m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00620)
Target Name Platelet-derived growth factor receptor alpha (PDGFRA)
Synonyms
PDGF-R-alpha; PDGFR-alpha; Alpha platelet-derived growth factor receptor; Alpha-type platelet-derived growth factor receptor; CD140 antigen-like family member A; CD140a antigen; Platelet-derived growth factor alpha receptor; Platelet-derived growth factor receptor 2; PDGFR-2; CD140a
    Click to Show/Hide
Gene Name PDGFRA
Chromosomal Location 4q12
Family Protein kinase superfamily, Tyr protein kinase family, CSF-1/PDGF receptor subfamily
Function
Tyrosine-protein kinase that acts as a cell-surface receptor for PDGFA, PDGFB and PDGFC and plays an essential role in the regulation of embryonic development, cell proliferation, survival and chemotaxis. Depending on the context, promotes or inhibits cell proliferation and cell migration. Plays an important role in the differentiation of bone marrow-derived mesenchymal stem cells. Required for normal skeleton development and cephalic closure during embryonic development. Required for normal development of the mucosa lining the gastrointestinal tract, and for recruitment of mesenchymal cells and normal development of intestinal villi. Plays a role in cell migration and chemotaxis in wound healing. Plays a role in platelet activation, secretion of agonists from platelet granules, and in thrombin-induced platelet aggregation. Binding of its cognate ligands - homodimeric PDGFA, homodimeric PDGFB, heterodimers formed by PDGFA and PDGFB or homodimeric PDGFC -leads to the activation of several signaling cascades; the response depends on the nature of the bound ligand and is modulated by the formation of heterodimers between PDGFRA and PDGFRB. Phosphorylates PIK3R1, PLCG1, and PTPN11. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate, mobilization of cytosolic Ca(2+) and the activation of protein kinase C. Phosphorylates PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, and thereby mediates activation of the AKT1 signaling pathway. Mediates activation of HRAS and of the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1. Promotes activation of STAT family members STAT1, STAT3 and STAT5A and/or STAT5B. Receptor signaling is down-regulated by protein phosphatases that dephosphorylate the receptor and its down-stream effectors, and by rapid internalization of the activated receptor.
    Click to Show/Hide
Gene ID 5156
Uniprot ID
PGFRA_HUMAN
HGNC ID
HGNC:8803
KEGG ID
hsa:5156
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PDGFRA can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
 GSE145309
Regulation
logFC: 1.93E+00
p-value: 8.84E-11
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between PDGFRA and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 4.83E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Specific depletion of METTL3 in pericytes suppressed diabetes-induced pericyte dysfunction and Microvascular complication in vivo. METTL3 overexpression impaired pericyte function by repressing PKC-Eta, FAT4, and Platelet-derived growth factor receptor alpha (PDGFRA) expression, which was mediated by YTHDF2-dependent mRNA decay.
Target Regulation Down regulation
Responsed Disease Diseases of arteries or arterioles ICD-11: BD5Y
 Disease Info 
In-vitro Model ACBRI-183 (Human retinal pericytes (ACBRI-183) was obtained from Cell Systems Corp. (CSC, USA))
In-vivo Model Mettl3 floxed mice were purchased from GemPharmatech Co. Ltd (Nanjing, China). Pdgfr-Beta-Cre mice were purchased from Beijing Biocytogen Co. Ltd (Beijing, China) generated on C57BL/6J background. Mettl3 flox/flox mice were crossed with Pdgfr-Beta-Cre mice to generate pericyte-specific Mettl3 knockout mice. All mice were bred under the specific-pathogen free condition with free access to diet and water or their nursing mothers with alternating 12/12 light-dark cycle (lights on at 08:00 and off at 20:00).
Diseases of arteries or arterioles [ICD-11: BD5Y]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Specific depletion of METTL3 in pericytes suppressed diabetes-induced pericyte dysfunction and Microvascular complication in vivo. METTL3 overexpression impaired pericyte function by repressing PKC-Eta, FAT4, and Platelet-derived growth factor receptor alpha (PDGFRA) expression, which was mediated by YTHDF2-dependent mRNA decay.
