGCAAAAGAAGGGAAACCCATCCAGTCCTGTGATTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000395923.5; ENST00000519508.6; ENST00000311028.4; ENST00000522448.5; ENST00000522754.1; ENST00000521599.5; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805417 | ||
| mod ID: M6ASITE086356 | Click to Show/Hide the Full List | ||
| mod site | chr8:101689007-101689008:- | [8] | |
| Sequence | TCTCTGTTCTAAAACGTAAGACTCGGGGGTTGGGGCAAAAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | hNPCs; A549; GM12878; Huh7 | ||
| Seq Type List | m6A-seq; m6A-CLIP/IP; MeRIP-seq | ||
| Transcript ID List | ENST00000522951.5; ENST00000311028.4; ENST00000522448.5; ENST00000521599.5; ENST00000522754.1; ENST00000395923.5; ENST00000519508.6; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805418 | ||
| mod ID: M6ASITE086357 | Click to Show/Hide the Full List | ||
| mod site | chr8:101689094-101689095:- | [6] | |
| Sequence | TGTGCTTGTGGAGAGCATGGACAGACTTCGTGGTGTTCATT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; brain; A549; GM12878; Huh7; MSC | ||
| Seq Type List | MeRIP-seq; m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000395923.5; ENST00000519508.6; ENST00000521599.5; ENST00000522448.5; ENST00000311028.4; ENST00000522951.5; ENST00000522754.1 | ||
| External Link | RMBase: m6A_site_805423 | ||
| mod ID: M6ASITE086358 | Click to Show/Hide the Full List | ||
| mod site | chr8:101689222-101689223:- | ||
| Sequence | TTTTTTTTTTTTTTTGCCAAACAATATCAATGGTGATGCCG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000519508.6; ENST00000522754.1; ENST00000522448.5; ENST00000220931.11; ENST00000521599.5; ENST00000522951.5; ENST00000395923.5; ENST00000311028.4 | ||
| External Link | RMBase: m6A_site_805424 | ||
| mod ID: M6ASITE086359 | Click to Show/Hide the Full List | ||
| mod site | chr8:101689401-101689402:- | [7] | |
| Sequence | TCCTCTTGCTTCCTAGGAAAACTCTCCCTGGAAGAGTTCAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000395923.5; ENST00000220931.11; ENST00000522448.5; ENST00000521599.5; ENST00000311028.4; ENST00000519508.6; ENST00000522951.5; ENST00000522754.1 | ||
| External Link | RMBase: m6A_site_805425 | ||
| mod ID: M6ASITE086360 | Click to Show/Hide the Full List | ||
| mod site | chr8:101692804-101692805:- | [7] | |
| Sequence | AAAGATCTTCCGCCAGATGGACACCAATAGAGACGGTAGGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000522754.1; ENST00000521599.5; ENST00000522448.5; ENST00000519508.6; ENST00000311028.4; ENST00000395923.5; ENST00000220931.11; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805426 | ||
| mod ID: M6ASITE086361 | Click to Show/Hide the Full List | ||
| mod site | chr8:101692829-101692830:- | [7] | |
| Sequence | AGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000311028.4; ENST00000521599.5; ENST00000220931.11; ENST00000522754.1; ENST00000395923.5; ENST00000522448.5; ENST00000519508.6; ENST00000522951.5 | ||
| External Link | RMBase: m6A_site_805427 | ||
| mod ID: M6ASITE086362 | Click to Show/Hide the Full List | ||
| mod site | chr8:101694352-101694353:- | [9] | |
| Sequence | CAGGGTTGGTCCTGAGCAAGACTGTAAAGCAGCTCAGGTGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | GM12878; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000522754.1; ENST00000521599.5; ENST00000520690.5; ENST00000522448.5; ENST00000522951.5; ENST00000519508.6; ENST00000311028.4; ENST00000395923.5 | ||
| External Link | RMBase: m6A_site_805428 | ||
| mod ID: M6ASITE086363 | Click to Show/Hide the Full List | ||
