m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00624)

Target Name	Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP)
Synonyms	hLHPP Click to Show/Hide
Gene Name	LHPP
Chromosomal Location	10q26.13
Family	HAD-like hydrolase superfamily
Function	Phosphatase that hydrolyzes imidodiphosphate, 3-phosphohistidine and 6-phospholysine. Has broad substrate specificity and can also hydrolyze inorganic diphosphate, but with lower efficiency (By similarity). Click to Show/Hide
Gene ID	64077
Uniprot ID	LHPP_HUMAN
HGNC ID	HGNC:30042
KEGG ID	hsa:64077

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

LHPP can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -1.51E+00 p-value: 1.12E-09
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between LHPP and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 8.41E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP) and NKX3-1 at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation	Down regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	B18-hi B cell line	Mus musculus
Treatment: YTHDF2 knockout B18-hi B cells Control: Wild type B18-hi B cells		GSE189819
Regulation		logFC: 1.54E+00 p-value: 1.87E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP) and NKX3-1 at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation	Down regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP) and NKX3-1 at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knock-down of YTHDF2 or METTL3 significantly induced the expression of Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP) and NKX3-1 at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Oxidative phosphorylation			hsa00190
In-vitro Model	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	RWPE-1	Normal	Homo sapiens	CVCL_3791
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	22Rv1	Prostate carcinoma	Homo sapiens	CVCL_1045
In-vivo Model	Approximately 2 × 10⁶ PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 10⁶ PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03329		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5A (KDM5A)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Prostate cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00624)

Phospholysine phosphohistidine inorganic pyrophosphate phosphatase (LHPP)

Adenosine-to-Inosine editing (A-to-I)