Responsed Disease Diseases of arteries or arterioles [ICD-11: BD5Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
In-vitro Model ACBRI-183 (Human retinal pericytes (ACBRI-183) was obtained from Cell Systems Corp. (CSC, USA))
In-vivo Model Mettl3 floxed mice were purchased from GemPharmatech Co. Ltd (Nanjing, China). Pdgfr-Beta-Cre mice were purchased from Beijing Biocytogen Co. Ltd (Beijing, China) generated on C57BL/6J background. Mettl3 flox/flox mice were crossed with Pdgfr-Beta-Cre mice to generate pericyte-specific Mettl3 knockout mice. All mice were bred under the specific-pathogen free condition with free access to diet and water or their nursing mothers with alternating 12/12 light-dark cycle (lights on at 08:00 and off at 20:00).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00620)
Platelet-derived growth factor receptor alpha (PDGFRA)
N6-methyladenosine (m6A)
In total 50 m6A sequence/site(s) in this target gene
mod ID: M6ASITE065726 Click to Show/Hide the Full List
mod site chr4:54229319-54229320:+ [2]
Sequence TTGGAGCTACAGGGAGAGAAACAGAGGAGGAGACTGCAAGA
Motif Score 2.20572619
Cell/Tissue List MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000512143.1; ENST00000507166.5; ENST00000257290.10; ENST00000509490.5; ENST00000508170.5; ENST00000509092.5
External Link RMBase: m6A_site_637821
mod ID: M6ASITE065727 Click to Show/Hide the Full List
mod site chr4:54229331-54229332:+ [2]
Sequence GGAGAGAAACAGAGGAGGAGACTGCAAGAGATCATTGGAGG
Motif Score 3.319380952
Cell/Tissue List MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000512143.1; ENST00000508170.5; ENST00000509092.5; ENST00000507166.5; ENST00000509490.5; ENST00000257290.10
External Link RMBase: m6A_site_637822
mod ID: M6ASITE065728 Click to Show/Hide the Full List
mod site chr4:54229383-54229384:+ [2]
Sequence CTCTTTACTCCATGTGTGGGACATTCATTGCGGAATAACAT
Motif Score 3.643047619
Cell/Tissue List MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000509490.5; ENST00000512143.1; ENST00000509092.5; ENST00000507166.5; ENST00000508170.5
External Link RMBase: m6A_site_637823
mod ID: M6ASITE065729 Click to Show/Hide the Full List
mod site chr4:54229890-54229891:+ [2]
Sequence CTCGCCTGCGGTTTGGCGGGACAGCGCTGCAGCCCATGGTG
Motif Score 3.643047619
Cell/Tissue List MSC
Seq Type List MeRIP-seq
Transcript ID List ENST00000257290.10; ENST00000512143.1; ENST00000509092.5; ENST00000508170.5; ENST00000507166.5; ENST00000503856.5; ENST00000509490.5
External Link RMBase: m6A_site_637824
mod ID: M6ASITE065730 Click to Show/Hide the Full List
mod site chr4:54272445-54272446:+ [3]
Sequence CACCATGGCTCAACTGGGGGACAGACGGTGAGGTGCACAGC
Motif Score 3.643047619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000509490.5; ENST00000257290.10; ENST00000509092.5; ENST00000507166.5
External Link RMBase: m6A_site_637825
mod ID: M6ASITE065731 Click to Show/Hide the Full List
mod site chr4:54274962-54274963:+ [4]
Sequence TGGGAGTTTCCAAGAGATGGACTAGTGCTTGGTAAGTTCCA
Motif Score 4.065041667
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000507166.5; ENST00000509092.5; ENST00000257290.10; ENST00000509490.5
External Link RMBase: m6A_site_637826
mod ID: M6ASITE065732 Click to Show/Hide the Full List
mod site chr4:54277917-54277918:+ [5]
Sequence ACGGCCAGATCCAGTGAAAAACAAGCTCTCATGTCTGAACT
Motif Score 2.20572619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000507166.5; ENST00000461294.2; ENST00000509092.5; ENST00000507536.1; ENST00000257290.10; ENST00000509490.5
External Link RMBase: m6A_site_637827
mod ID: M6ASITE065733 Click to Show/Hide the Full List
