General Information of the m6A Target Gene (ID: M6ATAR00644)
Target Name Angiopoietin-1 receptor (TEK)
Synonyms
Endothelial tyrosine kinase; Tunica interna endothelial cell kinase; Tyrosine kinase with Ig and EGF homology domains-2; Tyrosine-protein kinase receptor TEK; Tyrosine-protein kinase receptor TIE-2; hTIE2; p140 TEK; CD202b
    Click to Show/Hide
Gene Name TEK
Chromosomal Location 9p21.2
Family Protein kinase superfamily, Tyr protein kinase family, Tie subfamily
Function
Tyrosine-protein kinase that acts as cell-surface receptor for ANGPT1, ANGPT2 and ANGPT4 and regulates angiogenesis, endothelial cell survival, proliferation, migration, adhesion and cell spreading, reorganization of the actin cytoskeleton, but also maintenance of vascular quiescence. Has anti-inflammatory effects by preventing the leakage of pro-inflammatory plasma proteins and leukocytes from blood vessels. Required for normal angiogenesis and heart development during embryogenesis. Required for post-natal hematopoiesis. After birth, activates or inhibits angiogenesis, depending on the context. Inhibits angiogenesis and promotes vascular stability in quiescent vessels, where endothelial cells have tight contacts. In quiescent vessels, ANGPT1 oligomers recruit TEK to cell-cell contacts, forming complexes with TEK molecules from adjoining cells, and this leads to preferential activation of phosphatidylinositol 3-kinase and the AKT1 signaling cascades. In migrating endothelial cells that lack cell-cell adhesions, ANGT1 recruits TEK to contacts with the extracellular matrix, leading to the formation of focal adhesion complexes, activation of PTK2/FAK and of the downstream kinases MAPK1/ERK2 and MAPK3/ERK1, and ultimately to the stimulation of sprouting angiogenesis. ANGPT1 signaling triggers receptor dimerization and autophosphorylation at specific tyrosine residues that then serve as binding sites for scaffold proteins and effectors. Signaling is modulated by ANGPT2 that has lower affinity for TEK, can promote TEK autophosphorylation in the absence of ANGPT1, but inhibits ANGPT1-mediated signaling by competing for the same binding site. Signaling is also modulated by formation of heterodimers with TIE1, and by proteolytic processing that gives rise to a soluble TEK extracellular domain. The soluble extracellular domain modulates signaling by functioning as decoy receptor for angiopoietins. TEK phosphorylates DOK2, GRB7, GRB14, PIK3R1; SHC1 and TIE1.
    Click to Show/Hide
Gene ID 7010
Uniprot ID
TIE2_HUMAN
HGNC ID
HGNC:11724
KEGG ID
hsa:7010
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TEK can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
GSE145309
Regulation
logFC: 3.39E+00
p-value: 6.45E-138
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TEK and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 3.75E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Deletion of Mettl3 leads to the suppression of Angiopoietin-1 receptor (TEK) and VEGF-A,ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer.
Target Regulation Up regulation
Responsed Disease Bladder cancer ICD-11: 2C94
Cell Process Cellular proliferation and survival
In-vitro Model UM-UC-3 Bladder carcinoma Homo sapiens CVCL_1783
T24 Bladder carcinoma Homo sapiens CVCL_0554
In-vivo Model For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene.
Bladder cancer [ICD-11: 2C94]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Deletion of Mettl3 leads to the suppression of Angiopoietin-1 receptor (TEK) and VEGF-A,ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer.