| mod site | chr8:101694380-101694381:- | [9] | |
| Sequence | TTATCCAGAACATGTTAGGAACTTCTGGCAGGGTTGGTCCT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | GM12878; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000521599.5; ENST00000522448.5; ENST00000522754.1; ENST00000311028.4; ENST00000522951.5; ENST00000395923.5; ENST00000519508.6; ENST00000520690.5; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805429 | ||
| mod ID: M6ASITE086364 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719387-101719388:- | [4] | |
| Sequence | AAATGGAGATGGGACAATAGACTTTAGAGAATTCATCATCG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; Brain; hNPCs; GM12878; LCLs; MM6; Huh7; iSLK; MSC; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000518727.5; ENST00000517531.5; ENST00000311028.4; ENST00000523923.5; ENST00000522951.5; ENST00000520690.5; ENST00000517822.5; ENST00000522448.5; ENST00000395923.5; ENST00000522252.5; ENST00000521964.5; ENST00000520425.5; ENST00000521599.5; ENST00000519508.6; ENST00000524209.5; ENST00000519098.5; ENST00000518166.5; ENST00000220931.11 | ||
| External Link | RMBase: m6A_site_805430 | ||
| mod ID: M6ASITE086365 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719394-101719395:- | [4] | |
| Sequence | TCGATGCAAATGGAGATGGGACAATAGACTTTAGAGAATTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; hNPCs; GM12878; LCLs; MM6; Huh7; iSLK; MSC; TREX; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000522252.5; ENST00000524209.5; ENST00000520690.5; ENST00000522951.5; ENST00000517531.5; ENST00000311028.4; ENST00000220931.11; ENST00000521599.5; ENST00000522448.5; ENST00000520425.5; ENST00000519098.5; ENST00000518166.5; ENST00000519508.6; ENST00000523923.5; ENST00000521964.5; ENST00000518727.5; ENST00000517822.5; ENST00000395923.5 | ||
| External Link | RMBase: m6A_site_805431 | ||
| mod ID: M6ASITE086366 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719468-101719469:- | [4] | |
| Sequence | GTTTAAGAAAATATATGGGAACTTTTTCCCTTATGGGGATG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000522448.5; ENST00000519098.5; ENST00000517822.5; ENST00000519508.6; ENST00000522951.5; ENST00000518166.5; ENST00000522252.5; ENST00000521964.5; ENST00000520690.5; ENST00000518727.5; ENST00000311028.4; ENST00000395923.5; ENST00000220931.11; ENST00000518661.5; ENST00000520346.1; ENST00000517531.5; ENST00000521599.5; ENST00000520425.5; ENST00000523923.5; ENST00000524209.5 | ||
| External Link | RMBase: m6A_site_805432 | ||
| mod ID: M6ASITE086367 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719506-101719507:- | [4] | |
| Sequence | TTGAGAGACTGCCCCAGTGGACATTTGTCAATGGAAGAGTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; brain; A549; hESC-HEK293T; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000524209.5; ENST00000520690.5; ENST00000523923.5; ENST00000519098.5; ENST00000522206.5; ENST00000520425.5; ENST00000519508.6; ENST00000522448.5; ENST00000395923.5; ENST00000522951.5; ENST00000521964.5; ENST00000517822.5; ENST00000220931.11; ENST00000518661.5; ENST00000311028.4; ENST00000520346.1; ENST00000522252.5; ENST00000518727.5; ENST00000517531.5; ENST00000518166.5; ENST00000521599.5 | ||
| External Link | RMBase: m6A_site_805433 | ||
| mod ID: M6ASITE086368 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719519-101719520:- | [4] | |