mod site chr4:54277935-54277936:+ [5]
Sequence AAACAAGCTCTCATGTCTGAACTGAAGATAATGACTCACCT
Motif Score 3.373380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000509092.5; ENST00000461294.2; ENST00000507166.5; ENST00000257290.10; ENST00000507536.1; ENST00000509490.5
External Link RMBase: m6A_site_637828
mod ID: M6ASITE065734 Click to Show/Hide the Full List
mod site chr4:54277970-54277971:+ [5]
Sequence TCACCTGGGGCCACATTTGAACATTGTAAACTTGCTGGGAG
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000507536.1; ENST00000507166.5; ENST00000257290.10; ENST00000509092.5; ENST00000509490.5; ENST00000461294.2
External Link RMBase: m6A_site_637829
mod ID: M6ASITE065735 Click to Show/Hide the Full List
mod site chr4:54277979-54277980:+ [5]
Sequence GCCACATTTGAACATTGTAAACTTGCTGGGAGCCTGCACCA
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000507166.5; ENST00000257290.10; ENST00000509490.5; ENST00000461294.2; ENST00000509092.5; ENST00000507536.1
External Link RMBase: m6A_site_637830
mod ID: M6ASITE065736 Click to Show/Hide the Full List
mod site chr4:54281729-54281730:+ [6]
Sequence AGCTACTCTTCACTTGCTGAACATTTTCAAAAAGAATTGAG
Motif Score 2.951386905
Cell/Tissue List fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5; ENST00000507536.1; ENST00000509490.5
External Link RMBase: m6A_site_637831
mod ID: M6ASITE065737 Click to Show/Hide the Full List
mod site chr4:54281751-54281752:+ [6]
Sequence ATTTTCAAAAAGAATTGAGAACTTCTGGATTAAATTGCCTT
Motif Score 3.373380952
Cell/Tissue List fibroblasts; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000507536.1; ENST00000509490.5; ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637832
mod ID: M6ASITE065738 Click to Show/Hide the Full List
mod site chr4:54281783-54281784:+ [7]
Sequence AATTGCCTTCTTCCTCGAAAACCCTGGGACCCTTCCAGATG
Motif Score 2.185083333
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000507166.5; ENST00000509490.5; ENST00000257290.10; ENST00000507536.1
External Link RMBase: m6A_site_637833
mod ID: M6ASITE065739 Click to Show/Hide the Full List
mod site chr4:54281791-54281792:+ [7]
Sequence TCTTCCTCGAAAACCCTGGGACCCTTCCAGATGGGACTAAC
Motif Score 3.622404762
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000509490.5; ENST00000507536.1; ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637834
mod ID: M6ASITE065740 Click to Show/Hide the Full List
mod site chr4:54281806-54281807:+ [7]
Sequence CTGGGACCCTTCCAGATGGGACTAACTGGGGAAAGTGGACA
Motif Score 4.065041667
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000257290.10; ENST00000509490.5; ENST00000507166.5; ENST00000507536.1
External Link RMBase: m6A_site_637835
mod ID: M6ASITE065741 Click to Show/Hide the Full List
mod site chr4:54281824-54281825:+ [7]
Sequence GGACTAACTGGGGAAAGTGGACAAGTTACAAACAAAGAAAC
Motif Score 3.643047619
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000507536.1; ENST00000507166.5; ENST00000509490.5; ENST00000257290.10
External Link RMBase: m6A_site_637836
mod ID: M6ASITE065742 Click to Show/Hide the Full List
mod site chr4:54281835-54281836:+ [7]
Sequence GGAAAGTGGACAAGTTACAAACAAAGAAACTCAAAGGAAAG
Motif Score 2.20572619
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000509490.5; ENST00000257290.10; ENST00000507536.1; ENST00000507166.5
External Link RMBase: m6A_site_637837
mod ID: M6ASITE065743 Click to Show/Hide the Full List
mod site chr4:54281843-54281844:+ [7]
Sequence GACAAGTTACAAACAAAGAAACTCAAAGGAAAGTCATTGGC
Motif Score 2.627720238
Cell/Tissue List H1B; H1A; fibroblasts; Huh7; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000509490.5; ENST00000507536.1; ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637838
