m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00622)

Target Name	Death-associated protein kinase 2 (DAPK2)
Synonyms	DAP kinase 2; DAP-kinase-related protein 1; DRP-1 Click to Show/Hide
Gene Name	DAPK2
Chromosomal Location	15q22.31
Family	Protein kinase superfamily, CAMK Ser/Thr protein kinase family, DAP kinase subfamily
Function	Calcium/calmodulin-dependent serine/threonine kinase involved in multiple cellular signaling pathways that trigger cell survival, apoptosis, and autophagy. Regulates both type I apoptotic and type II autophagic cell death signals, depending on the cellular setting. The former is caspase-dependent, while the latter is caspase-independent and is characterized by the accumulation of autophagic vesicles. Acts as a mediator of anoikis and a suppressor of beta-catenin-dependent anchorage-independent growth of malignant epithelial cells. May play a role in granulocytic maturation. Regulates granulocytic motility by controlling cell spreading and polarization. Click to Show/Hide
Gene ID	23604
Uniprot ID	DAPK2_HUMAN
HGNC ID	HGNC:2675
KEGG ID	hsa:23604

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DAPK2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -2.25E+00 p-value: 1.26E-07
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between DAPK2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 6.83E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Cigarette smoking induced aberrant N6-methyladenosine modification of Death-associated protein kinase 2 (DAPK2), which resulted in decreased DAPK2 mRNA stability and expression of its mRNA and protein. This modification was mediated by the m6A "writer" METTL3 and the m6A "reader" YTHDF2. BAY 11-7085, a NF-Kappa-B signaling selective inhibitor, was shown to efficiently suppressed downregulation of DAPK2-induced oncogenic phenotypes of NSCLC cells.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
In-vitro Model	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Human umbilical cord blood CD34+ cells	Homo sapiens
Treatment: YTHDF2 knockdown UCB CD34+ cells Control: Wild type UCB CD34+ cells		GSE107956
Regulation		logFC: 1.13E+00 p-value: 1.77E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Cigarette smoking induced aberrant N6-methyladenosine modification of Death-associated protein kinase 2 (DAPK2), which resulted in decreased DAPK2 mRNA stability and expression of its mRNA and protein. This modification was mediated by the m6A "writer" METTL3 and the m6A "reader" YTHDF2. BAY 11-7085, a NF-Kappa-B signaling selective inhibitor, was shown to efficiently suppressed downregulation of DAPK2-induced oncogenic phenotypes of NSCLC cells.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
In-vitro Model	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Cigarette smoking induced aberrant N6-methyladenosine modification of Death-associated protein kinase 2 (DAPK2), which resulted in decreased DAPK2 mRNA stability and expression of its mRNA and protein. This modification was mediated by the m6A "writer" METTL3 and the m6A "reader" YTHDF2. BAY 11-7085, a NF-Kappa-B signaling selective inhibitor, was shown to efficiently suppressed downregulation of DAPK2-induced oncogenic phenotypes of NSCLC cells.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Cigarette smoking induced aberrant N6-methyladenosine modification of Death-associated protein kinase 2 (DAPK2), which resulted in decreased DAPK2 mRNA stability and expression of its mRNA and protein. This modification was mediated by the m6A "writer" METTL3 and the m6A "reader" YTHDF2. BAY 11-7085, a NF-Kappa-B signaling selective inhibitor, was shown to efficiently suppressed downregulation of DAPK2-induced oncogenic phenotypes of NSCLC cells.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	NCI-H838	Lung adenocarcinoma	Homo sapiens	CVCL_1594
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00622)

Death-associated protein kinase 2 (DAPK2)

Adenosine-to-Inosine editing (A-to-I)

