General Information of the m6A Target Gene (ID: M6ATAR00621)
Target Name Protein kinase C eta type (PKC-eta)
Synonyms
PKC-L; nPKC-eta
    Click to Show/Hide
Gene Name PKC-eta
Chromosomal Location 14q23.1
Family Protein kinase superfamily, AGC Ser/Thr protein kinase family, PKC subfamily
Function
Calcium-independent, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in the regulation of cell differentiation in keratinocytes and pre-B cell receptor, mediates regulation of epithelial tight junction integrity and foam cell formation, and is required for glioblastoma proliferation and apoptosis prevention in MCF-7 cells. In keratinocytes, binds and activates the tyrosine kinase FYN, which in turn blocks epidermal growth factor receptor (EGFR) signaling and leads to keratinocyte growth arrest and differentiation. Associates with the cyclin CCNE1-CDK2-CDKN1B complex and inhibits CDK2 kinase activity, leading to RB1 dephosphorylation and thereby G1 arrest in keratinocytes. In association with RALA activates actin depolymerization, which is necessary for keratinocyte differentiation. In the pre-B cell receptor signaling, functions downstream of BLNK by up-regulating IRF4, which in turn activates L chain gene rearrangement. Regulates epithelial tight junctions (TJs) by phosphorylating occludin (OCLN) on threonine residues, which is necessary for the assembly and maintenance of TJs. In association with PLD2 and via TLR4 signaling, is involved in lipopolysaccharide (LPS)-induced RGS2 down-regulation and foam cell formation. Upon PMA stimulation, mediates glioblastoma cell proliferation by activating the mTOR pathway, the PI3K/AKT pathway and the ERK1-dependent phosphorylation of ELK1. Involved in the protection of glioblastoma cells from irradiation-induced apoptosis by preventing caspase-9 activation. In camptothecin-treated MCF-7 cells, regulates NF-kappa-B upstream signaling by activating IKBKB, and confers protection against DNA damage-induced apoptosis. Promotes oncogenic functions of ATF2 in the nucleus while blocking its apoptotic function at mitochondria. Phosphorylates ATF2 which promotes its nuclear retention and transcriptional activity and negatively regulates its mitochondrial localization.
    Click to Show/Hide
Gene ID 5583
Uniprot ID
KPCL_HUMAN
HGNC ID
HGNC:9403
KEGG ID
hsa:5583
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PKC-eta can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
GSE167075
Regulation
logFC: 8.88E-01
p-value: 2.37E-29
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Specific depletion of METTL3 in pericytes suppressed diabetes-induced pericyte dysfunction and Microvascular complication in vivo. METTL3 overexpression impaired pericyte function by repressing Protein kinase C eta type (PKC-eta), FAT4, and PDGFRA expression, which was mediated by YTHDF2-dependent mRNA decay.
Target Regulation Down regulation
Responsed Disease Diseases of arteries or arterioles ICD-11: BD5Y
In-vitro Model ACBRI-183 (Human retinal pericytes (ACBRI-183) was obtained from Cell Systems Corp. (CSC, USA))
In-vivo Model Mettl3 floxed mice were purchased from GemPharmatech Co. Ltd (Nanjing, China). Pdgfr-Beta-Cre mice were purchased from Beijing Biocytogen Co. Ltd (Beijing, China) generated on C57BL/6J background. Mettl3 flox/flox mice were crossed with Pdgfr-Beta-Cre mice to generate pericyte-specific Mettl3 knockout mice. All mice were bred under the specific-pathogen free condition with free access to diet and water or their nursing mothers with alternating 12/12 light-dark cycle (lights on at 08:00 and off at 20:00).
Diseases of arteries or arterioles [ICD-11: BD5Y]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Specific depletion of METTL3 in pericytes suppressed diabetes-induced pericyte dysfunction and Microvascular complication in vivo. METTL3 overexpression impaired pericyte function by repressing Protein kinase C eta type (PKC-eta), FAT4, and PDGFRA expression, which was mediated by YTHDF2-dependent mRNA decay.
