m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00642)
Target Name Frizzled-10 (FZD10)
Synonyms
Fz-10; hFz10; FzE7; CD350
    Click to Show/Hide
Gene Name FZD10
Chromosomal Location 12q24.33
Family G-protein coupled receptor Fz/Smo family
Function
Receptor for Wnt proteins. Functions in the canonical Wnt/beta-catenin signaling pathway (By similarity). The canonical Wnt/beta-catenin signaling pathway leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues (Probable).
    Click to Show/Hide
Gene ID 11211
Uniprot ID
FZD10_HUMAN
HGNC ID
HGNC:4039
KEGG ID
hsa:11211
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
FZD10 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line Mouse hippocampus Mus musculus
Treatment: FTO knockout mice hippocampus
Control: Wild type hippocampus
 GSE94098
Regulation
logFC: -6.03E-01
p-value: 7.74E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Target Regulation Down regulation
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary ICD-11: 2B5D.0
 Disease Info 
Responsed Drug PARPi Investigative
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Target Regulation Down regulation
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary ICD-11: 2B5D.0
 Disease Info 
Responsed Drug PARPi Investigative
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug PARPi Investigative
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug PARPi Investigative
 Drug Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
PARPi [Investigative]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary ICD-11: 2B5D.0
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary Downregulation of m6A demethylases FTO and ALKBH5 was sufficient to increase Frizzled-10 (FZD10) mRNA m6A modification and reduce PARPi sensitivity, the finding elucidates a novel regulatory mechanism of PARPi resistance in EOC by showing that m6A modification of FZD10 mRNA contributes to PARPi resistance in BRCA-deficient EOC cells via upregulation of Wnt/Bete-catenin pathway.
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Malignant mixed epithelial mesenchymal tumour of ovary ICD-11: 2B5D.0
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
In-vitro Model UWB1.289 Ovarian carcinoma Homo sapiens CVCL_B079
PEO1 Ovarian cystadenocarcinoma Homo sapiens CVCL_2686
In-vivo Model 2 × 107 PARP inhibitor resistant PEO1 cells were suspended in 200 uL PBS : Matrigel (1:1) unilaterally injected subcutaneously into the right dorsal flank of 6-8 week-old female immunocompromised non-obese diabetic/severe combined immunodeficiency (NOD/SCID) gamma (NSG) mice. When the average tumor size reached ~100 mm3, the mice were then randomized into four groups and treated with vehicle control, Olaparib (50 mg/kg), XAV939 (5 mg/kg) or a combination daily for 18 days.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00642)
Frizzled-10 (FZD10)
N6-methyladenosine (m6A)
In total 40 m6A sequence/site(s) in this target gene
mod ID: M6ASITE016029 Click to Show/Hide the Full List
mod site chr12:130162729-130162730:+ [2]
Sequence CTTCCCGGTATTGTTTGCAAACTTTGCTGCTCTCCGCCGCG
Motif Score 2.627720238
Cell/Tissue List HepG2; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217838
mod ID: M6ASITE016030 Click to Show/Hide the Full List
mod site chr12:130162925-130162926:+ [3]
Sequence GCGCGGAGCTCCCCGCGAGGACACGTCCAACGCCAGCATGC
Motif Score 3.643047619
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217839
mod ID: M6ASITE016032 Click to Show/Hide the Full List
mod site chr12:130163015-130163016:+ [4]
Sequence CGCCGCCATCAGCTCCATGGACATGGAGCGCCCGGGCGACG
Motif Score 3.643047619
Cell/Tissue List HEK293T; HeLa; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217840
mod ID: M6ASITE016033 Click to Show/Hide the Full List
mod site chr12:130163072-130163073:+ [4]
Sequence CGAGATCCCGATGTGCAAGGACATCGGCTACAACATGACTC
Motif Score 3.643047619
Cell/Tissue List HEK293T; HeLa; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217841
mod ID: M6ASITE016034 Click to Show/Hide the Full List
mod site chr12:130163120-130163121:+ [3]
Sequence CAACCTGATGGGCCACGAGAACCAGCGCGAGGCAGCCATCC
Motif Score 2.930744048
Cell/Tissue List HEK293T; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217842
mod ID: M6ASITE016035 Click to Show/Hide the Full List
mod site chr12:130163339-130163340:+
Sequence CAAGTGGCCCGACTCCCTGGACTGCCGGAAACTCCCCAACA
