m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00646)
Target Name p53 apoptosis effector related to PMP-22 (PERP)
Synonyms
Keratinocyte-associated protein 1; KCP-1; P53-induced protein PIGPC1; Transmembrane protein THW
    Click to Show/Hide
Gene Name PERP
Chromosomal Location 6q23.3
Family TMEM47 family
Function
Component of intercellular desmosome junctions. Plays a role in stratified epithelial integrity and cell-cell adhesion by promoting desmosome assembly; FUNCTION: Plays a role as an effector in the TP53-dependent apoptotic pathway.
    Click to Show/Hide
Gene ID 64065
Uniprot ID
PERP_HUMAN
HGNC ID
HGNC:17637
KEGG ID
hsa:64065
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PERP can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL14-/- ESCs
Control: Wild type ESCs
 GSE145309
Regulation
logFC: 1.56E+00
p-value: 2.67E-25
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The upregulation of METTL14 leads to the decrease of p53 apoptosis effector related to PMP-22 (PERP) levels via m6A modification, promoting the growth and metastasis of pancreatic cancer; therefore METTL14 is a potential therapeutic target for its treatment.
Target Regulation Down regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
In-vitro Model SW1990 Pancreatic adenocarcinoma Homo sapiens CVCL_1723
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
Panc 03.27 Pancreatic adenocarcinoma Homo sapiens CVCL_1635
MIA PaCa-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0428
Capan-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0026
BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
AsPC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0152
In-vivo Model For the subcutaneous transplantation model, 100 uL of 1 × 106 cells were injected subcutaneously into the right armpit of BALB/c nude mice. Animal weight and tumor diameter were measured once a week from the time of implantation.For the pancreatic cancer orthotopic implantation model, 200 uL of Panc02-lucifer cells (2 × 107) were injected into the pancreas in mice anesthetized and laparotomized. After 4 weeks, the mice were anesthetized and injected with 150 mg/kg d-luciferin, via the tail vein.For the liver metastasis model, BALB/c nude mice received 2 × 106 cells (in 100 uL DMEM), directly injected into the spleen. Their body weight was measured once a week from the time of implantation.
Pancreatic cancer [ICD-11: 2C10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The upregulation of METTL14 leads to the decrease of p53 apoptosis effector related to PMP-22 (PERP) levels via m6A modification, promoting the growth and metastasis of pancreatic cancer; therefore METTL14 is a potential therapeutic target for its treatment.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Down regulation
In-vitro Model SW1990 Pancreatic adenocarcinoma Homo sapiens CVCL_1723
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
Panc 03.27 Pancreatic adenocarcinoma Homo sapiens CVCL_1635
MIA PaCa-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0428
Capan-2 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0026
BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
AsPC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0152
In-vivo Model For the subcutaneous transplantation model, 100 uL of 1 × 106 cells were injected subcutaneously into the right armpit of BALB/c nude mice. Animal weight and tumor diameter were measured once a week from the time of implantation.For the pancreatic cancer orthotopic implantation model, 200 uL of Panc02-lucifer cells (2 × 107) were injected into the pancreas in mice anesthetized and laparotomized. After 4 weeks, the mice were anesthetized and injected with 150 mg/kg d-luciferin, via the tail vein.For the liver metastasis model, BALB/c nude mice received 2 × 106 cells (in 100 uL DMEM), directly injected into the spleen. Their body weight was measured once a week from the time of implantation.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00646)
p53 apoptosis effector related to PMP-22 (PERP)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000114 Click to Show/Hide the Full List
mod site chr6:138090983-138090984:- [2]
Sequence GTCTGATATAAAACATGCCACAGGAGAATTCGGGGATTTGA
Cell/Tissue List H1
Seq Type List ac4C-seq
Transcript ID List ENST00000421351.4
External Link RMBase: ac4C_site_1624
N6-methyladenosine (m6A)
In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE077470 Click to Show/Hide the Full List
mod site chr6:138090785-138090786:- [3]
Sequence CAATAAACCAGGTATTCTAAACTTGTTTCCAGTTTGTAGTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735437