Responsed Disease Diseases of arteries or arterioles [ICD-11: BD5Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
In-vitro Model ACBRI-183 (Human retinal pericytes (ACBRI-183) was obtained from Cell Systems Corp. (CSC, USA))
In-vivo Model Mettl3 floxed mice were purchased from GemPharmatech Co. Ltd (Nanjing, China). Pdgfr-Beta-Cre mice were purchased from Beijing Biocytogen Co. Ltd (Beijing, China) generated on C57BL/6J background. Mettl3 flox/flox mice were crossed with Pdgfr-Beta-Cre mice to generate pericyte-specific Mettl3 knockout mice. All mice were bred under the specific-pathogen free condition with free access to diet and water or their nursing mothers with alternating 12/12 light-dark cycle (lights on at 08:00 and off at 20:00).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00621)
Protein kinase C eta type (PKC-eta)
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000239 Click to Show/Hide the Full List
mod site chr14:61530557-61530558:+
Sequence TGATGAGGTGGTCTACCCTACCTGGCTCCATGAAGATGCCA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000553846.1; ENST00000555185.5; ENST00000536400.5; ENST00000555082.5; ENST00000332981.10; ENST00000555382.5; ENST00000556347.1; ENST00000557599.5; ENST00000555628.5
External Link RMBase: m5C_site_12914
N6-methyladenosine (m6A)
In total 48 m6A sequence/site(s) in this target gene
mod ID: M6ASITE019879 Click to Show/Hide the Full List
mod site chr14:61281162-61281163:+ [2]
Sequence GTCATGGCGGCCGCGCGGGGACCGACGCGCGGGCTGACCGA
Motif Score 3.622404762
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000555185.5; ENST00000556778.5; ENST00000555906.5; ENST00000557294.5; ENST00000555542.5
External Link RMBase: m6A_site_250303
mod ID: M6ASITE019880 Click to Show/Hide the Full List
mod site chr14:61281235-61281236:+ [2]
Sequence CGCGCCGCGCAAGCCCGGGGACTGCTCGCGGGTCGGGTTTC
Motif Score 4.065041667
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000555542.5; ENST00000557294.5; ENST00000556778.5; ENST00000555185.5; ENST00000554835.1; ENST00000555906.5
External Link RMBase: m6A_site_250304
mod ID: M6ASITE019881 Click to Show/Hide the Full List
mod site chr14:61322040-61322041:+ [3]
Sequence GAGGGCTGGCCTGAGACGGGACTCCCGGTTCTCCCGCTGCG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; Jurkat; CD4T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000555906.5; ENST00000556778.5; ENST00000557294.5; ENST00000332981.10; ENST00000555542.5; ENST00000555185.5
External Link RMBase: m6A_site_250313
mod ID: M6ASITE019882 Click to Show/Hide the Full List
mod site chr14:61322225-61322226:+ [4]
Sequence GAAGGGCCACCAGCTGCTGGACCCCTATCTGACGGTGAGCG
Motif Score 3.622404762
Cell/Tissue List Jurkat; CD4T; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000555542.5; ENST00000332981.10; ENST00000555906.5; ENST00000556778.5; ENST00000555185.5; ENST00000557294.5
External Link RMBase: m6A_site_250314
mod ID: M6ASITE019883 Click to Show/Hide the Full List
mod site chr14:61322249-61322250:+ [4]
Sequence CTATCTGACGGTGAGCGTGGACCAGGTGCGCGTGGGCCAGA
Motif Score 3.622404762
Cell/Tissue List Jurkat; CD4T; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000555906.5; ENST00000555542.5; ENST00000332981.10; ENST00000555185.5; ENST00000557294.5; ENST00000556778.5
External Link RMBase: m6A_site_250315
mod ID: M6ASITE019884 Click to Show/Hide the Full List
mod site chr14:61322269-61322270:+ [4]
Sequence ACCAGGTGCGCGTGGGCCAGACCAGCACCAAGCAGAAGACC