In total 35 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004433		Click to Show/Hide the Full List
mod site	chr10:124474170-124474171:+		[2]
Sequence	TTTTTTTGAGACAGGGTCTCACTTTGTCACCTAGGCTGGAG
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19158
mod ID: A2ISITE004434		Click to Show/Hide the Full List
mod site	chr10:124474178-124474179:+		[2]
Sequence	AGACAGGGTCTCACTTTGTCACCTAGGCTGGAGTGCAGTGG
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19159
mod ID: A2ISITE004435		Click to Show/Hide the Full List
mod site	chr10:124474194-124474195:+		[2]
Sequence	TGTCACCTAGGCTGGAGTGCAGTGGCACAATCTTGGCTCAC
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19160
mod ID: A2ISITE004436		Click to Show/Hide the Full List
mod site	chr10:124474200-124474201:+		[2]
Sequence	CTAGGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAGC
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19161
mod ID: A2ISITE004437		Click to Show/Hide the Full List
mod site	chr10:124474203-124474204:+		[2]
Sequence	GGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAGCCTC
Transcript ID List	ENST00000368839.1; ENST00000392757.8; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19162
mod ID: A2ISITE004438		Click to Show/Hide the Full List
mod site	chr10:124474213-124474214:+		[2]
Sequence	CAGTGGCACAATCTTGGCTCACTGCAGCCTCGACCTCCTGG
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19163
mod ID: A2ISITE004439		Click to Show/Hide the Full List
mod site	chr10:124474218-124474219:+		[2]
Sequence	GCACAATCTTGGCTCACTGCAGCCTCGACCTCCTGGGCTCA
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19164
mod ID: A2ISITE004440		Click to Show/Hide the Full List
mod site	chr10:124474225-124474226:+		[2]
Sequence	CTTGGCTCACTGCAGCCTCGACCTCCTGGGCTCAAGCGATC
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19165
mod ID: A2ISITE004441		Click to Show/Hide the Full List
mod site	chr10:124474238-124474239:+		[2]
Sequence	AGCCTCGACCTCCTGGGCTCAAGCGATCCTTTCACCTCAGC
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19166
mod ID: A2ISITE004442		Click to Show/Hide the Full List
mod site	chr10:124474239-124474240:+		[2]
Sequence	GCCTCGACCTCCTGGGCTCAAGCGATCCTTTCACCTCAGCC
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19167
mod ID: A2ISITE004443		Click to Show/Hide the Full List
mod site	chr10:124474251-124474252:+		[2]
Sequence	TGGGCTCAAGCGATCCTTTCACCTCAGCCCCCAAAGTAGCT
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19168
mod ID: A2ISITE004444		Click to Show/Hide the Full List
mod site	chr10:124474256-124474257:+		[2]
Sequence	TCAAGCGATCCTTTCACCTCAGCCCCCAAAGTAGCTGAGAC
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19169
mod ID: A2ISITE004445		Click to Show/Hide the Full List
mod site	chr10:124474264-124474265:+		[2]
Sequence	TCCTTTCACCTCAGCCCCCAAAGTAGCTGAGACTACAAGTG
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19170
mod ID: A2ISITE004446		Click to Show/Hide the Full List
mod site	chr10:124474268-124474269:+		[2]
Sequence	TTCACCTCAGCCCCCAAAGTAGCTGAGACTACAAGTGCACA
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19171
mod ID: A2ISITE004447		Click to Show/Hide the Full List
mod site	chr10:124474273-124474274:+		[2]
Sequence	CTCAGCCCCCAAAGTAGCTGAGACTACAAGTGCACACCACT
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19172
mod ID: A2ISITE004448		Click to Show/Hide the Full List
mod site	chr10:124474278-124474279:+		[2]
Sequence	CCCCCAAAGTAGCTGAGACTACAAGTGCACACCACTGCACC
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19173
mod ID: A2ISITE004449		Click to Show/Hide the Full List
mod site	chr10:124474281-124474282:+		[2]
Sequence	CCAAAGTAGCTGAGACTACAAGTGCACACCACTGCACCTGG
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19174
mod ID: A2ISITE004450		Click to Show/Hide the Full List
mod site	chr10:124474319-124474320:+		[2]
Sequence	TGGCCAATTTTTGTATTTTTAGTACAGACAAGGTTTTGCCA
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19175
mod ID: A2ISITE004451		Click to Show/Hide the Full List
mod site	chr10:124474324-124474325:+		[2]