Responsed Disease Bladder cancer [ICD-11: 2C94]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Cell Process Cellular proliferation and survival
In-vitro Model UM-UC-3 Bladder carcinoma Homo sapiens CVCL_1783
T24 Bladder carcinoma Homo sapiens CVCL_0554
In-vivo Model For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00644)
Angiopoietin-1 receptor (TEK)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003107 Click to Show/Hide the Full List
mod site chr9:27131689-27131690:+ [3]
Sequence GTGTGGTGGTATATGCCTGTAGTCCCAGCTACTCAGGAGGC
Transcript ID List ENST00000615002.4; ENST00000519080.1; rmsk_2726192; ENST00000519097.5; ENST00000380036.9; ENST00000406359.8
External Link RMBase: RNA-editing_site_134682
N6-methyladenosine (m6A)
In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087800 Click to Show/Hide the Full List
mod site chr9:27109201-27109202:+ [4]
Sequence TTCTGAAAATGCTGACCGGGACCCACACTTCCAACAAAAAT
Motif Score 3.622404762
Cell/Tissue List fibroblasts; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615002.4; ENST00000519097.5
External Link RMBase: m6A_site_818196
mod ID: M6ASITE087801 Click to Show/Hide the Full List
mod site chr9:27109382-27109383:+ [4]
Sequence CATCCTAATCTACAAAGGAAACAGGAAAAAGGAACTTAAAA
Motif Score 2.20572619
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615002.4; ENST00000519097.5
External Link RMBase: m6A_site_818197
mod ID: M6ASITE087802 Click to Show/Hide the Full List
mod site chr9:27109395-27109396:+ [4]
Sequence AAAGGAAACAGGAAAAAGGAACTTAAAACTCCCTGTGCTCA
Motif Score 3.373380952
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615002.4; ENST00000519097.5
External Link RMBase: m6A_site_818198
mod ID: M6ASITE087803 Click to Show/Hide the Full List
mod site chr9:27109402-27109403:+ [4]
Sequence ACAGGAAAAAGGAACTTAAAACTCCCTGTGCTCAGACAGAA
Motif Score 2.627720238
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818199
mod ID: M6ASITE087804 Click to Show/Hide the Full List
mod site chr9:27109417-27109418:+ [4]
Sequence TTAAAACTCCCTGTGCTCAGACAGAAATGAGACTGTTACAG
Motif Score 2.897386905
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000615002.4; ENST00000406359.8
External Link RMBase: m6A_site_818200
mod ID: M6ASITE087805 Click to Show/Hide the Full List
mod site chr9:27109428-27109429:+ [4]
Sequence TGTGCTCAGACAGAAATGAGACTGTTACAGCCTGCTTCTGT
Motif Score 3.319380952
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406359.8; ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818201
mod ID: M6ASITE087806 Click to Show/Hide the Full List
mod site chr9:27109477-27109478:+ [5]
Sequence TTCTTGCCTCTAACTTGTAAACAAGACGTAGTAGGACGATG
Motif Score 2.20572619
Cell/Tissue List H1A; H1B; fibroblasts; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4; ENST00000519080.1
External Link RMBase: m6A_site_818202
mod ID: M6ASITE087807 Click to Show/Hide the Full List
mod site chr9:27109515-27109516:+ [5]
Sequence ATGCTAATGGAAAGTCACAAACCGCTGGGTTTTTGAAAGGA
Motif Score 2.185083333
Cell/Tissue List H1A; H1B; fibroblasts; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615002.4; ENST00000519080.1; ENST00000380036.9; ENST00000519097.5; ENST00000406359.8
External Link RMBase: m6A_site_818203
mod ID: M6ASITE087808 Click to Show/Hide the Full List
mod site chr9:27109544-27109545:+ [5]
Sequence TTTTTGAAAGGATCCTTGGGACCTCATGCACATTTGTGGAA
Motif Score 3.622404762
Cell/Tissue List H1B; fibroblasts; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000406359.8; ENST00000615002.4; ENST00000380036.9; ENST00000519080.1
External Link RMBase: m6A_site_818204
mod ID: M6ASITE087809 Click to Show/Hide the Full List
mod site chr9:27109565-27109566:+ [5]
Sequence CCTCATGCACATTTGTGGAAACTGGATGGAGAGATTTGGGG
Motif Score 2.627720238
Cell/Tissue List H1B; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000519080.1; ENST00000519097.5; ENST00000615002.4; ENST00000406359.8; ENST00000380036.9
External Link RMBase: m6A_site_818205
mod ID: M6ASITE087810 Click to Show/Hide the Full List
mod site chr9:27109594-27109595:+ [6]
Sequence AGAGATTTGGGGAAGCATGGACTCTTTAGCCAGCTTAGTTC
Motif Score 4.065041667
Cell/Tissue List MSC; TIME; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000380036.9; ENST00000615002.4; ENST00000406359.8; ENST00000519097.5; ENST00000519080.1
External Link RMBase: m6A_site_818206
mod ID: M6ASITE087811 Click to Show/Hide the Full List
mod site chr9:27157832-27157833:+ [6]
Sequence GTCTCTCTTTCCTTTTAGGAACTGTGGAAGGTGCCATGGAC