Motif Score 2.876744048
Cell/Tissue List Jurkat; CD4T; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000556778.5; ENST00000555542.5; ENST00000555906.5; ENST00000332981.10; ENST00000557294.5; ENST00000555185.5
External Link RMBase: m6A_site_250316
mod ID: M6ASITE019885 Click to Show/Hide the Full List
mod site chr14:61322287-61322288:+ [4]
Sequence AGACCAGCACCAAGCAGAAGACCAACAAACCCACGTACAAC
Motif Score 2.876744048
Cell/Tissue List Jurkat; CD4T; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000555906.5; ENST00000555185.5; ENST00000556778.5; ENST00000332981.10; ENST00000555542.5; ENST00000557294.5
External Link RMBase: m6A_site_250317
mod ID: M6ASITE019886 Click to Show/Hide the Full List
mod site chr14:61322295-61322296:+ [4]
Sequence ACCAAGCAGAAGACCAACAAACCCACGTACAACGAGGAGTT
Motif Score 2.185083333
Cell/Tissue List Jurkat; CD4T; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000556778.5; ENST00000555542.5; ENST00000555185.5; ENST00000557294.5; ENST00000332981.10; ENST00000555906.5
External Link RMBase: m6A_site_250318
mod ID: M6ASITE019887 Click to Show/Hide the Full List
mod site chr14:61322303-61322304:+ [5]
Sequence GAAGACCAACAAACCCACGTACAACGAGGAGTTTTGCGCTA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000332981.10; ENST00000555906.5; ENST00000555542.5; ENST00000556778.5; ENST00000557294.5; ENST00000555185.5
External Link RMBase: m6A_site_250319
mod ID: M6ASITE019888 Click to Show/Hide the Full List
mod site chr14:61322447-61322448:+ [6]
Sequence GCGCACGACCGGCGCCTCGGACACCTTCGAGGGTTGGGTGA
Motif Score 3.643047619
Cell/Tissue List CD34; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000556778.5; ENST00000332981.10; ENST00000555906.5; ENST00000555542.5; ENST00000555185.5; ENST00000557294.5
External Link RMBase: m6A_site_250320
mod ID: M6ASITE019889 Click to Show/Hide the Full List
mod site chr14:61322674-61322675:+ [6]
Sequence TCTCCAGGAAGCCGGCCTGGACACGATCCCCTTTCAGGACA
Motif Score 3.643047619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000332981.10; ENST00000555906.5; ENST00000556778.5; ENST00000555542.5; ENST00000555082.5; ENST00000555185.5
External Link RMBase: m6A_site_250321
mod ID: M6ASITE019890 Click to Show/Hide the Full List
mod site chr14:61322692-61322693:+ [6]
Sequence GGACACGATCCCCTTTCAGGACAGCGGCTTGGCCTAACGGG
Motif Score 3.643047619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000332981.10; ENST00000555185.5; ENST00000555542.5; ENST00000555082.5; ENST00000556778.5; ENST00000555906.5
External Link RMBase: m6A_site_250322
mod ID: M6ASITE019891 Click to Show/Hide the Full List
mod site chr14:61443138-61443139:+ [5]
Sequence CAGAGAGACCGGATCTTCAAACATTTTACCAGGAAGCGCCA
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000553265.5; ENST00000553726.5; ENST00000553831.5; ENST00000555542.5; ENST00000332981.10; ENST00000556164.5; ENST00000555082.5; ENST00000557473.1; ENST00000557585.5; ENST00000556778.5; ENST00000555906.5; ENST00000553830.1; ENST00000555185.5
External Link RMBase: m6A_site_250323
mod ID: M6ASITE019892 Click to Show/Hide the Full List
mod site chr14:61450907-61450908:+ [5]
Sequence TCCACAACTACAAAGTGCCAACATTCTGCGATCACTGTGGC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000332981.10; ENST00000555082.5; ENST00000556778.5; ENST00000555185.5; ENST00000553726.5; ENST00000557473.1; ENST00000557585.5
External Link RMBase: m6A_site_250324
mod ID: M6ASITE019893 Click to Show/Hide the Full List