Motif Score 4.065041667
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217843
mod ID: M6ASITE016036 Click to Show/Hide the Full List
mod site chr12:130163349-130163350:+
Sequence GACTCCCTGGACTGCCGGAAACTCCCCAACAAGAACGACCC
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217844
mod ID: M6ASITE016037 Click to Show/Hide the Full List
mod site chr12:130163357-130163358:+ [5]
Sequence GGACTGCCGGAAACTCCCCAACAAGAACGACCCCAACTACC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217845
mod ID: M6ASITE016038 Click to Show/Hide the Full List
mod site chr12:130163609-130163610:+ [3]
Sequence CGTGTACTGGAGCCGCGAGGACAAGCGCTTCGCAGTGGTCT
Motif Score 3.643047619
Cell/Tissue List HEK293T; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217846
mod ID: M6ASITE016039 Click to Show/Hide the Full List
mod site chr12:130163819-130163820:+ [2]
Sequence GAGCATCGCCTGCGACCGGGACAGCGGCCAGCTCTATGTCA
Motif Score 3.643047619
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217847
mod ID: M6ASITE016040 Click to Show/Hide the Full List
mod site chr12:130163850-130163851:+ [2]
Sequence CTCTATGTCATCCAGGAGGGACTGGAGAGCACCGGCTGCAC
Motif Score 4.065041667
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217848
mod ID: M6ASITE016041 Click to Show/Hide the Full List
mod site chr12:130164037-130164038:+ [3]
Sequence GGGCCATCCCGGCGGTGAAGACCATCCTGATCCTGGTCATG
Motif Score 2.876744048
Cell/Tissue List HEK293T; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217849
mod ID: M6ASITE016043 Click to Show/Hide the Full List
mod site chr12:130164239-130164240:+ [3]
Sequence GATGAAGACGGGCGGCGAGAACACGGACAAGCTGGAGAAGC
Motif Score 2.951386905
Cell/Tissue List HEK293T; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217850
mod ID: M6ASITE016044 Click to Show/Hide the Full List
mod site chr12:130164245-130164246:+ [3]
Sequence GACGGGCGGCGAGAACACGGACAAGCTGGAGAAGCTCATGG
Motif Score 3.643047619
Cell/Tissue List HEK293T; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217851
mod ID: M6ASITE016045 Click to Show/Hide the Full List
mod site chr12:130164392-130164393:+ [4]
Sequence GCAGCACAAGTGCAAAATGAACAACCAGACTAAAACGCTGG
Motif Score 2.951386905
Cell/Tissue List HEK293T; HeLa; hESC-HEK293T; HepG2
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217852
mod ID: M6ASITE016046 Click to Show/Hide the Full List
mod site chr12:130164400-130164401:+ [4]
Sequence AGTGCAAAATGAACAACCAGACTAAAACGCTGGACTGCCTG
Motif Score 3.319380952
Cell/Tissue List HEK293T; HeLa; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217853
mod ID: M6ASITE016047 Click to Show/Hide the Full List
mod site chr12:130164413-130164414:+ [4]
Sequence CAACCAGACTAAAACGCTGGACTGCCTGATGGCCGCCTCCA
Motif Score 4.065041667
Cell/Tissue List HEK293T; HeLa; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217854
mod ID: M6ASITE016048 Click to Show/Hide the Full List
mod site chr12:130164511-130164512:+ [4]
Sequence CCAGCGGGATGTGGATTTGGACCTCCAAGACTCTGCAGTCC
Motif Score 3.622404762
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217855
mod ID: M6ASITE016049 Click to Show/Hide the Full List
mod site chr12:130164520-130164521:+ [4]
Sequence TGTGGATTTGGACCTCCAAGACTCTGCAGTCCTGGCAGCAG
Motif Score 3.319380952
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; hNPCs; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217856
mod ID: M6ASITE016050 Click to Show/Hide the Full List
mod site chr12:130164579-130164580:+ [4]
Sequence AAGAAGAAGAGCCGGAGAAAACCGGCCAGCGTGATCACCAG
Motif Score 2.185083333
Cell/Tissue List HEK293T; HeLa; HepG2; hNPCs; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217857
mod ID: M6ASITE016051 Click to Show/Hide the Full List
mod site chr12:130164637-130164638:+ [4]
Sequence AAGCCCAGCATCCCCAGAAAACTCACCACGGGAAATATGAG
Motif Score 2.627720238
Cell/Tissue List HEK293T; HeLa; HepG2; hNPCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217858
mod ID: M6ASITE016052 Click to Show/Hide the Full List
mod site chr12:130164688-130164689:+ [4]
Sequence AGTCGCCCACCTGCGTGTGAACAGGGCTGGAGGGAAGGGCA
Motif Score 2.951386905
Cell/Tissue List HEK293T; HeLa; HepG2; hNPCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217859
mod ID: M6ASITE016054 Click to Show/Hide the Full List
mod site chr12:130164977-130164978:+ [3]
Sequence GATTCAGCCCTCAGAAGAAAACTTTTGTTTAGAGCCCTCCC
Motif Score 2.627720238
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217860