| Sequence | GTATAAAGGCTTCTTGAGAGACTGCCCCAGTGGACATTTGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000518166.5; ENST00000311028.4; ENST00000522951.5; ENST00000518661.5; ENST00000517531.5; ENST00000521599.5; ENST00000521964.5; ENST00000520346.1; ENST00000520690.5; ENST00000523923.5; ENST00000520425.5; ENST00000517822.5; ENST00000524209.5; ENST00000522206.5; ENST00000519098.5; ENST00000519508.6; ENST00000522252.5; ENST00000395923.5; ENST00000220931.11; ENST00000518727.5; ENST00000522448.5 | ||
| External Link | RMBase: m6A_site_805434 | ||
| mod ID: M6ASITE086369 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719567-101719568:- | [4] | |
| Sequence | GGACTTGCTGGAAAGCACAGACTTTACAGAGCATGAGATCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000520690.5; ENST00000523923.5; ENST00000522252.5; ENST00000395923.5; ENST00000518166.5; ENST00000311028.4; ENST00000522951.5; ENST00000517531.5; ENST00000518727.5; ENST00000521599.5; ENST00000524209.5; ENST00000519098.5; ENST00000520425.5; ENST00000518661.5; ENST00000519508.6; ENST00000522206.5; ENST00000517822.5; ENST00000220931.11; ENST00000521964.5; ENST00000522448.5; ENST00000520346.1 | ||
| External Link | RMBase: m6A_site_805435 | ||
| mod ID: M6ASITE086370 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719585-101719586:- | [4] | |
| Sequence | GCGCCCGGAGGTCATGCAGGACTTGCTGGAAAGCACAGACT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000521964.5; ENST00000311028.4; ENST00000521599.5; ENST00000522448.5; ENST00000517531.5; ENST00000518166.5; ENST00000522951.5; ENST00000518727.5; ENST00000518661.5; ENST00000517822.5; ENST00000520690.5; ENST00000524137.5; ENST00000520425.5; ENST00000524209.5; ENST00000395923.5; ENST00000522252.5; ENST00000220931.11; ENST00000520346.1; ENST00000523923.5; ENST00000519098.5; ENST00000519508.6; ENST00000522206.5 | ||
| External Link | RMBase: m6A_site_805436 | ||
| mod ID: M6ASITE086371 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719615-101719616:- | [4] | |
| Sequence | CGCCAGGATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; A549; H1B; hNPCs; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000522078.5; ENST00000523923.5; ENST00000518661.5; ENST00000311028.4; ENST00000519098.5; ENST00000522448.5; ENST00000522252.5; ENST00000518166.5; ENST00000520346.1; ENST00000524137.5; ENST00000395923.5; ENST00000220931.11; ENST00000520425.5; ENST00000517822.5; ENST00000522951.5; ENST00000521964.5; ENST00000517531.5; ENST00000522206.5; ENST00000519508.6; ENST00000520690.5; ENST00000524209.5; ENST00000521599.5; ENST00000518727.5 | ||
| External Link | RMBase: m6A_site_805437 | ||
| mod ID: M6ASITE086372 | Click to Show/Hide the Full List | ||
| mod site | chr8:101719620-101719621:- | [4] | |
| Sequence | CTTGCCGCCAGGATGGGGAAACAGAACAGCAAGCTGCGCCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; H1B; hNPCs; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX; endometrial; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000517531.5; ENST00000522252.5; ENST00000220931.11; ENST00000523923.5; ENST00000524137.5; ENST00000395923.5; ENST00000520425.5; ENST00000522951.5; ENST00000522448.5; ENST00000522078.5; ENST00000521599.5; ENST00000520346.1; ENST00000518166.5; ENST00000524209.5; ENST00000519098.5; ENST00000517822.5; ENST00000523645.5; ENST00000518727.5; ENST00000522206.5; ENST00000311028.4; ENST00000518661.5; ENST00000519508.6; ENST00000521964.5; ENST00000520690.5 | ||
| External Link | RMBase: m6A_site_805438 | ||
| mod ID: M6ASITE086373 | Click to Show/Hide the Full List | ||