mod site chr14:61450951-61450952:+ [5]
Sequence CTGCTCTGGGGAATAATGCGACAAGGACTTCAGTGTAAAAG
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000557585.5; ENST00000556778.5; ENST00000555082.5; ENST00000553726.5; ENST00000555185.5; ENST00000332981.10
External Link RMBase: m6A_site_250325
mod ID: M6ASITE019894 Click to Show/Hide the Full List
mod site chr14:61453295-61453296:+ [6]
Sequence TGTGGGGTAAATGCGGTGGAACTTGCCAAGACCCTGGCAGG
Motif Score 3.373380952
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000553726.5; ENST00000332981.10; ENST00000555082.5; ENST00000555185.5; ENST00000557585.5; ENST00000553889.5
External Link RMBase: m6A_site_250326
mod ID: M6ASITE019895 Click to Show/Hide the Full List
mod site chr14:61453305-61453306:+ [6]
Sequence ATGCGGTGGAACTTGCCAAGACCCTGGCAGGGATGGGTCTC
Motif Score 2.876744048
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000555185.5; ENST00000332981.10; ENST00000557585.5; ENST00000553726.5; ENST00000553889.5; ENST00000555082.5
External Link RMBase: m6A_site_250327
mod ID: M6ASITE019896 Click to Show/Hide the Full List
mod site chr14:61456846-61456847:+ [6]
Sequence GGTGGCGCTCGTGGAATGGGACCTTCCCGTGGAAAGCCACC
Motif Score 3.622404762
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000557585.5; ENST00000555185.5; ENST00000555082.5; ENST00000553726.5; ENST00000557559.1; ENST00000553889.5; ENST00000332981.10
External Link RMBase: m6A_site_250328
mod ID: M6ASITE019897 Click to Show/Hide the Full List
mod site chr14:61457031-61457032:+ [7]
Sequence AGGGAGTTTCGAGTGGCAGAACCGATCATCTGTCAAACTGA
Motif Score 2.930744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000553726.5; ENST00000557585.5; ENST00000555082.5; ENST00000332981.10; ENST00000553889.5; ENST00000557559.1; ENST00000555185.5
External Link RMBase: m6A_site_250329
mod ID: M6ASITE019898 Click to Show/Hide the Full List
mod site chr14:61457047-61457048:+ [7]
Sequence CAGAACCGATCATCTGTCAAACTGAGTTGATCTTTCCCCCA
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000555082.5; ENST00000557585.5; ENST00000332981.10; ENST00000553889.5; ENST00000557559.1; ENST00000555185.5; ENST00000553726.5
External Link RMBase: m6A_site_250330
mod ID: M6ASITE019899 Click to Show/Hide the Full List
mod site chr14:61457177-61457178:+ [7]
Sequence GTGTTCTTACTCTTTCAGAAACTCGTTTCCAGATCGACCCT
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000553889.5; ENST00000557585.5; ENST00000553726.5; ENST00000332981.10; ENST00000555185.5; ENST00000557559.1; ENST00000555082.5
External Link RMBase: m6A_site_250331
mod ID: M6ASITE019900 Click to Show/Hide the Full List
mod site chr14:61457529-61457530:+ [6]
Sequence TGCTTGCAAGAGTAAAAGAAACAGGAGACCTCTATGCTGTG
Motif Score 2.20572619
Cell/Tissue List CD34; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000332981.10; ENST00000555185.5; ENST00000553889.5; ENST00000557585.5; ENST00000555604.1; ENST00000555082.5; ENST00000557559.1
External Link RMBase: m6A_site_250332
mod ID: M6ASITE019901 Click to Show/Hide the Full List
mod site chr14:61457536-61457537:+ [6]
Sequence AAGAGTAAAAGAAACAGGAGACCTCTATGCTGTGAAGGTGC
Motif Score 2.876744048
Cell/Tissue List CD34; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000557585.5; ENST00000557559.1; ENST00000555185.5; ENST00000553889.5; ENST00000332981.10; ENST00000555604.1; ENST00000555082.5
External Link RMBase: m6A_site_250333
mod ID: M6ASITE019902 Click to Show/Hide the Full List
mod site chr14:61529088-61529089:+ [5]