mod ID: M6ASITE065744 Click to Show/Hide the Full List
mod site chr4:54281974-54281975:+ [4]
Sequence AAATAAAGCAATTCACAGAAACTACTTTTTCATGTAGCTTG
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000509490.5; ENST00000507536.1; ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637839
mod ID: M6ASITE065745 Click to Show/Hide the Full List
mod site chr4:54285385-54285386:+ [4]
Sequence TGCAGACTCAGAAGTCAAAAACCTCCTTTCAGATGATAACT
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637840
mod ID: M6ASITE065746 Click to Show/Hide the Full List
mod site chr4:54289101-54289102:+ [8]
Sequence GTGGAGAATCTGCTGCCTGGACAATATAAAAAGGTGTGTTT
Motif Score 3.643047619
Cell/Tissue List U2OS; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637841
mod ID: M6ASITE065747 Click to Show/Hide the Full List
mod site chr4:54290334-54290335:+ [8]
Sequence TTATGAAAAAATTCACCTGGACTTCCTGAAGAGTGACCATC
Motif Score 4.065041667
Cell/Tissue List U2OS; MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637842
mod ID: M6ASITE065748 Click to Show/Hide the Full List
mod site chr4:54290379-54290380:+ [8]
Sequence TGTGGCACGCATGCGTGTGGACTCAGACAATGCATACATTG
Motif Score 4.065041667
Cell/Tissue List U2OS; H1A; H1B; GSC-11; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637843
mod ID: M6ASITE065749 Click to Show/Hide the Full List
mod site chr4:54290385-54290386:+ [8]
Sequence ACGCATGCGTGTGGACTCAGACAATGCATACATTGGTGTCA
Motif Score 2.897386905
Cell/Tissue List U2OS; H1A; H1B; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637844
mod ID: M6ASITE065750 Click to Show/Hide the Full List
mod site chr4:54290424-54290425:+ [8]
Sequence CACCTACAAAAACGAGGAAGACAAGCTGAAGGACTGGGAGG
Motif Score 2.897386905
Cell/Tissue List U2OS; H1A; H1B; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637845
mod ID: M6ASITE065751 Click to Show/Hide the Full List
mod site chr4:54290436-54290437:+ [8]
Sequence CGAGGAAGACAAGCTGAAGGACTGGGAGGGTGGTCTGGATG
Motif Score 4.065041667
Cell/Tissue List U2OS; H1A; H1B; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637846
mod ID: M6ASITE065752 Click to Show/Hide the Full List
mod site chr4:54290464-54290465:+ [8]
Sequence GGTGGTCTGGATGAGCAGAGACTGAGCGCTGACAGTGGCTA
Motif Score 3.319380952
Cell/Tissue List U2OS; H1A; H1B; hNPCs; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637847
mod ID: M6ASITE065753 Click to Show/Hide the Full List
mod site chr4:54290529-54290530:+ [8]
Sequence CCCTGTCCCTGAGGAGGAGGACCTGGGCAAGAGGAACAGAC
Motif Score 3.622404762
Cell/Tissue List U2OS; H1A; H1B; hNPCs; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637848
mod ID: M6ASITE065754 Click to Show/Hide the Full List
mod site chr4:54290544-54290545:+ [8]
Sequence GGAGGACCTGGGCAAGAGGAACAGACACAGGTAGCTGTGGG
Motif Score 2.951386905
Cell/Tissue List U2OS; H1A; H1B; hNPCs; Huh7; GSC-11; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637849
mod ID: M6ASITE065755 Click to Show/Hide the Full List
mod site chr4:54295131-54295132:+ [8]
Sequence CTCCCTCCTCCAGCTCGCAGACCTCTGAAGAGAGTGCCATT
Motif Score 2.876744048
Cell/Tissue List U2OS; H1A; H1B; Huh7; GSC-11; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637850
mod ID: M6ASITE065756 Click to Show/Hide the Full List
mod site chr4:54295197-54295198:+ [8]
Sequence TCATCAAGAGAGAGGACGAGACCATTGAAGACATCGACATG
Motif Score 2.876744048
Cell/Tissue List U2OS; H1B; Huh7; GSC-11; HEK293T; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637851
mod ID: M6ASITE065757 Click to Show/Hide the Full List
mod site chr4:54295207-54295208:+ [8]
