m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00645)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SFRP2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1 | ||
| Cell Line | c2c12 cell line | Mus musculus |
|
Treatment: HNRNPA2B1 knockout c2c12 cells
Control: WT c2c12 cells
|
GSE152467 | |
| Regulation |
![]() ![]() |
logFC: 9.22E+00 p-value: 5.06E-12 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | HNRNPA2B1 inhibits Secreted frizzled-related protein 2 (SFRP2) and activates Wnt-Beta/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Lung adenocarcinoma | ICD-11: 2C25.0 | ||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| In-vitro Model | NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| In-vivo Model | A549 cells were transfected with lentivirus-packaged sh-HNRNPA2B1 (lv-sh-HNRNPA2B1) or control (lv-shCtrl). Then, each mouse was injected subcutaneously with A549 cells of indicated transfection group to generate xenografts. The tumor volume ((width2 × length)/2) was evaluated 4 days a time until 28 days. | |||
Lung cancer [ICD-11: 2C25]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | HNRNPA2B1 inhibits Secreted frizzled-related protein 2 (SFRP2) and activates Wnt-Beta/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression. | |||
| Responsed Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Target Regulator | Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) | READER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| In-vitro Model | NCI-H1975 | Lung adenocarcinoma | Homo sapiens | CVCL_1511 |
| A-549 | Lung adenocarcinoma | Homo sapiens | CVCL_0023 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| In-vivo Model | A549 cells were transfected with lentivirus-packaged sh-HNRNPA2B1 (lv-sh-HNRNPA2B1) or control (lv-shCtrl). Then, each mouse was injected subcutaneously with A549 cells of indicated transfection group to generate xenografts. The tumor volume ((width2 × length)/2) was evaluated 4 days a time until 28 days. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00645)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: AC4SITE000090 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781426-153781427:- | [3] | |
| Sequence | CGGCATCCTGATGGCTCCGACAGGCCTGCTCCAGAGCACGG | ||
| Cell/Tissue List | H1 | ||
| Seq Type List | ac4C-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: ac4C_site_1469 | ||
N6-methyladenosine (m6A)
| In total 16 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE068481 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781362-153781363:- | [4] | |
| Sequence | TCAGCTCCCGTTCCCCAAGCACACTCCTAGCTGCTCCAGTC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654850 | ||
| mod ID: M6ASITE068482 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781549-153781550:- | [5] | |
| Sequence | TATCTGGTCATGGGACAGAAACAGGGTGGGGAGCTGGTGAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654851 | ||
| mod ID: M6ASITE068483 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781555-153781556:- | [5] | |
| Sequence | GCGCCCTATCTGGTCATGGGACAGAAACAGGGTGGGGAGCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654852 | ||
| mod ID: M6ASITE068484 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781616-153781617:- | [5] | |
| Sequence | ATCGGTGCTGTGGCTCAAAGACAGCTTGCAGTGCACCTGTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654853 | ||
| mod ID: M6ASITE068485 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781646-153781647:- | [5] | |
| Sequence | GAACGGTGTGTCCGAAAGGGACCTGAAGAAATCGGTGCTGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654854 | ||
| mod ID: M6ASITE068486 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781673-153781674:- | [4] | |
| Sequence | GACCAAGAGCAAGACCATTTACAAGCTGAACGGTGTGTCCG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654855 | ||
| mod ID: M6ASITE068487 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781680-153781681:- | [5] | |
| Sequence | TCCTGGAGACCAAGAGCAAGACCATTTACAAGCTGAACGGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | H1B; hNPCs; hESCs; fibroblasts; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654856 | ||
| mod ID: M6ASITE068488 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781692-153781693:- | [6] | |
| Sequence | ATACCAAAATCATCCTGGAGACCAAGAGCAAGACCATTTAC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | hNPCs; hESCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654857 | ||
| mod ID: M6ASITE068489 | Click to Show/Hide the Full List | ||
| mod site | chr4:153781724-153781725:- | [4] | |
| Sequence | AAAAGTGAAGGAGATAACCTACATCAACCGAGATACCAAAA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654858 | ||
| mod ID: M6ASITE068490 | Click to Show/Hide the Full List | ||
| mod site | chr4:153785895-153785896:- | [4] | |
| Sequence | TAAAAATGATGATGACAACGACATAATGGAAACGCTTTGTA | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654859 | ||
| mod ID: M6ASITE068491 | Click to Show/Hide the Full List | ||
| mod site | chr4:153785901-153785902:- | [4] | |
| Sequence | CAAAAATAAAAATGATGATGACAACGACATAATGGAAACGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654860 | ||
| mod ID: M6ASITE068492 | Click to Show/Hide the Full List | ||
| mod site | chr4:153788392-153788393:- | [4] | |
| Sequence | GTGCGACCGTTTCCCCCAGGACAACGACCTTTGCATCCCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654861 | ||
| mod ID: M6ASITE068493 | Click to Show/Hide the Full List | ||
| mod site | chr4:153788665-153788666:- | [4] | |
| Sequence | CCACGGCATCGAATACCAGAACATGCGGCTGCCCAACCTGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654862 | ||
| mod ID: M6ASITE068494 | Click to Show/Hide the Full List | ||
| mod site | chr4:153788731-153788732:- | [4] | |
| Sequence | TGGCCAGCCCGACTTCTCCTACAAGCGCAGCAATTGCAAGC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654863 | ||
| mod ID: M6ASITE068495 | Click to Show/Hide the Full List | ||
| mod site | chr4:153788898-153788899:- | [5] | |
| Sequence | CGGGCCCGGGACAAGCTCGAACTCCGGCCGCCTCGCCCTTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | H1A; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654864 | ||
| mod ID: M6ASITE068496 | Click to Show/Hide the Full List | ||
| mod site | chr4:153788908-153788909:- | [5] | |
| Sequence | GCGAAGAGAGCGGGCCCGGGACAAGCTCGAACTCCGGCCGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | H1A; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274063.5 | ||
| External Link | RMBase: m6A_site_654865 | ||
References