| mod site | chr8:101721282-101721283:- | [4] | |
| Sequence | GTAGCAGGAGGGAGACAGAAACAAACCCCAGAATGCGTGAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; GM12878; Huh7; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000520690.5; ENST00000518166.5; ENST00000524209.5; ENST00000522951.5; ENST00000522206.5; ENST00000518727.5; ENST00000517822.5; ENST00000519098.5; ENST00000521599.5; ENST00000311028.4; ENST00000520425.5; ENST00000517531.5; ENST00000518661.5; ENST00000522078.5; ENST00000520346.1; ENST00000220931.11; ENST00000523923.5; ENST00000524137.5; ENST00000523645.5; ENST00000521964.5; ENST00000522448.5; ENST00000395923.5; ENST00000522252.5 | ||
| External Link | RMBase: m6A_site_805439 | ||
| mod ID: M6ASITE086374 | Click to Show/Hide the Full List | ||
| mod site | chr8:101721288-101721289:- | [4] | |
| Sequence | GACTGTGTAGCAGGAGGGAGACAGAAACAAACCCCAGAATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; GM12878; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000520690.5; ENST00000518661.5; ENST00000518727.5; ENST00000311028.4; ENST00000522078.5; ENST00000517531.5; ENST00000395923.5; ENST00000519098.5; ENST00000520425.5; ENST00000521599.5; ENST00000518166.5; ENST00000520346.1; ENST00000522951.5; ENST00000522448.5; ENST00000523645.5; ENST00000220931.11; ENST00000517822.5; ENST00000524209.5; ENST00000524137.5; ENST00000522206.5; ENST00000522252.5; ENST00000521964.5; ENST00000523923.5 | ||
| External Link | RMBase: m6A_site_805440 | ||
| mod ID: M6ASITE086375 | Click to Show/Hide the Full List | ||
| mod site | chr8:101788697-101788698:- | [7] | |
| Sequence | TAACCCGTTTGGTGCTGTGGACCTCTTTGGCAGCCTGGTGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000520425.5; ENST00000523923.5; ENST00000521957.1; ENST00000520346.1; ENST00000522448.5; ENST00000520690.5; ENST00000524137.5; ENST00000524101.1; ENST00000395923.5; ENST00000523645.5; ENST00000517531.5; ENST00000522252.5; ENST00000521371.1; ENST00000517822.5; ENST00000518661.5; ENST00000518952.5; ENST00000521964.5; ENST00000522951.5; ENST00000518166.5; ENST00000521599.5; ENST00000518727.5; ENST00000519098.5; ENST00000522206.5; ENST00000522078.5; ENST00000311028.4; ENST00000524209.5 | ||
| External Link | RMBase: m6A_site_805441 | ||
| mod ID: M6ASITE086376 | Click to Show/Hide the Full List | ||
| mod site | chr8:101788724-101788725:- | [7] | |
| Sequence | TATTTTGTGTATAGTTTCGGACATTCTTAACCCGTTTGGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000520425.5; ENST00000311028.4; ENST00000517531.5; ENST00000518952.5; ENST00000521957.1; ENST00000521599.5; ENST00000524137.5; ENST00000524209.5; ENST00000519098.5; ENST00000520690.5; ENST00000518166.5; ENST00000522448.5; ENST00000521964.5; ENST00000517822.5; ENST00000518661.5; ENST00000220931.11; ENST00000523645.5; ENST00000524101.1; ENST00000523923.5; ENST00000522951.5; ENST00000522252.5; ENST00000395923.5; ENST00000518727.5; ENST00000521371.1; ENST00000522078.5; ENST00000522206.5; ENST00000520346.1 | ||
| External Link | RMBase: m6A_site_805442 | ||
| mod ID: M6ASITE086377 | Click to Show/Hide the Full List | ||
| mod site | chr8:101788766-101788767:- | [7] | |
| Sequence | AGGAACGAGGTACTCTAGAAACCTGGCTGTTGCATTATTAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7; TREX | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000524101.1; ENST00000522951.5; ENST00000522448.5; ENST00000519098.5; ENST00000517822.5; ENST00000524209.5; ENST00000523923.5; ENST00000522252.5; ENST00000518166.5; ENST00000523645.5; ENST00000522078.5; ENST00000521964.5; ENST00000520425.5; ENST00000518952.5; ENST00000518661.5; ENST00000220931.11; ENST00000521957.1; ENST00000521371.1; ENST00000521599.5; ENST00000311028.4; ENST00000520690.5; ENST00000524137.5; ENST00000395923.5; ENST00000517531.5; ENST00000518727.5; ENST00000522206.5; ENST00000520346.1 | ||