Motif Score 3.373380952
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000519080.1; ENST00000380036.9; ENST00000615002.4; ENST00000406359.8; ENST00000519097.5
External Link RMBase: m6A_site_818207
mod ID: M6ASITE087812 Click to Show/Hide the Full List
mod site chr9:27157851-27157852:+ [6]
Sequence AACTGTGGAAGGTGCCATGGACTTGATCTTGATCAATTCCC
Motif Score 4.065041667
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000615002.4; ENST00000519097.5; ENST00000519080.1; ENST00000406359.8; ENST00000380036.9
External Link RMBase: m6A_site_818208
mod ID: M6ASITE087813 Click to Show/Hide the Full List
mod site chr9:27157895-27157896:+ [6]
Sequence CTCTTGTATCTGATGCTGAAACATCTCTCACCTGCATTGCC
Motif Score 2.20572619
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000380036.9; ENST00000519080.1; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818209
mod ID: M6ASITE087814 Click to Show/Hide the Full List
mod site chr9:27157956-27157957:+ [4]
Sequence GCCCATCACCATAGGAAGGGACTTTGAAGCCTTAATGAACC
Motif Score 4.065041667
Cell/Tissue List fibroblasts; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380036.9; ENST00000615002.4; ENST00000519080.1; ENST00000406359.8; ENST00000519097.5
External Link RMBase: m6A_site_818210
mod ID: M6ASITE087815 Click to Show/Hide the Full List
mod site chr9:27157974-27157975:+ [4]
Sequence GGACTTTGAAGCCTTAATGAACCAGCACCAGGATCCGCTGG
Motif Score 2.930744048
Cell/Tissue List fibroblasts; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380036.9; ENST00000519080.1; ENST00000406359.8; ENST00000615002.4; ENST00000519097.5
External Link RMBase: m6A_site_818211
mod ID: M6ASITE087816 Click to Show/Hide the Full List
mod site chr9:27203025-27203026:+ [6]
Sequence TCAAGGGCCTAGAGCCTGAAACAGCATACCAGGTGGACATT
Motif Score 2.20572619
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000380036.9; ENST00000615002.4; ENST00000406359.8
External Link RMBase: m6A_site_818212
mod ID: M6ASITE087817 Click to Show/Hide the Full List
mod site chr9:27203041-27203042:+ [6]
Sequence TGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACA
Motif Score 3.643047619
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4
External Link RMBase: m6A_site_818213
mod ID: M6ASITE087818 Click to Show/Hide the Full List
mod site chr9:27203056-27203057:+ [6]
Sequence GGTGGACATTTTTGCAGAGAACAACATAGGGTCAAGCAACC
Motif Score 2.951386905
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4
External Link RMBase: m6A_site_818214
mod ID: M6ASITE087819 Click to Show/Hide the Full List
mod site chr9:27203093-27203094:+ [6]
Sequence AACCCAGCCTTTTCTCATGAACTGGTGACCCTCCCAGAATC
Motif Score 3.373380952
Cell/Tissue List TIME; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000519097.5; ENST00000615002.4; ENST00000406359.8; ENST00000380036.9
External Link RMBase: m6A_site_818215
mod ID: M6ASITE087820 Click to Show/Hide the Full List
mod site chr9:27204919-27204920:+ [6]
Sequence TTCCTGCACAGCACCAGCGGACCTCGGAGGGGGGAAGATGC
Motif Score 3.622404762
Cell/Tissue List TIME; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4
External Link RMBase: m6A_site_818216
mod ID: M6ASITE087821 Click to Show/Hide the Full List
mod site chr9:27229301-27229302:+ [4]
Sequence CCTTGACACCTGCTGAGAAAACATGCCTCTGCCAAAGGATG
Motif Score 2.20572619
Cell/Tissue List fibroblasts; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380036.9; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818217
mod ID: M6ASITE087822 Click to Show/Hide the Full List
mod site chr9:27229358-27229359:+ [4]
Sequence ATATGTGCTGTACACCTGGGACCTTCACCACTGTAGATCCC
Motif Score 3.622404762
Cell/Tissue List fibroblasts; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406359.8; ENST00000519097.5; ENST00000615002.4; ENST00000380036.9
External Link RMBase: m6A_site_818218
mod ID: M6ASITE087823 Click to Show/Hide the Full List
mod site chr9:27229417-27229418:+ [4]
Sequence TATGCTCTGACTCTAATAGGACTGTATATACTGTTTTAAGA
Motif Score 4.065041667
Cell/Tissue List fibroblasts; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406359.8; ENST00000380036.9; ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818219
mod ID: M6ASITE087824 Click to Show/Hide the Full List
mod site chr9:27229504-27229505:+ [6]
Sequence ATATTTTTTTAAAAATGTGGACTTCATAGGAAGGCGTGAGT
Motif Score 4.065041667
Cell/Tissue List TIME
Seq Type List MeRIP-seq
Transcript ID List ENST00000380036.9; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4
External Link RMBase: m6A_site_818220