In total 15 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006920		Click to Show/Hide the Full List
mod site	chr15:63909738-63909739:-		[2]
Sequence	CACCATCTCAGCTCGCTGCAACCTCTGCCTCCCGGGTTCAA
Transcript ID List	ENST00000558064.1; ENST00000559007.5; ENST00000261891.7; ENST00000457488.5; ENST00000559731.5
External Link	RMBase: RNA-editing_site_44273
mod ID: A2ISITE006921		Click to Show/Hide the Full List
mod site	chr15:63909793-63909794:-		[3]
Sequence	TTTTTTTTTTTTTGAGACAGAGTCTCACTGTGTCTCCCAGG
Transcript ID List	ENST00000457488.5; ENST00000559007.5; ENST00000261891.7; ENST00000559731.5; ENST00000558064.1
External Link	RMBase: RNA-editing_site_44274
mod ID: A2ISITE006922		Click to Show/Hide the Full List
mod site	chr15:63910618-63910619:-		[2]
Sequence	GAGCCCAGGAGTTAAAGGTTACAGTGAATTATGATCACACT
Transcript ID List	rmsk_4360496; ENST00000457488.5; ENST00000559731.5; ENST00000558064.1; ENST00000559007.5; ENST00000261891.7
External Link	RMBase: RNA-editing_site_44275
mod ID: A2ISITE006923		Click to Show/Hide the Full List
mod site	chr15:63910642-63910643:-		[2]
Sequence	GGAGCTGAGGTGGGAGGATCACTTGAGCCCAGGAGTTAAAG
Transcript ID List	ENST00000559731.5; ENST00000558064.1; ENST00000457488.5; ENST00000559007.5; rmsk_4360496; ENST00000261891.7
External Link	RMBase: RNA-editing_site_44276
mod ID: A2ISITE006924		Click to Show/Hide the Full List
mod site	chr15:63910678-63910679:-		[4]
Sequence	GTATGGTGACAGGCACCTATAGTCCTAGCTACTCAGGGAGC
Transcript ID List	ENST00000559731.5; ENST00000457488.5; ENST00000558064.1; ENST00000261891.7; ENST00000559007.5; rmsk_4360496
External Link	RMBase: RNA-editing_site_44277
mod ID: A2ISITE006925		Click to Show/Hide the Full List
mod site	chr15:63910680-63910681:-		[4]
Sequence	AGGTATGGTGACAGGCACCTATAGTCCTAGCTACTCAGGGA
Transcript ID List	ENST00000558064.1; rmsk_4360496; ENST00000261891.7; ENST00000559731.5; ENST00000457488.5; ENST00000559007.5
External Link	RMBase: RNA-editing_site_44278
mod ID: A2ISITE006926		Click to Show/Hide the Full List
mod site	chr15:63910755-63910756:-		[4]
Sequence	AGACCAGCCCAGGCAACAACAGTGAGACCCTGACTCTACAA
Transcript ID List	rmsk_4360496; ENST00000558064.1; ENST00000457488.5; ENST00000261891.7; ENST00000559731.5; ENST00000559007.5
External Link	RMBase: RNA-editing_site_44279
mod ID: A2ISITE006927		Click to Show/Hide the Full List
mod site	chr15:63910784-63910785:-		[2]
Sequence	CGGGAGGTTCATTTAAGGCCAGGAGTTAAAGACCAGCCCAG
Transcript ID List	ENST00000559007.5; ENST00000457488.5; ENST00000558064.1; ENST00000559731.5; ENST00000261891.7; rmsk_4360496
External Link	RMBase: RNA-editing_site_44280
mod ID: A2ISITE006928		Click to Show/Hide the Full List
mod site	chr15:63910789-63910790:-		[2]
Sequence	TGAGGCGGGAGGTTCATTTAAGGCCAGGAGTTAAAGACCAG
Transcript ID List	ENST00000559731.5; ENST00000558064.1; rmsk_4360496; ENST00000261891.7; ENST00000559007.5; ENST00000457488.5
External Link	RMBase: RNA-editing_site_44281
mod ID: A2ISITE006929		Click to Show/Hide the Full List
mod site	chr15:63911118-63911119:-		[2]
Sequence	TCAAGCGATTCTCCTGCGTCAGCCTCCTGAGTAGCTGGGAT
Transcript ID List	ENST00000261891.7; ENST00000558064.1; ENST00000559007.5; ENST00000559731.5; ENST00000457488.5
External Link	RMBase: RNA-editing_site_44282
mod ID: A2ISITE006930		Click to Show/Hide the Full List
mod site	chr15:63911179-63911180:-		[2]
Sequence	ATTGCTTAGGTTGGAGTGCAATGGCGCGATCTCGGCTCACC
Transcript ID List	ENST00000558064.1; ENST00000457488.5; ENST00000559007.5; ENST00000559731.5; ENST00000261891.7
External Link	RMBase: RNA-editing_site_44283
mod ID: A2ISITE006931		Click to Show/Hide the Full List
mod site	chr15:63911199-63911200:-		[2]
Sequence	TTAGACAGAGTTTCACTCTTATTGCTTAGGTTGGAGTGCAA
Transcript ID List	ENST00000559731.5; ENST00000558064.1; ENST00000261891.7; ENST00000559007.5; ENST00000457488.5
External Link	RMBase: RNA-editing_site_44284
mod ID: A2ISITE006932		Click to Show/Hide the Full List
mod site	chr15:63927927-63927928:-		[3]
Sequence	GACAAAACCCCATCTCTACAAAAAACAAAACAAAAAACTAG
Transcript ID List	ENST00000559007.5; rmsk_4360527; ENST00000457488.5; ENST00000261891.7; ENST00000612884.4; ENST00000558069.5
External Link	RMBase: RNA-editing_site_44285
mod ID: A2ISITE006933		Click to Show/Hide the Full List
mod site	chr15:63928188-63928189:-		[3]
Sequence	ATATCACAATTGCTAGGGGTAGGGACTTAGTATCTGTATCT
Transcript ID List	ENST00000559007.5; ENST00000261891.7; ENST00000457488.5; rmsk_4360528; ENST00000558069.5; ENST00000612884.4
External Link	RMBase: RNA-editing_site_44286
mod ID: A2ISITE006934		Click to Show/Hide the Full List
mod site	chr15:64003635-64003636:-		[3]
Sequence	TCCAGCCTGGGTGACAGAGCAAGACTCTGTCAGAAGGAAAA
Transcript ID List	ENST00000558069.5; ENST00000561162.5; ENST00000559007.5; ENST00000559897.1; ENST00000261891.7; ENST00000612884.4; ENST00000559306.1; rmsk_4360695; ENST00000457488.5; ENST00000558482.5
External Link	RMBase: RNA-editing_site_44287