Sequence TTTCAGAGATCTGAAACTGGACAATGTCCTGTTGGACCACG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000555233.5; ENST00000536400.5; ENST00000555628.5; ENST00000555185.5; ENST00000557599.5; ENST00000640011.1; ENST00000555082.5; ENST00000332981.10; ENST00000555382.5; ENST00000553846.1; ENST00000555110.1
External Link RMBase: m6A_site_250334
mod ID: M6ASITE019903 Click to Show/Hide the Full List
mod site chr14:61543388-61543389:+ [6]
Sequence GGGCCACAGCAGGAAGGGGAACATAAAATGAGTCCCTGAGT
Motif Score 2.951386905
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000555082.5; ENST00000556245.1; ENST00000556347.1; ENST00000555628.5; ENST00000557599.5; ENST00000536400.5; ENST00000555382.5; ENST00000332981.10; ENST00000553846.1
External Link RMBase: m6A_site_250335
mod ID: M6ASITE019904 Click to Show/Hide the Full List
mod site chr14:61544660-61544661:+ [6]
Sequence CAGCCTCCCAGATTTGGCAGACTGTAGGATCTCAGTAAGTG
Motif Score 3.319380952
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000556347.1; ENST00000556245.1; ENST00000536400.5; ENST00000555082.5; ENST00000332981.10; ENST00000555628.5; ENST00000555382.5; ENST00000557599.5; ENST00000553846.1
External Link RMBase: m6A_site_250336
mod ID: M6ASITE019905 Click to Show/Hide the Full List
mod site chr14:61547755-61547756:+ [6]
Sequence CACTCAGTTCATGACCAAGAACCCCACCATGCGCTTGGGCA
Motif Score 2.930744048
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000553846.1; ENST00000557599.5; ENST00000555628.5; ENST00000555082.5; ENST00000332981.10; ENST00000556245.1; ENST00000555382.5; ENST00000536400.5; ENST00000556347.1
External Link RMBase: m6A_site_250337
mod ID: M6ASITE019906 Click to Show/Hide the Full List
mod site chr14:61547810-61547811:+ [6]
Sequence GGCGAGCACGCCATCTTGAGACATCCTTTTTTTAAGGAAAT
Motif Score 2.897386905
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000555628.5; ENST00000555082.5; ENST00000556245.1; ENST00000553846.1; ENST00000556347.1; ENST00000557599.5; ENST00000332981.10; ENST00000555382.5; ENST00000536400.5
External Link RMBase: m6A_site_250338
mod ID: M6ASITE019907 Click to Show/Hide the Full List
mod site chr14:61547848-61547849:+ [6]
Sequence AATCGACTGGGCCCAGCTGAACCATCGCCAAATAGAACCGC
Motif Score 2.930744048
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000332981.10; ENST00000555382.5; ENST00000557599.5; ENST00000556245.1; ENST00000555082.5; ENST00000536400.5; ENST00000556347.1; ENST00000555628.5
External Link RMBase: m6A_site_250339
mod ID: M6ASITE019908 Click to Show/Hide the Full List
mod site chr14:61547864-61547865:+ [6]
Sequence CTGAACCATCGCCAAATAGAACCGCCTTTCAGACCCAGAAT
Motif Score 2.930744048
Cell/Tissue List CD34; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000332981.10; ENST00000536400.5; ENST00000555382.5; ENST00000557599.5; ENST00000556347.1; ENST00000556245.1; ENST00000555082.5
External Link RMBase: m6A_site_250340
mod ID: M6ASITE019909 Click to Show/Hide the Full List
mod site chr14:61547876-61547877:+ [6]
Sequence CAAATAGAACCGCCTTTCAGACCCAGAATCGTAAGTGTCCC
Motif Score 2.876744048
Cell/Tissue List CD34; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556245.1; ENST00000332981.10; ENST00000536400.5; ENST00000555082.5; ENST00000555382.5; ENST00000556347.1; ENST00000557599.5
External Link RMBase: m6A_site_250341
mod ID: M6ASITE019910 Click to Show/Hide the Full List
mod site chr14:61549761-61549762:+ [6]
Sequence TTAACTCCAATTGATGAGGGACATCTTCCAATGATTAACCA
Motif Score 3.643047619
