m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00660)

Target Name	Anterior gradient protein 2 homolog (AGR2)
Synonyms	AG-2; hAG-2; HPC8; Secreted cement gland protein XAG-2 homolog Click to Show/Hide
Gene Name	AGR2
Chromosomal Location	7p21.1
Family	AGR family
Function	Required for MUC2 post-transcriptional synthesis and secretion. May play a role in the production of mucus by intestinal cells (By similarity). Proto-oncogene that may play a role in cell migration, cell differentiation and cell growth. Promotes cell adhesion. Click to Show/Hide
Gene ID	10551
Uniprot ID	AGR2_HUMAN
HGNC ID	HGNC:328
KEGG ID	hsa:10551

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

AGR2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -7.71E-01 p-value: 1.08E-130
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the E2F1/Anterior gradient protein 2 homolog (AGR2) axis, and promote the adriamycin resistance of breast cancer.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the E2F1/Anterior gradient protein 2 homolog (AGR2) axis, and promote the adriamycin resistance of breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the E2F1/Anterior gradient protein 2 homolog (AGR2) axis, and promote the adriamycin resistance of breast cancer.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00660)

Anterior gradient protein 2 homolog (AGR2)

N6-methyladenosine (m6A)

In total 24 m6A sequence/site(s) in this target gene
mod ID: M6ASITE078728		Click to Show/Hide the Full List
mod site	chr7:16792366-16792367:-		[2]
Sequence	AGAGTCAACTCTGGCCAGGAACTCTAAGGTACACACTTTCA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000419304.7
External Link	RMBase: m6A_site_749182
mod ID: M6ASITE078729		Click to Show/Hide the Full List
mod site	chr7:16792414-16792415:-		[2]
Sequence	ATAAAAGAATATTTAGAAAAACATCCCAAGAAAATCACATC
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000419304.7
External Link	RMBase: m6A_site_749183
mod ID: M6ASITE078730		Click to Show/Hide the Full List
mod site	chr7:16792477-16792478:-		[2]
Sequence	CACTAGATGACTGTAAGTAGACACGAGCTTAATCAACAGAA
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000419304.7
External Link	RMBase: m6A_site_749184
mod ID: M6ASITE078731		Click to Show/Hide the Full List
mod site	chr7:16792530-16792531:-		[2]
Sequence	TCAAATGATGAAGACCAAAGACCAAGTTATCATCTCACCAC
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000419304.7
External Link	RMBase: m6A_site_749185
mod ID: M6ASITE078732		Click to Show/Hide the Full List
mod site	chr7:16792537-16792538:-		[2]
Sequence	AACTAGTTCAAATGATGAAGACCAAAGACCAAGTTATCATC
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000419304.7
External Link	RMBase: m6A_site_749186
mod ID: M6ASITE078733		Click to Show/Hide the Full List
mod site	chr7:16792812-16792813:-		[3]
Sequence	CTAGTGTGGAAGCATAGTGAACACACTGATTAGGTTATGGT
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000450569.5; ENST00000419304.7
External Link	RMBase: m6A_site_749187
mod ID: M6ASITE078734		Click to Show/Hide the Full List
mod site	chr7:16792837-16792838:-		[3]
Sequence	ACCAGAAGAAGTGTGAGAAGACTGGCTAGTGTGGAAGCATA
Motif Score	3.319380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000450569.5; ENST00000419304.7
External Link	RMBase: m6A_site_749188
mod ID: M6ASITE078735		Click to Show/Hide the Full List
mod site	chr7:16792857-16792858:-		[3]
Sequence	GTCAGGCCTTGAGACTTGAAACCAGAAGAAGTGTGAGAAGA
Motif Score	2.185083333
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000419304.7; ENST00000450569.5
External Link	RMBase: m6A_site_749189
mod ID: M6ASITE078736		Click to Show/Hide the Full List
mod site	chr7:16792864-16792865:-		[3]
Sequence	TCTGTCTGTCAGGCCTTGAGACTTGAAACCAGAAGAAGTGT
Motif Score	3.319380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000419304.7; ENST00000450569.5
External Link	RMBase: m6A_site_749190
mod ID: M6ASITE078737		Click to Show/Hide the Full List
mod site	chr7:16792918-16792919:-		[3]
Sequence	AAGCTCTCAAGTTGCTGAAGACTGAATTGTAAAGAAAAAAA
Motif Score	3.319380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000450569.5; ENST00000419304.7
External Link	RMBase: m6A_site_749191
mod ID: M6ASITE078738		Click to Show/Hide the Full List
mod site	chr7:16801196-16801197:-		[4]
Sequence	TCTGTCTTTTAAAGCAACAAACCCTTGATGATTATTCATCA
Motif Score	2.185083333
Cell/Tissue List	A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000419304.7; ENST00000412973.1; ENST00000489523.5; ENST00000401412.5
External Link	RMBase: m6A_site_749192
mod ID: M6ASITE078739		Click to Show/Hide the Full List
mod site	chr7:16801323-16801324:-		[4]
Sequence	AAGCTCTATATAAATCCAAGACAAGGTAAAGATCAGGATTA
Motif Score	2.897386905