| External Link | RMBase: m6A_site_805443 | ||
| mod ID: M6ASITE086378 | Click to Show/Hide the Full List | ||
| mod site | chr8:101788837-101788838:- | [7] | |
| Sequence | AATCATTTTACAGCATTGAGACTATGTTGATTTCAAGGTCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000220931.11; ENST00000523645.5; ENST00000311028.4; ENST00000524137.5; ENST00000521964.5; ENST00000522206.5; ENST00000517531.5; ENST00000517822.5; ENST00000519098.5; ENST00000521371.1; ENST00000518727.5; ENST00000524101.1; ENST00000522252.5; ENST00000518952.5; ENST00000520346.1; ENST00000395923.5; ENST00000518166.5; ENST00000521599.5; ENST00000520425.5; ENST00000523923.5; ENST00000518661.5; ENST00000522951.5; ENST00000520690.5; ENST00000522078.5; ENST00000522448.5; ENST00000521957.1; ENST00000524209.5 | ||
| External Link | RMBase: m6A_site_805444 | ||
| mod ID: M6ASITE086379 | Click to Show/Hide the Full List | ||
| mod site | chr8:101788868-101788869:- | [7] | |
| Sequence | GGAAAATAAGAGAAAAAAAGACTGTCATCAGAATCATTTTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000522951.5; ENST00000522206.5; ENST00000517531.5; ENST00000524137.5; ENST00000519098.5; ENST00000520690.5; ENST00000520425.5; ENST00000518661.5; ENST00000521964.5; ENST00000311028.4; ENST00000518727.5; ENST00000522448.5; ENST00000395923.5; ENST00000523923.5; ENST00000520346.1; ENST00000518166.5; ENST00000517822.5; ENST00000524101.1; ENST00000522078.5; ENST00000521957.1; ENST00000220931.11; ENST00000521599.5; ENST00000523645.5; ENST00000522252.5; ENST00000518952.5; ENST00000524209.5; ENST00000521371.1 | ||
| External Link | RMBase: m6A_site_805445 | ||
| mod ID: M6ASITE086380 | Click to Show/Hide the Full List | ||
| mod site | chr8:101790891-101790892:- | [8] | |
| Sequence | CCAGGGGCTGCAGAGCATGGACTGTTAAATCTTGCACTTCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000521599.5; ENST00000523923.5; ENST00000519098.5; ENST00000395923.5; ENST00000521957.1; ENST00000521371.1; ENST00000522252.5; ENST00000517531.5; ENST00000522448.5; ENST00000311028.4; ENST00000523645.5; ENST00000520346.1; ENST00000518661.5; ENST00000522206.5; ENST00000517822.5; ENST00000518727.5; ENST00000518166.5; ENST00000522078.5; ENST00000524101.1; ENST00000518952.5; ENST00000522951.5; ENST00000220931.11; ENST00000521964.5; ENST00000520425.5; ENST00000520690.5; ENST00000524209.5 | ||
| External Link | RMBase: m6A_site_805446 | ||
| mod ID: M6ASITE086381 | Click to Show/Hide the Full List | ||
| mod site | chr8:101790938-101790939:- | [8] | |
| Sequence | GAGAATCTGGTGGATGCTGGACCTTGCTGCTGCTGCTACTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000522448.5; ENST00000518661.5; ENST00000517531.5; ENST00000521957.1; ENST00000522206.5; ENST00000522078.5; ENST00000518727.5; ENST00000521599.5; ENST00000220931.11; ENST00000520690.5; ENST00000523923.5; ENST00000521964.5; ENST00000518952.5; ENST00000522252.5; ENST00000520346.1; ENST00000522951.5; ENST00000523645.5; ENST00000518166.5; ENST00000519098.5; ENST00000524209.5; ENST00000517822.5; ENST00000395923.5; ENST00000311028.4; ENST00000521371.1; ENST00000520425.5 | ||
| External Link | RMBase: m6A_site_805447 | ||
References