Cell/Tissue List CD34; HEK293T; hESC-HEK293T; A549; LCLs; CD8T; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000332981.10; ENST00000555082.5; ENST00000557599.5; ENST00000556245.1; ENST00000556347.1; ENST00000536400.5
External Link RMBase: m6A_site_250342
mod ID: M6ASITE019911 Click to Show/Hide the Full List
mod site chr14:61549796-61549797:+ [6]
Sequence TAACCAGGATGAGTTTAGAAACTTTTCCTATGTGTCTCCAG
Motif Score 2.627720238
Cell/Tissue List CD34; HEK293T; U2OS; A549; GM12878; LCLs; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556347.1; ENST00000555082.5; ENST00000536400.5; ENST00000556245.1; ENST00000557599.5; ENST00000332981.10
External Link RMBase: m6A_site_250343
mod ID: M6ASITE019912 Click to Show/Hide the Full List
mod site chr14:61549862-61549863:+ [8]
Sequence GTGAGAGAGAGGGCACGAGAACCCAAAGGGAATAGAGATTC
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HEK293T; A549; U2OS; GM12878; LCLs; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000536400.5; ENST00000555082.5; ENST00000556347.1; ENST00000556245.1; ENST00000332981.10
External Link RMBase: m6A_site_250344
mod ID: M6ASITE019913 Click to Show/Hide the Full List
mod site chr14:61549904-61549905:+ [8]
Sequence CCAGGAATTTCCTCTATGGGACCTTCCCAGCATCAGCCTTA
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; HEK293T; A549; U2OS; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000332981.10; ENST00000555082.5; ENST00000536400.5; ENST00000556245.1; ENST00000556347.1
External Link RMBase: m6A_site_250345
mod ID: M6ASITE019914 Click to Show/Hide the Full List
mod site chr14:61549927-61549928:+ [8]
Sequence TTCCCAGCATCAGCCTTAGAACAAGAACCTTACCTTCAAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HEK293T; A549; hESC-HEK293T; U2OS; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000332981.10; ENST00000556245.1; ENST00000556347.1; ENST00000536400.5; ENST00000555082.5
External Link RMBase: m6A_site_250346
mod ID: M6ASITE019915 Click to Show/Hide the Full List
mod site chr14:61549933-61549934:+ [8]
Sequence GCATCAGCCTTAGAACAAGAACCTTACCTTCAAGGAGCAAG
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HEK293T; A549; U2OS; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000536400.5; ENST00000556245.1; ENST00000332981.10; ENST00000555082.5; ENST00000556347.1
External Link RMBase: m6A_site_250347
mod ID: M6ASITE019916 Click to Show/Hide the Full List
mod site chr14:61549960-61549961:+ [8]
Sequence CTTCAAGGAGCAAGTGAAGAACTCTGTGAAGGATGGAACTT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HEK293T; A549; U2OS; H1A; H1B; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000556347.1; ENST00000556245.1; ENST00000332981.10; ENST00000555082.5
External Link RMBase: m6A_site_250348
mod ID: M6ASITE019917 Click to Show/Hide the Full List
mod site chr14:61549977-61549978:+ [8]
Sequence AGAACTCTGTGAAGGATGGAACTTTCAGATATCAACTATTT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HEK293T; A549; U2OS; H1A; H1B; GM12878; LCLs; CD8T; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000555082.5; ENST00000556245.1; ENST00000556347.1; ENST00000332981.10
External Link RMBase: m6A_site_250349
mod ID: M6ASITE019918 Click to Show/Hide the Full List
mod site chr14:61550188-61550189:+ [6]
Sequence CAGGCTTCTTAATTCAAGAGACAAACCAAGACGTTCTGTCA
Motif Score 2.897386905
Cell/Tissue List CD34; HEK293T; A549; hESC-HEK293T; U2OS; GM12878; LCLs; CD8T; MSC; TIME; iSLK
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000556245.1; ENST00000332981.10; ENST00000556347.1; ENST00000555082.5
