m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00644)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TEK
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: 3.39E+00 p-value: 6.45E-138 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between TEK and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 3.75E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Deletion of Mettl3 leads to the suppression of Angiopoietin-1 receptor (TEK) and VEGF-A,ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Cell Process | Cellular proliferation and survival | |||
| In-vitro Model | UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene. | |||
Bladder cancer [ICD-11: 2C94]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Deletion of Mettl3 leads to the suppression of Angiopoietin-1 receptor (TEK) and VEGF-A,ablation of Mettl3 in bladder urothelial attenuates the oncogenesis and tumor angiogenesis of bladder cancer. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cellular proliferation and survival | |||
| In-vitro Model | UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| In-vivo Model | For induction of BCa, 6-8-week-old mice were treated with drinking water containing 500 ug/ml BBN for 16 weeks and then given normal water for another 10 weeks. Tamoxifen was intraperitonelly injected to the mice with 0.08 mg/g of body weight each day for 3 days in order to inductively knock out the target gene. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00644)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE003107 | Click to Show/Hide the Full List | ||
| mod site | chr9:27131689-27131690:+ | [3] | |
| Sequence | GTGTGGTGGTATATGCCTGTAGTCCCAGCTACTCAGGAGGC | ||
| Transcript ID List | ENST00000615002.4; ENST00000519080.1; rmsk_2726192; ENST00000519097.5; ENST00000380036.9; ENST00000406359.8 | ||
| External Link | RMBase: RNA-editing_site_134682 | ||
N6-methyladenosine (m6A)
| In total 25 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE087800 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109201-27109202:+ | [4] | |
| Sequence | TTCTGAAAATGCTGACCGGGACCCACACTTCCAACAAAAAT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | fibroblasts; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615002.4; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818196 | ||
| mod ID: M6ASITE087801 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109382-27109383:+ | [4] | |
| Sequence | CATCCTAATCTACAAAGGAAACAGGAAAAAGGAACTTAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615002.4; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818197 | ||
| mod ID: M6ASITE087802 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109395-27109396:+ | [4] | |
| Sequence | AAAGGAAACAGGAAAAAGGAACTTAAAACTCCCTGTGCTCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615002.4; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818198 | ||
| mod ID: M6ASITE087803 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109402-27109403:+ | [4] | |
| Sequence | ACAGGAAAAAGGAACTTAAAACTCCCTGTGCTCAGACAGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818199 | ||
| mod ID: M6ASITE087804 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109417-27109418:+ | [4] | |
| Sequence | TTAAAACTCCCTGTGCTCAGACAGAAATGAGACTGTTACAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000615002.4; ENST00000406359.8 | ||
| External Link | RMBase: m6A_site_818200 | ||
| mod ID: M6ASITE087805 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109428-27109429:+ | [4] | |
| Sequence | TGTGCTCAGACAGAAATGAGACTGTTACAGCCTGCTTCTGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000406359.8; ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818201 | ||
| mod ID: M6ASITE087806 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109477-27109478:+ | [5] | |
| Sequence | TTCTTGCCTCTAACTTGTAAACAAGACGTAGTAGGACGATG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | H1A; H1B; fibroblasts; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4; ENST00000519080.1 | ||
| External Link | RMBase: m6A_site_818202 | ||
| mod ID: M6ASITE087807 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109515-27109516:+ | [5] | |
| Sequence | ATGCTAATGGAAAGTCACAAACCGCTGGGTTTTTGAAAGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | H1A; H1B; fibroblasts; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615002.4; ENST00000519080.1; ENST00000380036.9; ENST00000519097.5; ENST00000406359.8 | ||
| External Link | RMBase: m6A_site_818203 | ||
| mod ID: M6ASITE087808 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109544-27109545:+ | [5] | |
| Sequence | TTTTTGAAAGGATCCTTGGGACCTCATGCACATTTGTGGAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | H1B; fibroblasts; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000406359.8; ENST00000615002.4; ENST00000380036.9; ENST00000519080.1 | ||
| External Link | RMBase: m6A_site_818204 | ||
| mod ID: M6ASITE087809 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109565-27109566:+ | [5] | |
| Sequence | CCTCATGCACATTTGTGGAAACTGGATGGAGAGATTTGGGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | H1B; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000519080.1; ENST00000519097.5; ENST00000615002.4; ENST00000406359.8; ENST00000380036.9 | ||