mod ID: M6ASITE016055 Click to Show/Hide the Full List
mod site chr12:130165053-130165054:+ [3]
Sequence ACCCATTTACAAATAAGAGGACAGATAACTGCTTTGCAAAT
Motif Score 3.643047619
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217861
mod ID: M6ASITE016056 Click to Show/Hide the Full List
mod site chr12:130165166-130165167:+ [4]
Sequence GGCATCCCTGCAGAGGAAAGACAGGACCCGGGGCCCGCCTC
Motif Score 2.897386905
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217862
mod ID: M6ASITE016057 Click to Show/Hide the Full List
mod site chr12:130165171-130165172:+ [4]
Sequence CCCTGCAGAGGAAAGACAGGACCCGGGGCCCGCCTCACACC
Motif Score 3.622404762
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217863
mod ID: M6ASITE016058 Click to Show/Hide the Full List
mod site chr12:130165220-130165221:+ [4]
Sequence TTTGGAGTTGCTTAAAATAGACTCCGGCCTTCACCAATAGT
Motif Score 3.319380952
Cell/Tissue List HEK293T; HeLa; HepG2; H1A; H1B; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217864
mod ID: M6ASITE016059 Click to Show/Hide the Full List
mod site chr12:130165252-130165253:+ [4]
Sequence ACCAATAGTCTCTCTGCAAGACAGAAACCTCCATCAAACCT
Motif Score 2.897386905
Cell/Tissue List HEK293T; HeLa; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217865
mod ID: M6ASITE016060 Click to Show/Hide the Full List
mod site chr12:130165258-130165259:+ [4]
Sequence AGTCTCTCTGCAAGACAGAAACCTCCATCAAACCTCACATT
Motif Score 2.185083333
Cell/Tissue List HEK293T; HeLa; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217866
mod ID: M6ASITE016061 Click to Show/Hide the Full List
mod site chr12:130165269-130165270:+ [4]
Sequence AAGACAGAAACCTCCATCAAACCTCACATTTGTGAACTCAA
Motif Score 2.185083333
Cell/Tissue List HEK293T; HeLa; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217867
mod ID: M6ASITE016062 Click to Show/Hide the Full List
mod site chr12:130165284-130165285:+ [4]
Sequence ATCAAACCTCACATTTGTGAACTCAAACGATGTGCAATACA
Motif Score 3.373380952
Cell/Tissue List HEK293T; HeLa; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217868
mod ID: M6ASITE016063 Click to Show/Hide the Full List
mod site chr12:130165338-130165339:+ [3]
Sequence CCTTGAAAATAAAAAGAGAAACAAGTATTTTGCTATATATA
Motif Score 2.20572619
Cell/Tissue List HEK293T; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217869
mod ID: M6ASITE016065 Click to Show/Hide the Full List
mod site chr12:130165362-130165363:+ [5]
Sequence GTATTTTGCTATATATAAAGACAACAAAAGAAATCTCCTAA
Motif Score 2.897386905
Cell/Tissue List HEK293T; hESC-HEK293T; BGC823; HepG2
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217870
mod ID: M6ASITE016066 Click to Show/Hide the Full List
mod site chr12:130165390-130165391:+ [4]
Sequence AGAAATCTCCTAACAAAAGAACTAAGAGGCCCAGCCCTCAG
Motif Score 3.373380952
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217871
mod ID: M6ASITE016067 Click to Show/Hide the Full List
mod site chr12:130165413-130165414:+ [4]
Sequence AAGAGGCCCAGCCCTCAGAAACCCTTCAGTGCTACATTTTG
Motif Score 2.185083333
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217872
mod ID: M6ASITE016068 Click to Show/Hide the Full List
mod site chr12:130165450-130165451:+ [4]
Sequence TTTGTGGCTTTTTAATGGAAACCAAGCCAATGTTATAGACG
Motif Score 2.185083333
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217873
mod ID: M6ASITE016069 Click to Show/Hide the Full List
mod site chr12:130165476-130165477:+ [4]
Sequence CCAATGTTATAGACGTTTGGACTGATTTGTGGAAAGGAGGG
Motif Score 4.065041667
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000229030.4; ENST00000539839.1
External Link RMBase: m6A_site_217874
mod ID: M6ASITE016070 Click to Show/Hide the Full List
mod site chr12:130165561-130165562:+ [4]
Sequence TTGACTCTTTCTATTGTTAAACAAATGATTTCCACAAACAG
Motif Score 2.20572619
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217875
mod ID: M6ASITE016071 Click to Show/Hide the Full List
mod site chr12:130165578-130165579:+ [4]
Sequence TAAACAAATGATTTCCACAAACAGATCAGGAAGCACTAGGT
Motif Score 2.20572619
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217876
mod ID: M6ASITE016072 Click to Show/Hide the Full List
mod site chr12:130165607-130165608:+ [4]
Sequence GAAGCACTAGGTTGGCAGAGACACTTTGTCTAGTGTATTCT
Motif Score 2.897386905
Cell/Tissue List HEK293T; HeLa; BGC823; HepG2
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539839.1; ENST00000229030.4
External Link RMBase: m6A_site_217877