External Link RMBase: m6A_site_250350
mod ID: M6ASITE019919 Click to Show/Hide the Full List
mod site chr14:61550239-61550240:+ [6]
Sequence GCTCTTCTTTAAGCCAATGAACCCCAATTCCTGGCAGTCTA
Motif Score 2.930744048
Cell/Tissue List CD34; HEK293T; U2OS; GM12878; LCLs; CD8T; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000332981.10; ENST00000556347.1; ENST00000556245.1; ENST00000555082.5
External Link RMBase: m6A_site_250351
mod ID: M6ASITE019920 Click to Show/Hide the Full List
mod site chr14:61550259-61550260:+ [5]
Sequence ACCCCAATTCCTGGCAGTCTACAAGAAGTCTCTTAATGCTA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000556245.1; ENST00000555082.5; ENST00000332981.10; ENST00000556347.1
External Link RMBase: m6A_site_250352
mod ID: M6ASITE019921 Click to Show/Hide the Full List
mod site chr14:61550348-61550349:+ [6]
Sequence GAATGATTTACTCTGAAGAAACAAACAATGGTATCTCTGAA
Motif Score 2.20572619
Cell/Tissue List CD34; HEK293T; hESC-HEK293T; U2OS; GM12878; LCLs; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000332981.10; ENST00000556347.1; ENST00000555082.5; ENST00000556245.1
External Link RMBase: m6A_site_250353
mod ID: M6ASITE019922 Click to Show/Hide the Full List
mod site chr14:61550352-61550353:+ [5]
Sequence GATTTACTCTGAAGAAACAAACAATGGTATCTCTGAAACTC
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000555082.5; ENST00000556245.1; ENST00000556347.1; ENST00000332981.10
External Link RMBase: m6A_site_250354
mod ID: M6ASITE019923 Click to Show/Hide the Full List
mod site chr14:61550369-61550370:+ [6]
Sequence CAAACAATGGTATCTCTGAAACTCACAACCTAAAGCCCAAT
Motif Score 2.627720238
Cell/Tissue List CD34; HEK293T; U2OS; GM12878; LCLs; CD8T; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000556347.1; ENST00000556245.1; ENST00000332981.10; ENST00000555082.5
External Link RMBase: m6A_site_250355
mod ID: M6ASITE019924 Click to Show/Hide the Full List
mod site chr14:61550469-61550470:+ [9]
Sequence CTTTAATAGATATTTATTAAACTGTCCAGTGAAAAGGTGCC
Motif Score 2.627720238
Cell/Tissue List HEK293T; GM12878; LCLs; CD8T; TIME
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000332981.10; ENST00000556245.1; ENST00000555082.5; ENST00000556347.1
External Link RMBase: m6A_site_250356
mod ID: M6ASITE019925 Click to Show/Hide the Full List
mod site chr14:61550490-61550491:+ [5]
Sequence CTGTCCAGTGAAAAGGTGCCACAATGCCCAGTATTGTAAAC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000556347.1; ENST00000332981.10; ENST00000556245.1; ENST00000555082.5
External Link RMBase: m6A_site_250357
mod ID: M6ASITE019926 Click to Show/Hide the Full List
mod site chr14:61550509-61550510:+ [9]
Sequence CACAATGCCCAGTATTGTAAACAACAGGTTTGCATTCATGA
Motif Score 2.20572619
Cell/Tissue List HEK293T; GM12878; LCLs; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000556245.1; ENST00000556347.1; ENST00000332981.10; ENST00000555082.5
External Link RMBase: m6A_site_250358
Pseudouridine (Pseudo)
In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000049 Click to Show/Hide the Full List
mod site chr14:61367376-61367377:+ [10]
Sequence TGTATGTGTGTGTGTGTGTGTGTGTGTGTCAGAGGTCAGCC
Transcript ID List ENST00000555542.5; ENST00000553830.1; ENST00000555906.5; ENST00000555185.5; ENST00000332981.10; ENST00000553726.5; ENST00000553831.5; ENST00000553265.5; ENST00000556164.5; rmsk_4190826; ENST00000555082.5; ENST00000556778.5
External Link RMBase: Pseudo_site_1491