Sequence	AATTTTTGTATTTTTAGTACAGACAAGGTTTTGCCACGTTG
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19176
mod ID: A2ISITE004452		Click to Show/Hide the Full List
mod site	chr10:124474326-124474327:+		[2]
Sequence	TTTTTGTATTTTTAGTACAGACAAGGTTTTGCCACGTTGCC
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19177
mod ID: A2ISITE004453		Click to Show/Hide the Full List
mod site	chr10:124474328-124474329:+		[2]
Sequence	TTTGTATTTTTAGTACAGACAAGGTTTTGCCACGTTGCCCA
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19178
mod ID: A2ISITE004454		Click to Show/Hide the Full List
mod site	chr10:124474329-124474330:+		[2]
Sequence	TTGTATTTTTAGTACAGACAAGGTTTTGCCACGTTGCCCAG
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19179
mod ID: A2ISITE004455		Click to Show/Hide the Full List
mod site	chr10:124474339-124474340:+		[2]
Sequence	AGTACAGACAAGGTTTTGCCACGTTGCCCAGGCTGGTCTTG
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19180
mod ID: A2ISITE004456		Click to Show/Hide the Full List
mod site	chr10:124474348-124474349:+		[2]
Sequence	AAGGTTTTGCCACGTTGCCCAGGCTGGTCTTGAACTCCAGA
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000392757.8
External Link	RMBase: RNA-editing_site_19181
mod ID: A2ISITE004457		Click to Show/Hide the Full List
mod site	chr10:124474373-124474374:+		[2]
Sequence	GGTCTTGAACTCCAGAGCTCAACGGATCTGCCCACCTCAGT
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19182
mod ID: A2ISITE004458		Click to Show/Hide the Full List
mod site	chr10:124474391-124474392:+		[2]
Sequence	TCAACGGATCTGCCCACCTCAGTCTCCCAAAGTGTTGGGAT
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19183
mod ID: A2ISITE004459		Click to Show/Hide the Full List
mod site	chr10:124474413-124474414:+		[2]
Sequence	TCTCCCAAAGTGTTGGGATTACAAGTATGAACCACCGTGCC
Transcript ID List	ENST00000368839.1; ENST00000392757.8; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19184
mod ID: A2ISITE004460		Click to Show/Hide the Full List
mod site	chr10:124474416-124474417:+		[2]
Sequence	CCCAAAGTGTTGGGATTACAAGTATGAACCACCGTGCCCGG
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19185
mod ID: A2ISITE004461		Click to Show/Hide the Full List
mod site	chr10:124474439-124474440:+		[2]
Sequence	ATGAACCACCGTGCCCGGCCATATGAAGTCTTGTAGTTGTT
Transcript ID List	ENST00000368839.1; ENST00000392757.8; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19186
mod ID: A2ISITE004462		Click to Show/Hide the Full List
mod site	chr10:124474444-124474445:+		[2]
Sequence	CCACCGTGCCCGGCCATATGAAGTCTTGTAGTTGTTGAACT
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19187
mod ID: A2ISITE004463		Click to Show/Hide the Full List
mod site	chr10:124501454-124501455:+		[3]
Sequence	CCACTAAAAATACAAACATTAGCCAGACGTGGTGGTGTGCA
Transcript ID List	ENST00000368842.10; rmsk_3443287; ENST00000481452.1; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19188
mod ID: A2ISITE004464		Click to Show/Hide the Full List
mod site	chr10:124554094-124554095:+		[3]
Sequence	AGCCTGGGCTGCCTGGATTCAGCTCCTGCTCTGACATTTAC
Transcript ID List	ENST00000493240.1; ENST00000368839.1; ENST00000482963.1; rmsk_3443376; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19189
mod ID: A2ISITE004465		Click to Show/Hide the Full List
mod site	chr10:124554113-124554114:+		[3]
Sequence	CAGCTCCTGCTCTGACATTTACAGCTGGGACGACCTGGGCC
Transcript ID List	ENST00000368842.10; rmsk_3443376; ENST00000368839.1; ENST00000482963.1; ENST00000493240.1
External Link	RMBase: RNA-editing_site_19190
mod ID: A2ISITE004466		Click to Show/Hide the Full List
mod site	chr10:124554550-124554551:+		[3]
Sequence	ATAATGTGCATGCAGTGCTTAGCCTAGTGCCCGGTGCAGAG
Transcript ID List	ENST00000493240.1; ENST00000368842.10; ENST00000482963.1; ENST00000368839.1
External Link	RMBase: RNA-editing_site_19191
mod ID: A2ISITE004467		Click to Show/Hide the Full List
mod site	chr10:124600534-124600535:+		[3]
Sequence	GCAGTTGGTCTCCAGAAGGAAATTCTCTGTATCTGGGTGCT
Transcript ID List	ENST00000493240.1; ENST00000482963.1; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: RNA-editing_site_19192