Cell/Tissue List	A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000468419.1; ENST00000489523.5; ENST00000419304.7; ENST00000401412.5; ENST00000412973.1
External Link	RMBase: m6A_site_749193
mod ID: M6ASITE078740		Click to Show/Hide the Full List
mod site	chr7:16801353-16801354:-		[4]
Sequence	ACCAACTCATCTGGACTCAGACATATGAAGAAGCTCTATAT
Motif Score	2.897386905
Cell/Tissue List	A549; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000468419.1; ENST00000401412.5; ENST00000412973.1; ENST00000419304.7; ENST00000489523.5
External Link	RMBase: m6A_site_749194
mod ID: M6ASITE078741		Click to Show/Hide the Full List
mod site	chr7:16801359-16801360:-		[4]
Sequence	GGGGTGACCAACTCATCTGGACTCAGACATATGAAGAAGCT
Motif Score	4.065041667
Cell/Tissue List	A549; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000412973.1; ENST00000401412.5; ENST00000468419.1; ENST00000489523.5; ENST00000419304.7
External Link	RMBase: m6A_site_749195
mod ID: M6ASITE078742		Click to Show/Hide the Full List
mod site	chr7:16801669-16801670:-		[5]
Sequence	CTCGACCCAAACTGCCCCAGACCCTCTCCAGAGGTAGGAGT
Motif Score	2.876744048
Cell/Tissue List	HepG2; A549; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000412973.1; ENST00000468419.1; ENST00000489523.5; ENST00000401412.5; ENST00000419304.7
External Link	RMBase: m6A_site_749196
mod ID: M6ASITE078743		Click to Show/Hide the Full List
mod site	chr7:16801679-16801680:-		[5]
Sequence	ACAAAGGACTCTCGACCCAAACTGCCCCAGACCCTCTCCAG
Motif Score	2.627720238
Cell/Tissue List	HepG2; A549; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000412973.1; ENST00000468419.1; ENST00000489523.5; ENST00000401412.5; ENST00000419304.7
External Link	RMBase: m6A_site_749197
mod ID: M6ASITE078744		Click to Show/Hide the Full List
mod site	chr7:16801692-16801693:-		[5]
Sequence	AGCCAAAAAGGACACAAAGGACTCTCGACCCAAACTGCCCC
Motif Score	4.065041667
Cell/Tissue List	HepG2; A549; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000468419.1; ENST00000419304.7; ENST00000401412.5; ENST00000412973.1; ENST00000489523.5
External Link	RMBase: m6A_site_749198
mod ID: M6ASITE078745		Click to Show/Hide the Full List
mod site	chr7:16801701-16801702:-		[5]
Sequence	CAAACCTGGAGCCAAAAAGGACACAAAGGACTCTCGACCCA
Motif Score	3.643047619
Cell/Tissue List	HepG2; A549; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000412973.1; ENST00000468419.1; ENST00000401412.5; ENST00000419304.7; ENST00000489523.5
External Link	RMBase: m6A_site_749199
mod ID: M6ASITE078746		Click to Show/Hide the Full List
mod site	chr7:16801718-16801719:-		[5]
Sequence	GCCAGAGATACCACAGTCAAACCTGGAGCCAAAAAGGACAC
Motif Score	2.185083333
Cell/Tissue List	HepG2; A549; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000468419.1; ENST00000489523.5; ENST00000401412.5; ENST00000419304.7; ENST00000412973.1
External Link	RMBase: m6A_site_749200
mod ID: M6ASITE078747		Click to Show/Hide the Full List
mod site	chr7:16804984-16804985:-		[6]
Sequence	TGGCACACTCAGAAGCTTGGACCGCATCCTAGCCGCCGACT
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000412973.1; ENST00000419304.7; ENST00000489523.5; ENST00000401412.5; ENST00000486219.1; ENST00000468419.1
External Link	RMBase: m6A_site_749201
mod ID: M6ASITE078748		Click to Show/Hide the Full List
mod site	chr7:16811668-16811669:-		[6]
Sequence	CAAACAGAAGAATATTGAGAACATAGTACGTGTTATTCTCT
Motif Score	2.951386905
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000412973.1
External Link	RMBase: m6A_site_749202
mod ID: M6ASITE078749		Click to Show/Hide the Full List
mod site	chr7:16811685-16811686:-		[6]
Sequence	CATATGGAAAACACTTGCAAACAGAAGAATATTGAGAACAT
Motif Score	2.20572619
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000412973.1
External Link	RMBase: m6A_site_749203
mod ID: M6ASITE078750		Click to Show/Hide the Full List
mod site	chr7:16811695-16811696:-		[6]
Sequence	CAGAATGAGTCATATGGAAAACACTTGCAAACAGAAGAATA
Motif Score	2.20572619
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000412973.1
External Link	RMBase: m6A_site_749204
mod ID: M6ASITE078751		Click to Show/Hide the Full List
mod site	chr7:16811736-16811737:-		[6]
Sequence	AGGCTGACCTATTGCTGAGGACTATGAGAAAAAAGTTATTA
Motif Score	4.065041667
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000412973.1
External Link	RMBase: m6A_site_749205

Ref 1	Effect of m6A methyltransferase METTL3 -mediated MALAT1/E2F1/AGR2 axis on adriamycin resistance in breast cancer. J Biochem Mol Toxicol. 2022 Jan;36(1):e22922. doi: 10.1002/jbt.22922. Epub 2021 Dec 28.
Ref 2	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 3	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 4	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 5	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 6	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map