mod ID: M6ASITE077471 Click to Show/Hide the Full List
mod site chr6:138090799-138090800:- [3]
Sequence TTATGAAGTTTTCCCAATAAACCAGGTATTCTAAACTTGTT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735438
mod ID: M6ASITE077472 Click to Show/Hide the Full List
mod site chr6:138090885-138090886:- [3]
Sequence TTTCGACTTACATAATGAAAACCAATTCATTTTAAATATCA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735439
mod ID: M6ASITE077473 Click to Show/Hide the Full List
mod site chr6:138090896-138090897:- [4]
Sequence ATTTTTTACCATTTCGACTTACATAATGAAAACCAATTCAT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735440
mod ID: M6ASITE077474 Click to Show/Hide the Full List
mod site chr6:138090991-138090992:- [3]
Sequence TTTTAAATGTCTGATATAAAACATGCCACAGGAGAATTCGG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735441
mod ID: M6ASITE077475 Click to Show/Hide the Full List
mod site chr6:138091016-138091017:- [3]
Sequence ATCCTGGTCTTTCTTGGTAAACAGATTTTAAATGTCTGATA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735442
mod ID: M6ASITE077476 Click to Show/Hide the Full List
mod site chr6:138091053-138091054:- [3]
Sequence GTTTGCAACTGTAAGCAGAAACCTACATATAGTTAAAATCC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735443
mod ID: M6ASITE077477 Click to Show/Hide the Full List
mod site chr6:138091066-138091067:- [5]
Sequence CAGGCTTCTGATAGTTTGCAACTGTAAGCAGAAACCTACAT
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735444
mod ID: M6ASITE077478 Click to Show/Hide the Full List
mod site chr6:138091087-138091088:- [3]
Sequence ATCTGGGCTCTATCATATAGACAGGCTTCTGATAGTTTGCA
Motif Score 2.897386905
Cell/Tissue List HeLa; liver
Seq Type List m6A-seq; m6A-REF-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735445
mod ID: M6ASITE077479 Click to Show/Hide the Full List
mod site chr6:138091132-138091133:- [5]
Sequence CAGCCTCAGGAGAATAAATGACTTGCTTTTCTAAATCTCAG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735446
mod ID: M6ASITE077480 Click to Show/Hide the Full List
mod site chr6:138091153-138091154:- [3]
Sequence GTCACAAAAGTGCCACTAAAACAGCCTCAGGAGAATAAATG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735447
mod ID: M6ASITE077481 Click to Show/Hide the Full List
mod site chr6:138091170-138091171:- [5]
Sequence TTAGGAGGGTCATTCTTGTCACAAAAGTGCCACTAAAACAG
Motif Score 2.047297619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735448
mod ID: M6ASITE077482 Click to Show/Hide the Full List
mod site chr6:138091224-138091225:- [5]
Sequence ACTGGGTCTAATTTATCATGACTGATAGATCTGGTTAAGTT
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735449
mod ID: M6ASITE077483 Click to Show/Hide the Full List
mod site chr6:138091244-138091245:- [3]
Sequence TAGACTGGATTGAAAGATGGACTGGGTCTAATTTATCATGA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735450
mod ID: M6ASITE077484 Click to Show/Hide the Full List
mod site chr6:138091261-138091262:- [3]
Sequence TATGTTCAGAACCAGAGTAGACTGGATTGAAAGATGGACTG
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735451
mod ID: M6ASITE077485 Click to Show/Hide the Full List
mod site chr6:138091271-138091272:- [3]
Sequence TTTGTGTTTATATGTTCAGAACCAGAGTAGACTGGATTGAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735452
mod ID: M6ASITE077486 Click to Show/Hide the Full List
mod site chr6:138091414-138091415:- [3]
Sequence AGTACTATTTCATGGTCCAAACCTGTTGCCATAGTTGGTAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735453
mod ID: M6ASITE077487 Click to Show/Hide the Full List
mod site chr6:138091455-138091456:- [5]
Sequence TTAGCTAAGGCTTCATGTTGACTCGATATGTCATCTAGGAA
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735454
mod ID: M6ASITE077488 Click to Show/Hide the Full List
mod site chr6:138091555-138091556:- [3]
Sequence GTTTATTTTCAAGCCTTCGAACTATTTAAGGAAAGCAAAAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735455
mod ID: M6ASITE077489 Click to Show/Hide the Full List
mod site chr6:138091602-138091603:- [3]
Sequence TAAAAGTTGTTAATGACCAAACATTCTAAAAGAAATGCAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T; hNPCs
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735456
mod ID: M6ASITE077490 Click to Show/Hide the Full List
mod site chr6:138091607-138091608:- [5]
Sequence AAGGTTAAAAGTTGTTAATGACCAAACATTCTAAAAGAAAT
Motif Score 2.839113095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735457
mod ID: M6ASITE077491 Click to Show/Hide the Full List
mod site chr6:138091663-138091664:- [3]
Sequence GTTATTTCCAAATAGAATGGACTCGGTCTGTTAAGGGCTAA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735458
mod ID: M6ASITE077492 Click to Show/Hide the Full List
