m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00645)

Target Name	Secreted frizzled-related protein 2 (SFRP2)
Synonyms	FRP-2; sFRP-2; Secreted apoptosis-related protein 1; SARP-1 Click to Show/Hide
Gene Name	SFRP2
Chromosomal Location	4q31.3
Family	Secreted frizzled-related protein (sFRP) family
Function	Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types. SFRP2 may be important for eye retinal development and for myogenesis. Click to Show/Hide
Gene ID	6423
Uniprot ID	SFRP2_HUMAN
HGNC ID	HGNC:10777
KEGG ID	hsa:6423

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SFRP2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1*
Cell Line	c2c12 cell line	Mus musculus
Treatment: HNRNPA2B1 knockout c2c12 cells Control: WT c2c12 cells		GSE152467
Regulation		logFC: 9.22E+00 p-value: 5.06E-12
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	HNRNPA2B1 inhibits Secreted frizzled-related protein 2 (SFRP2) and activates Wnt-Beta/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression.
Target Regulation	Down regulation
Responsed Disease	Lung adenocarcinoma		ICD-11: 2C25.0	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	A549 cells were transfected with lentivirus-packaged sh-HNRNPA2B1 (lv-sh-HNRNPA2B1) or control (lv-shCtrl). Then, each mouse was injected subcutaneously with A549 cells of indicated transfection group to generate xenografts. The tumor volume ((width2 × length)/2) was evaluated 4 days a time until 28 days.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	HNRNPA2B1 inhibits Secreted frizzled-related protein 2 (SFRP2) and activates Wnt-Beta/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression.
Responsed Disease	Lung adenocarcinoma [ICD-11: 2C25.0]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Wnt signaling pathway			hsa04310
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	A549 cells were transfected with lentivirus-packaged sh-HNRNPA2B1 (lv-sh-HNRNPA2B1) or control (lv-shCtrl). Then, each mouse was injected subcutaneously with A549 cells of indicated transfection group to generate xenografts. The tumor volume ((width2 × length)/2) was evaluated 4 days a time until 28 days.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00645)

Secreted frizzled-related protein 2 (SFRP2)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000090		Click to Show/Hide the Full List
mod site	chr4:153781426-153781427:-		[3]
Sequence	CGGCATCCTGATGGCTCCGACAGGCCTGCTCCAGAGCACGG
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: ac4C_site_1469

N6-methyladenosine (m6A)

In total 16 m6A sequence/site(s) in this target gene
mod ID: M6ASITE068481		Click to Show/Hide the Full List
mod site	chr4:153781362-153781363:-		[4]
Sequence	TCAGCTCCCGTTCCCCAAGCACACTCCTAGCTGCTCCAGTC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654850
mod ID: M6ASITE068482		Click to Show/Hide the Full List
mod site	chr4:153781549-153781550:-		[5]
Sequence	TATCTGGTCATGGGACAGAAACAGGGTGGGGAGCTGGTGAT
Motif Score	2.20572619
Cell/Tissue List	H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654851
mod ID: M6ASITE068483		Click to Show/Hide the Full List
mod site	chr4:153781555-153781556:-		[5]
Sequence	GCGCCCTATCTGGTCATGGGACAGAAACAGGGTGGGGAGCT
Motif Score	3.643047619
Cell/Tissue List	H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654852
mod ID: M6ASITE068484		Click to Show/Hide the Full List
mod site	chr4:153781616-153781617:-		[5]
Sequence	ATCGGTGCTGTGGCTCAAAGACAGCTTGCAGTGCACCTGTG
Motif Score	2.897386905
Cell/Tissue List	H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654853
mod ID: M6ASITE068485		Click to Show/Hide the Full List
mod site	chr4:153781646-153781647:-		[5]
Sequence	GAACGGTGTGTCCGAAAGGGACCTGAAGAAATCGGTGCTGT
Motif Score	3.622404762
Cell/Tissue List	H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654854
mod ID: M6ASITE068486		Click to Show/Hide the Full List
mod site	chr4:153781673-153781674:-		[4]
Sequence	GACCAAGAGCAAGACCATTTACAAGCTGAACGGTGTGTCCG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654855
mod ID: M6ASITE068487		Click to Show/Hide the Full List
mod site	chr4:153781680-153781681:-		[5]
Sequence	TCCTGGAGACCAAGAGCAAGACCATTTACAAGCTGAACGGT
Motif Score	2.876744048
Cell/Tissue List	H1B; hNPCs; hESCs; fibroblasts; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654856
mod ID: M6ASITE068488		Click to Show/Hide the Full List
mod site	chr4:153781692-153781693:-		[6]
Sequence	ATACCAAAATCATCCTGGAGACCAAGAGCAAGACCATTTAC
Motif Score	2.876744048
Cell/Tissue List	hNPCs; hESCs; fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654857
mod ID: M6ASITE068489		Click to Show/Hide the Full List
mod site	chr4:153781724-153781725:-		[4]
Sequence	AAAAGTGAAGGAGATAACCTACATCAACCGAGATACCAAAA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654858
mod ID: M6ASITE068490		Click to Show/Hide the Full List
mod site	chr4:153785895-153785896:-		[4]
Sequence	TAAAAATGATGATGACAACGACATAATGGAAACGCTTTGTA
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654859
mod ID: M6ASITE068491		Click to Show/Hide the Full List
mod site	chr4:153785901-153785902:-		[4]
Sequence	CAAAAATAAAAATGATGATGACAACGACATAATGGAAACGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654860
mod ID: M6ASITE068492		Click to Show/Hide the Full List
mod site	chr4:153788392-153788393:-		[4]
Sequence	GTGCGACCGTTTCCCCCAGGACAACGACCTTTGCATCCCCC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654861
mod ID: M6ASITE068493		Click to Show/Hide the Full List
mod site	chr4:153788665-153788666:-		[4]
Sequence	CCACGGCATCGAATACCAGAACATGCGGCTGCCCAACCTGC
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654862
mod ID: M6ASITE068494		Click to Show/Hide the Full List
mod site	chr4:153788731-153788732:-		[4]
Sequence	TGGCCAGCCCGACTTCTCCTACAAGCGCAGCAATTGCAAGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654863
mod ID: M6ASITE068495		Click to Show/Hide the Full List
mod site	chr4:153788898-153788899:-		[5]
Sequence	CGGGCCCGGGACAAGCTCGAACTCCGGCCGCCTCGCCCTTC
Motif Score	3.373380952
Cell/Tissue List	H1A; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654864
mod ID: M6ASITE068496		Click to Show/Hide the Full List
mod site	chr4:153788908-153788909:-		[5]
Sequence	GCGAAGAGAGCGGGCCCGGGACAAGCTCGAACTCCGGCCGC
Motif Score	3.643047619
Cell/Tissue List	H1A; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000274063.5
External Link	RMBase: m6A_site_654865

Ref 1	HNRNPA2B1 inhibited SFRP2 and activated Wnt-Beta/catenin via m6A-mediated miR-106b-5p processing to aggravate stemness in lung adenocarcinoma. Pathol Res Pract. 2022 May;233:153794. doi: 10.1016/j.prp.2022.153794. Epub 2022 Feb 10.
Ref 2	Human 3-alpha hydroxysteroid dehydrogenase type 3 (3Alpha-HSD3): the V54L mutation restricting the steroid alternative binding and enhancing the 20Alpha-HSD activity. J Steroid Biochem Mol Biol. 2014 May;141:135-43. doi: 10.1016/j.jsbmb.2014.01.003. Epub 2014 Jan 13.
Ref 3	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 6	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map