N6-methyladenosine (m6A)

In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE023546		Click to Show/Hide the Full List
mod site	chr15:63907938-63907939:-		[5]
Sequence	ATTTTGCTCATTTTTATTAAACTTCTGGTTTACCTGATGCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; GM12878; peripheral-blood; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000559007.5; ENST00000261891.7; ENST00000457488.5
External Link	RMBase: m6A_site_282358
mod ID: M6ASITE023547		Click to Show/Hide the Full List
mod site	chr15:63907997-63907998:-		[6]
Sequence	CAGGCTGACCAACACCTCAGACCTTCTGAAGCAGCCCATTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; H1B; H1A; GM12878; LCLs; Huh7; CD4T; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559007.5; ENST00000457488.5; ENST00000261891.7
External Link	RMBase: m6A_site_282359
mod ID: M6ASITE023548		Click to Show/Hide the Full List
mod site	chr15:63908036-63908037:-		[6]
Sequence	CAATCCTGTGACCTCCCAGAACCATGGAAGCCAGGACGTCA
Motif Score	2.930744048
Cell/Tissue List	HeLa; A549; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559007.5; ENST00000261891.7; ENST00000457488.5
External Link	RMBase: m6A_site_282360
mod ID: M6ASITE023549		Click to Show/Hide the Full List
mod site	chr15:63908058-63908059:-		[6]
Sequence	GTGAACCTTGGGTGTGAGGGACCAATCCTGTGACCTCCCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000559007.5; ENST00000261891.7
External Link	RMBase: m6A_site_282361
mod ID: M6ASITE023550		Click to Show/Hide the Full List
mod site	chr15:63908074-63908075:-		[6]
Sequence	AGGGTGATTGAGGAAAGTGAACCTTGGGTGTGAGGGACCAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000261891.7; ENST00000457488.5; ENST00000559007.5
External Link	RMBase: m6A_site_282362
mod ID: M6ASITE023551		Click to Show/Hide the Full List
mod site	chr15:63908096-63908097:-		[6]
Sequence	CAGAGTCCTCCCCATTGGGAACAGGGTGATTGAGGAAAGTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; peripheral-blood; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000559007.5; ENST00000261891.7
External Link	RMBase: m6A_site_282363
mod ID: M6ASITE023552		Click to Show/Hide the Full List
mod site	chr15:63908117-63908118:-		[6]
Sequence	CCAAAAATTACACCAGAGAGACAGAGTCCTCCCCATTGGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1A; H1B; GM12878; LCLs; Huh7; peripheral-blood; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000261891.7; ENST00000559007.5
External Link	RMBase: m6A_site_282364
mod ID: M6ASITE023553		Click to Show/Hide the Full List
mod site	chr15:63908147-63908148:-		[6]
Sequence	ACAGGCTGAGGGGGTTCAGAACCAGCCTGGCCAAAAATTAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1B; GM12878; LCLs; Huh7; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000261891.7; ENST00000559007.5
External Link	RMBase: m6A_site_282365
mod ID: M6ASITE023554		Click to Show/Hide the Full List
mod site	chr15:63908185-63908186:-		[6]
Sequence	CATCACGGGGTGAAGGTCAGACTAAGGCAGCCTTCTTCACA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000261891.7; ENST00000559007.5
External Link	RMBase: m6A_site_282366
mod ID: M6ASITE023555		Click to Show/Hide the Full List
mod site	chr15:63908215-63908216:-		[6]
Sequence	TTAGGAAAACAATATAAAGGACATCCTCATCATCACGGGGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; LCLs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000261891.7; ENST00000457488.5; ENST00000559007.5
External Link	RMBase: m6A_site_282367
mod ID: M6ASITE023556		Click to Show/Hide the Full List
mod site	chr15:63908227-63908228:-		[6]
Sequence	GGGAGTGTGGACTTAGGAAAACAATATAAAGGACATCCTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; GM12878; LCLs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000457488.5; ENST00000559007.5; ENST00000261891.7