5-methylcytidine (m5C)

In total 8 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004797		Click to Show/Hide the Full List
mod site	chr10:124461956-124461957:+		[4]
Sequence	CGGCGCGGGCGGCGGCACGGCCATCGCCGGCTCGGTGGAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m5C_site_6085
mod ID: M5CSITE004798		Click to Show/Hide the Full List
mod site	chr10:124461957-124461958:+		[4]
Sequence	GGCGCGGGCGGCGGCACGGCCATCGCCGGCTCGGTGGAGGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: m5C_site_6086
mod ID: M5CSITE004799		Click to Show/Hide the Full List
mod site	chr10:124461960-124461961:+		[4]
Sequence	GCGGGCGGCGGCACGGCCATCGCCGGCTCGGTGGAGGCGGT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000392757.8
External Link	RMBase: m5C_site_6087
mod ID: M5CSITE004800		Click to Show/Hide the Full List
mod site	chr10:124461962-124461963:+		[4]
Sequence	GGGCGGCGGCACGGCCATCGCCGGCTCGGTGGAGGCGGTGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000368839.1; ENST00000392757.8; ENST00000368842.10
External Link	RMBase: m5C_site_6088
mod ID: M5CSITE004801		Click to Show/Hide the Full List
mod site	chr10:124461963-124461964:+		[4]
Sequence	GGCGGCGGCACGGCCATCGCCGGCTCGGTGGAGGCGGTGGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m5C_site_6089
mod ID: M5CSITE004802		Click to Show/Hide the Full List
mod site	chr10:124461977-124461978:+		[4]
Sequence	CATCGCCGGCTCGGTGGAGGCGGTGGCCAGGTGAGTGGGCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000392757.8; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: m5C_site_6090
mod ID: M5CSITE004803		Click to Show/Hide the Full List
mod site	chr10:124461983-124461984:+		[4]
Sequence	CGGCTCGGTGGAGGCGGTGGCCAGGTGAGTGGGCCCCGGGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000392757.8
External Link	RMBase: m5C_site_6091
mod ID: M5CSITE004804		Click to Show/Hide the Full List
mod site	chr10:124461984-124461985:+		[4]
Sequence	GGCTCGGTGGAGGCGGTGGCCAGGTGAGTGGGCCCCGGGAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000368842.10; ENST00000392757.8; ENST00000368839.1
External Link	RMBase: m5C_site_6092