mod site chr6:138091739-138091740:- [4]
Sequence GAATATGCACGTGAAACTTAACACTTTATAAGGTAAAAATG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735459
mod ID: M6ASITE077493 Click to Show/Hide the Full List
mod site chr6:138091744-138091745:- [3]
Sequence TAAGAGAATATGCACGTGAAACTTAACACTTTATAAGGTAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735460
mod ID: M6ASITE077494 Click to Show/Hide the Full List
mod site chr6:138091771-138091772:- [5]
Sequence CTATCCATAACATTTATACTACATTTGTAAGAGAATATGCA
Motif Score 2.078666667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735461
mod ID: M6ASITE077495 Click to Show/Hide the Full List
mod site chr6:138091774-138091775:- [5]
Sequence TATCTATCCATAACATTTATACTACATTTGTAAGAGAATAT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735462
mod ID: M6ASITE077496 Click to Show/Hide the Full List
mod site chr6:138091782-138091783:- [4]
Sequence TTTCCTTATATCTATCCATAACATTTATACTACATTTGTAA
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735463
mod ID: M6ASITE077497 Click to Show/Hide the Full List
mod site chr6:138091814-138091815:- [5]
Sequence TCTTTTCACTAATTACCTATACTATGCCAATATTTCCTTAT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735464
mod ID: M6ASITE077498 Click to Show/Hide the Full List
mod site chr6:138091820-138091821:- [5]
Sequence GTTGTGTCTTTTCACTAATTACCTATACTATGCCAATATTT
Motif Score 2.052208333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735465
mod ID: M6ASITE077499 Click to Show/Hide the Full List
mod site chr6:138091929-138091930:- [3]
Sequence GGCAGTGTTCATATTATTAAACTAGTCAAAAATGCTAAAAT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735466
mod ID: M6ASITE077500 Click to Show/Hide the Full List
mod site chr6:138091960-138091961:- [3]
Sequence GTTTCTCCAGGCGACTTTGAACCCATTTTTTGGCAGTGTTC
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735467
mod ID: M6ASITE077501 Click to Show/Hide the Full List
mod site chr6:138091967-138091968:- [5]
Sequence AGAAACTGTTTCTCCAGGCGACTTTGAACCCATTTTTTGGC
Motif Score 3.287565476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735468
mod ID: M6ASITE077502 Click to Show/Hide the Full List
mod site chr6:138091983-138091984:- [3]
Sequence GATGGACTCCAGAAGAAGAAACTGTTTCTCCAGGCGACTTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735469
mod ID: M6ASITE077503 Click to Show/Hide the Full List
mod site chr6:138091998-138091999:- [3]
Sequence AATCGCTGCTGCTGAGATGGACTCCAGAAGAAGAAACTGTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735470
mod ID: M6ASITE077504 Click to Show/Hide the Full List
mod site chr6:138092054-138092055:- [5]
Sequence TGCCAAGCCCAGGTACTTCTACACATCTGCCTAACTTGGGA
Motif Score 2.078666667
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735471
mod ID: M6ASITE077505 Click to Show/Hide the Full List
mod site chr6:138092183-138092184:- [4]
Sequence TGCCAACCCTGCTGTCACTTACATCTATAACTGGGCCTACG
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735472
mod ID: M6ASITE077506 Click to Show/Hide the Full List
mod site chr6:138092217-138092218:- [3]
Sequence ACCCCGTGAAGTACACCCAGACCTTCACCCTTCATGCCAAC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735473
mod ID: M6ASITE077507 Click to Show/Hide the Full List
mod site chr6:138092225-138092226:- [5]
Sequence GGTAATTTACCCCGTGAAGTACACCCAGACCTTCACCCTTC
Motif Score 2.856142857
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735474
mod ID: M6ASITE077508 Click to Show/Hide the Full List
mod site chr6:138096405-138096406:- [3]
Sequence TCCTTCTTCGCCCTCTGTGGACCCCAGATGCTTGTCTTCCT
Motif Score 3.622404762
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735475
mod ID: M6ASITE077509 Click to Show/Hide the Full List
mod site chr6:138107263-138107264:- [4]
Sequence ACTCAGCGCCATCGCCTTCGACATCATCGCGCTGGCCGGCC
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735476
mod ID: M6ASITE077510 Click to Show/Hide the Full List
mod site chr6:138107341-138107342:- [4]
Sequence CGGCCCCGCGCCGCCCGTCAACATGATCCGCTGCGGCCTGG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000421351.4
External Link RMBase: m6A_site_735477
2'-O-Methylation (2'-O-Me)
In total 2 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000414 Click to Show/Hide the Full List
mod site chr6:138091215-138091216:- [6]
Sequence AATTTATCATGACTGATAGATCTGGTTAAGTTGTGTAGTAA
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000421351.4
External Link RMBase: Nm_site_5983
mod ID: 2OMSITE000415 Click to Show/Hide the Full List
mod site chr6:138091981-138091982:- [6]
Sequence TGGACTCCAGAAGAAGAAACTGTTTCTCCAGGCGACTTTGA
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000421351.4
External Link RMBase: Nm_site_5984