External Link	RMBase: m6A_site_282368
mod ID: M6ASITE023557		Click to Show/Hide the Full List
mod site	chr15:63908237-63908238:-		[5]
Sequence	AGTCTGGGGTGGGAGTGTGGACTTAGGAAAACAATATAAAG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HeLa; A549; GM12878
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000261891.7; ENST00000559007.5; ENST00000457488.5
External Link	RMBase: m6A_site_282369
mod ID: M6ASITE023558		Click to Show/Hide the Full List
mod site	chr15:63908356-63908357:-		[6]
Sequence	GCTTGCAGGCAAGCCAGGAGACCCTGGGAGCTGTGGCTGTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; U2OS; H1A; GM12878; peripheral-blood; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000457488.5; ENST00000559731.5; ENST00000559007.5; ENST00000261891.7
External Link	RMBase: m6A_site_282370
mod ID: M6ASITE023559		Click to Show/Hide the Full List
mod site	chr15:63908448-63908449:-		[6]
Sequence	CCTTCTGTGCAGACTTTTGGACCCAGCTCAGCACCAGCACC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; U2OS; H1B; Jurkat; peripheral-blood; GSC-11; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559007.5; ENST00000261891.7; ENST00000457488.5; ENST00000559731.5
External Link	RMBase: m6A_site_282371
mod ID: M6ASITE023560		Click to Show/Hide the Full List
mod site	chr15:63908456-63908457:-		[6]
Sequence	CGGGGCTCCCTTCTGTGCAGACTTTTGGACCCAGCTCAGCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; U2OS; H1B; Jurkat; peripheral-blood; GSC-11; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559731.5; ENST00000559007.5; ENST00000457488.5; ENST00000261891.7
External Link	RMBase: m6A_site_282372
mod ID: M6ASITE023561		Click to Show/Hide the Full List
mod site	chr15:63908571-63908572:-		[6]
Sequence	TGAGAGTGACACTGAGGAGGACATCGCCAGGAGGAAAGCCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; Jurkat; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000559007.5; ENST00000559731.5; ENST00000457488.5; ENST00000261891.7
External Link	RMBase: m6A_site_282373
mod ID: M6ASITE023562		Click to Show/Hide the Full List
mod site	chr15:63922807-63922808:-		[7]
Sequence	GGGCTCCACATTCTACCAGGACACCAGTGAATCCCTGTCAG
Motif Score	3.643047619
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000558069.5; ENST00000559007.5; ENST00000557867.1; ENST00000261891.7; ENST00000457488.5; ENST00000612884.4
External Link	RMBase: m6A_site_282374
mod ID: M6ASITE023563		Click to Show/Hide the Full List
mod site	chr15:63926049-63926050:-		[6]
Sequence	TGGGAGACACGAAGCAGGAAACACTGGCAAATATCACAGCA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000261891.7; ENST00000558076.1; ENST00000558069.5; ENST00000457488.5; ENST00000612884.4; ENST00000559007.5; ENST00000557867.1
External Link	RMBase: m6A_site_282375
mod ID: M6ASITE023564		Click to Show/Hide the Full List
mod site	chr15:63926063-63926064:-		[6]
Sequence	AGCATCCCCTTTCCTGGGAGACACGAAGCAGGAAACACTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000558069.5; ENST00000557867.1; ENST00000261891.7; ENST00000559007.5; ENST00000612884.4; ENST00000558076.1; ENST00000457488.5
External Link	RMBase: m6A_site_282376

Ref 1	Cigarette smoking induces aberrant N(6)-methyladenosine of DAPK2 to promote non-small cell lung cancer progression by activating NF-KappaB pathway. Cancer Lett. 2021 Oct 10;518:214-229. doi: 10.1016/j.canlet.2021.07.022. Epub 2021 Jul 21.
Ref 2	Widespread RNA editing of embedded alu elements in the human transcriptome. Genome Res. 2004 Sep;14(9):1719-25. doi: 10.1101/gr.2855504.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 5	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map