N6-methyladenosine (m6A)

In total 35 m6A sequence/site(s) in this target gene
mod ID: M6ASITE002282		Click to Show/Hide the Full List
mod site	chr10:124488508-124488509:+		[5]
Sequence	AGAAAGCTTTTCTTATCAAAACATGAATAACGCCTTCCAGG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000392757.8; ENST00000368842.10; ENST00000368839.1; ENST00000487190.1; ENST00000481452.1
External Link	RMBase: m6A_site_122178
mod ID: M6ASITE002283		Click to Show/Hide the Full List
mod site	chr10:124496968-124496969:+		[5]
Sequence	GCTCTCTCCTAGGCGTTACTACAAGGAGACCTCTGGCCTGA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000368839.1; ENST00000392757.8; ENST00000368842.10; ENST00000481452.1
External Link	RMBase: m6A_site_122179
mod ID: M6ASITE002284		Click to Show/Hide the Full List
mod site	chr10:124613310-124613311:+		[6]
Sequence	GAAGGCTGATGGGTACGTGGACAACCTCGCAGAGGCAGTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000368842.10; ENST00000482963.1; ENST00000486535.1; ENST00000368839.1; ENST00000493240.1; ENST00000492187.1
External Link	RMBase: m6A_site_122180
mod ID: M6ASITE002285		Click to Show/Hide the Full List
mod site	chr10:124613331-124613332:+		[6]
Sequence	CAACCTCGCAGAGGCAGTGGACCTGCTGCTGCAGCACGCCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000368842.10; ENST00000482963.1; ENST00000493240.1; ENST00000492187.1; ENST00000368839.1; ENST00000486535.1
External Link	RMBase: m6A_site_122181
mod ID: M6ASITE002286		Click to Show/Hide the Full List
mod site	chr10:124613520-124613521:+		[7]
Sequence	CCACCTGCCCCAGTGCCCAGACCAACCAAGGCCCTGACAGC
Motif Score	2.876744048
Cell/Tissue List	HepG2; H1B; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000482963.1
External Link	RMBase: m6A_site_122182
mod ID: M6ASITE002287		Click to Show/Hide the Full List
mod site	chr10:124613655-124613656:+		[8]
Sequence	GTGAAGTCCAGGAGGGTGGGACAGGCCTGTCAGGCCTCTGG
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000482963.1; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m6A_site_122183
mod ID: M6ASITE002288		Click to Show/Hide the Full List
mod site	chr10:124613695-124613696:+		[8]
Sequence	GGAATCTCCCAAATCCCAGAACTCACCACTCACCATGGGCC
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000482963.1
External Link	RMBase: m6A_site_122184
mod ID: M6ASITE002289		Click to Show/Hide the Full List
mod site	chr10:124613730-124613731:+		[8]
Sequence	TGGGCCTTTAAATGCAGTAAACTCCACCTAACCAGATTCAG
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000368842.10; ENST00000482963.1
External Link	RMBase: m6A_site_122185
mod ID: M6ASITE002290		Click to Show/Hide the Full List
mod site	chr10:124613780-124613781:+		[8]
Sequence	GCCCACTGCCTCCTCTTCAGACTCTTTGCATTTCAGTGAAG
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000482963.1; ENST00000368842.10
External Link	RMBase: m6A_site_122186
mod ID: M6ASITE002291		Click to Show/Hide the Full List
mod site	chr10:124613813-124613814:+		[8]
Sequence	CAGTGAAGAGCCTGGAAGAAACCCAGGGGCCTCCTATGCAC
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000482963.1; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m6A_site_122187
mod ID: M6ASITE002292		Click to Show/Hide the Full List
mod site	chr10:124613851-124613852:+		[8]
Sequence	CACAGATCTTGCAGCCCAGAACCAAGTCAGCCTCCCTGCGA
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000482963.1; ENST00000368842.10
External Link	RMBase: m6A_site_122188
mod ID: M6ASITE002293		Click to Show/Hide the Full List
mod site	chr10:124613908-124613909:+		[6]
Sequence	CCCACCACCCCACCCCCGAAACAATGCCAGCCCGCTGCTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000482963.1; ENST00000368842.10
External Link	RMBase: m6A_site_122189
mod ID: M6ASITE002294		Click to Show/Hide the Full List
mod site	chr10:124613955-124613956:+		[6]
Sequence	CCTCCCAGTCACCTTTGCAGACAAAGACCAGGGGCAGCTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000482963.1; ENST00000368842.10
External Link	RMBase: m6A_site_122190
mod ID: M6ASITE002295		Click to Show/Hide the Full List
mod site	chr10:124613961-124613962:+		[6]
Sequence	AGTCACCTTTGCAGACAAAGACCAGGGGCAGCTCCCGAGGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000368839.1; ENST00000482963.1; ENST00000368842.10
External Link	RMBase: m6A_site_122191
mod ID: M6ASITE002296		Click to Show/Hide the Full List
mod site	chr10:124614003-124614004:+		[5]
Sequence	ACTGTGAAGGCTCCCATGCCACACAGTGAGAACTGTAGCCT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000482963.1; ENST00000368839.1; ENST00000368842.10
External Link	RMBase: m6A_site_122192
mod ID: M6ASITE002297		Click to Show/Hide the Full List
mod site	chr10:124614014-124614015:+		[6]
Sequence	TCCCATGCCACACAGTGAGAACTGTAGCCTCTGCGTCCAAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; A549; Huh7; Jurkat; CD4T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000368842.10; ENST00000482963.1; ENST00000368839.1
External Link	RMBase: m6A_site_122193
mod ID: M6ASITE002298		Click to Show/Hide the Full List
mod site	chr10:124614055-124614056:+		[6]
Sequence	GCACACAGGGTACTTTCTGGACCCACTGCTGGACAGACTTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; Jurkat; CD4T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000482963.1
External Link	RMBase: m6A_site_122194
mod ID: M6ASITE002299		Click to Show/Hide the Full List
mod site	chr10:124614067-124614068:+		[6]