| External Link | RMBase: m6A_site_818205 | ||
| mod ID: M6ASITE087810 | Click to Show/Hide the Full List | ||
| mod site | chr9:27109594-27109595:+ | [6] | |
| Sequence | AGAGATTTGGGGAAGCATGGACTCTTTAGCCAGCTTAGTTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | MSC; TIME; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000615002.4; ENST00000406359.8; ENST00000519097.5; ENST00000519080.1 | ||
| External Link | RMBase: m6A_site_818206 | ||
| mod ID: M6ASITE087811 | Click to Show/Hide the Full List | ||
| mod site | chr9:27157832-27157833:+ | [6] | |
| Sequence | GTCTCTCTTTCCTTTTAGGAACTGTGGAAGGTGCCATGGAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000519080.1; ENST00000380036.9; ENST00000615002.4; ENST00000406359.8; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818207 | ||
| mod ID: M6ASITE087812 | Click to Show/Hide the Full List | ||
| mod site | chr9:27157851-27157852:+ | [6] | |
| Sequence | AACTGTGGAAGGTGCCATGGACTTGATCTTGATCAATTCCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000615002.4; ENST00000519097.5; ENST00000519080.1; ENST00000406359.8; ENST00000380036.9 | ||
| External Link | RMBase: m6A_site_818208 | ||
| mod ID: M6ASITE087813 | Click to Show/Hide the Full List | ||
| mod site | chr9:27157895-27157896:+ | [6] | |
| Sequence | CTCTTGTATCTGATGCTGAAACATCTCTCACCTGCATTGCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000519080.1; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818209 | ||
| mod ID: M6ASITE087814 | Click to Show/Hide the Full List | ||
| mod site | chr9:27157956-27157957:+ | [4] | |
| Sequence | GCCCATCACCATAGGAAGGGACTTTGAAGCCTTAATGAACC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | fibroblasts; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000615002.4; ENST00000519080.1; ENST00000406359.8; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818210 | ||
| mod ID: M6ASITE087815 | Click to Show/Hide the Full List | ||
| mod site | chr9:27157974-27157975:+ | [4] | |
| Sequence | GGACTTTGAAGCCTTAATGAACCAGCACCAGGATCCGCTGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | fibroblasts; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000519080.1; ENST00000406359.8; ENST00000615002.4; ENST00000519097.5 | ||
| External Link | RMBase: m6A_site_818211 | ||
| mod ID: M6ASITE087816 | Click to Show/Hide the Full List | ||
| mod site | chr9:27203025-27203026:+ | [6] | |
| Sequence | TCAAGGGCCTAGAGCCTGAAACAGCATACCAGGTGGACATT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000380036.9; ENST00000615002.4; ENST00000406359.8 | ||
| External Link | RMBase: m6A_site_818212 | ||
| mod ID: M6ASITE087817 | Click to Show/Hide the Full List | ||
| mod site | chr9:27203041-27203042:+ | [6] | |
| Sequence | TGAAACAGCATACCAGGTGGACATTTTTGCAGAGAACAACA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818213 | ||
| mod ID: M6ASITE087818 | Click to Show/Hide the Full List | ||
| mod site | chr9:27203056-27203057:+ | [6] | |
| Sequence | GGTGGACATTTTTGCAGAGAACAACATAGGGTCAAGCAACC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818214 | ||
| mod ID: M6ASITE087819 | Click to Show/Hide the Full List | ||
| mod site | chr9:27203093-27203094:+ | [6] | |
| Sequence | AACCCAGCCTTTTCTCATGAACTGGTGACCCTCCCAGAATC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | TIME; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000615002.4; ENST00000406359.8; ENST00000380036.9 | ||
| External Link | RMBase: m6A_site_818215 | ||
| mod ID: M6ASITE087820 | Click to Show/Hide the Full List | ||
| mod site | chr9:27204919-27204920:+ | [6] | |
| Sequence | TTCCTGCACAGCACCAGCGGACCTCGGAGGGGGGAAGATGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | TIME; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000519097.5; ENST00000406359.8; ENST00000380036.9; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818216 | ||
| mod ID: M6ASITE087821 | Click to Show/Hide the Full List | ||
| mod site | chr9:27229301-27229302:+ | [4] | |
| Sequence | CCTTGACACCTGCTGAGAAAACATGCCTCTGCCAAAGGATG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | fibroblasts; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818217 | ||
| mod ID: M6ASITE087822 | Click to Show/Hide the Full List | ||
| mod site | chr9:27229358-27229359:+ | [4] | |
| Sequence | ATATGTGCTGTACACCTGGGACCTTCACCACTGTAGATCCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | fibroblasts; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000406359.8; ENST00000519097.5; ENST00000615002.4; ENST00000380036.9 | ||
| External Link | RMBase: m6A_site_818218 | ||
| mod ID: M6ASITE087823 | Click to Show/Hide the Full List | ||
| mod site | chr9:27229417-27229418:+ | [4] | |
| Sequence | TATGCTCTGACTCTAATAGGACTGTATATACTGTTTTAAGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | fibroblasts; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000406359.8; ENST00000380036.9; ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818219 | ||
| mod ID: M6ASITE087824 | Click to Show/Hide the Full List | ||
| mod site | chr9:27229504-27229505:+ | [6] | |
| Sequence | ATATTTTTTTAAAAATGTGGACTTCATAGGAAGGCGTGAGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000380036.9; ENST00000406359.8; ENST00000519097.5; ENST00000615002.4 | ||
| External Link | RMBase: m6A_site_818220 | ||
References