Sequence	CTTTCTGGACCCACTGCTGGACAGACTTGAAGGTGTCATGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; Jurkat; CD4T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m6A_site_122195
mod ID: M6ASITE002300		Click to Show/Hide the Full List
mod site	chr10:124614107-124614108:+		[6]
Sequence	CCCGGTGTGTGCAGGAGGAAACTAACAGTTCAGTAAACTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; Jurkat; CD4T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000368842.10; ENST00000368839.1; ENST00000482963.1
External Link	RMBase: m6A_site_122196
mod ID: M6ASITE002301		Click to Show/Hide the Full List
mod site	chr10:124614123-124614124:+		[6]
Sequence	GGAAACTAACAGTTCAGTAAACTCTGCCTTGACCAGCAGCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; Jurkat; CD4T; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1; ENST00000368842.10; ENST00000368839.1
External Link	RMBase: m6A_site_122197
mod ID: M6ASITE002302		Click to Show/Hide the Full List
mod site	chr10:124616722-124616723:+		[6]
Sequence	CCTGGCAGAGACGGTGTGGAACCGCCGGCCGCATGCGGGGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; H1B
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122198
mod ID: M6ASITE002303		Click to Show/Hide the Full List
mod site	chr10:124616797-124616798:+		[6]
Sequence	TGTTCAACACATGTCGCGGAACTGTCGTGAAAAAAAGACTC
Motif Score	3.373380952
Cell/Tissue List	HeLa; H1A; H1B
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122199
mod ID: M6ASITE002304		Click to Show/Hide the Full List
mod site	chr10:124616814-124616815:+		[6]
Sequence	GGAACTGTCGTGAAAAAAAGACTCAGGACCACAGGTCCGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; H1A; H1B; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122200
mod ID: M6ASITE002305		Click to Show/Hide the Full List
mod site	chr10:124616821-124616822:+		[6]
Sequence	TCGTGAAAAAAAGACTCAGGACCACAGGTCCGGGGTGCTCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1A; H1B; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122201
mod ID: M6ASITE002306		Click to Show/Hide the Full List
mod site	chr10:124616965-124616966:+		[9]
Sequence	GGTGGGGGGTGGAGGGGAGGACAGGGAGAGCAGGCCTCTCG
Motif Score	3.643047619
Cell/Tissue List	H1A; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122202
mod ID: M6ASITE002307		Click to Show/Hide the Full List
mod site	chr10:124617256-124617257:+		[6]
Sequence	CTGCAGAAAAGGCCCACGAGACTCAGACTGGCAGAGACTTA
Motif Score	3.319380952
Cell/Tissue List	HeLa; H1A; H1B; HEK293A-TOA; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122204
mod ID: M6ASITE002308		Click to Show/Hide the Full List
mod site	chr10:124617262-124617263:+		[6]
Sequence	AAAAGGCCCACGAGACTCAGACTGGCAGAGACTTAGGCGGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293A-TOA; MSC; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122205
mod ID: M6ASITE002309		Click to Show/Hide the Full List
mod site	chr10:124617272-124617273:+		[6]
Sequence	CGAGACTCAGACTGGCAGAGACTTAGGCGGACCAGGAACAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293A-TOA; MSC; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122206
mod ID: M6ASITE002310		Click to Show/Hide the Full List
mod site	chr10:124617282-124617283:+		[6]
Sequence	ACTGGCAGAGACTTAGGCGGACCAGGAACAGGGGCGCAGTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293A-TOA; MSC; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122207
mod ID: M6ASITE002311		Click to Show/Hide the Full List
mod site	chr10:124617289-124617290:+		[6]
Sequence	GAGACTTAGGCGGACCAGGAACAGGGGCGCAGTCTCCGTCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293A-TOA; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122208
mod ID: M6ASITE002312		Click to Show/Hide the Full List
mod site	chr10:124617317-124617318:+		[6]
Sequence	GCAGTCTCCGTCCCACCCAAACCCTAACCAGAGAGAACACG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; H1A; H1B; HEK293T; HEK293A-TOA; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122210
mod ID: M6ASITE002313		Click to Show/Hide the Full List
mod site	chr10:124617333-124617334:+		[6]
Sequence	CCAAACCCTAACCAGAGAGAACACGGCACGTTGTGCCAGAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; H1A; H1B; CD4T; HEK293T; HEK293A-TOA; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122211
mod ID: M6ASITE002314		Click to Show/Hide the Full List
mod site	chr10:124617406-124617407:+		[6]
Sequence	CACTGCCGACAAGGCTGGGAACTGGGCCAAGTGAAGCAGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122214
mod ID: M6ASITE002315		Click to Show/Hide the Full List
mod site	chr10:124617650-124617651:+		[10]
Sequence	ACCTCAGGGCAGAGGTGGGGACACAGGGCGGGACGGGCGAG
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122220
mod ID: M6ASITE002316		Click to Show/Hide the Full List
mod site	chr10:124617753-124617754:+		[10]
Sequence	AGTTCCAGCTGCCCCTCAGAACTGTCCTGGTTTAGGAGGTG
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000482963.1
External Link	RMBase: m6A_site_122223

Ref 1	YTHDF2 mediates the mRNA degradation of the tumor suppressors to induce AKT phosphorylation in N6-methyladenosine-dependent way in prostate cancer. Mol Cancer. 2020 Oct 29;19(1):152. doi: 10.1186/s12943-020-01267-6.
Ref 2	Identification of widespread ultra-edited human RNAs. PLoS Genet. 2011 Oct;7(10):e1002317. doi: 10.1371/journal.pgen.1002317. Epub 2011 Oct 20.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 10	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map