Sequence AGAGGACGAGACCATTGAAGACATCGACATGATGGATGACA
Motif Score 2.897386905
Cell/Tissue List U2OS; H1B; Huh7; GSC-11; HEK293T; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637852
mod ID: M6ASITE065758 Click to Show/Hide the Full List
mod site chr4:54295237-54295238:+ [8]
Sequence GATGGATGACATCGGCATAGACTCTTCAGACCTGGTGGAAG
Motif Score 3.319380952
Cell/Tissue List U2OS; H1B; Huh7; GSC-11; HEK293T; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637853
mod ID: M6ASITE065759 Click to Show/Hide the Full List
mod site chr4:54295246-54295247:+ [8]
Sequence CATCGGCATAGACTCTTCAGACCTGGTGGAAGACAGCTTCC
Motif Score 2.876744048
Cell/Tissue List U2OS; H1B; Huh7; GSC-11; HEK293T; MSC; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10; ENST00000507166.5
External Link RMBase: m6A_site_637854
mod ID: M6ASITE065760 Click to Show/Hide the Full List
mod site chr4:54295258-54295259:+ [3]
Sequence CTCTTCAGACCTGGTGGAAGACAGCTTCCTGTAACTGGCGG
Motif Score 2.897386905
Cell/Tissue List brain; liver; U2OS; H1B; Huh7; GSC-11; HEK293T; MSC; endometrial; GSCs
Seq Type List m6A-REF-seq; MeRIP-seq; m6A-seq
Transcript ID List ENST00000507166.5; ENST00000257290.10
External Link RMBase: m6A_site_637855
mod ID: M6ASITE065761 Click to Show/Hide the Full List
mod site chr4:54295331-54295332:+ [8]
Sequence CTCTGGATCCCGTTCAGAAAACCACTTTATTGCAATGCAGA
Motif Score 2.185083333
Cell/Tissue List U2OS; H1B; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637856
mod ID: M6ASITE065762 Click to Show/Hide the Full List
mod site chr4:54295365-54295366:+ [8]
Sequence ATGCAGAGGTTGAGAGGAGGACTTGGTTGATGTTTAAAGAG
Motif Score 4.065041667
Cell/Tissue List U2OS; H1B; fibroblasts; Huh7; GSC-11; MSC; TREX; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637857
mod ID: M6ASITE065763 Click to Show/Hide the Full List
mod site chr4:54295450-54295451:+ [8]
Sequence AATGGGATATTTTGAAATGAACTTTGTCAGTGTTGCCTCTT
Motif Score 3.373380952
Cell/Tissue List HEK293T; U2OS; fibroblasts; Huh7; GSC-11; MSC; TREX; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637858
mod ID: M6ASITE065764 Click to Show/Hide the Full List
mod site chr4:54295550-54295551:+ [8]
Sequence TAATAGGCCACAGAAGGTGAACTTTGTGCTTCAAGGACATT
Motif Score 3.373380952
Cell/Tissue List U2OS; hNPCs; fibroblasts; Huh7; GSC-11; MSC; TREX; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637859
mod ID: M6ASITE065765 Click to Show/Hide the Full List
mod site chr4:54295566-54295567:+ [8]
Sequence GTGAACTTTGTGCTTCAAGGACATTGGTGAGAGTCCAACAG
Motif Score 3.643047619
Cell/Tissue List U2OS; hNPCs; fibroblasts; Huh7; GSC-11; MSC; TREX; endometrial; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637860
mod ID: M6ASITE065766 Click to Show/Hide the Full List
mod site chr4:54295587-54295588:+ [8]
Sequence CATTGGTGAGAGTCCAACAGACACAATTTATACTGCGACAG
Motif Score 2.897386905
Cell/Tissue List U2OS; fibroblasts; Huh7; GSC-11; MSC; TREX; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637861
mod ID: M6ASITE065767 Click to Show/Hide the Full List
mod site chr4:54295609-54295610:+ [8]
Sequence ACAATTTATACTGCGACAGAACTTCAGCATTGTAATTATGT
Motif Score 3.373380952
Cell/Tissue List U2OS; fibroblasts; Huh7; GSC-11; MSC; TREX; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637862
mod ID: M6ASITE065768 Click to Show/Hide the Full List
mod site chr4:54295681-54295682:+ [8]
Sequence GTATTAACTATCTTCTTTGGACTTCTGAAGAGACCACTCAA
Motif Score 4.065041667
Cell/Tissue List U2OS; fibroblasts; Huh7; HEK293A-TOA; MSC; TREX; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637863
mod ID: M6ASITE065769 Click to Show/Hide the Full List
mod site chr4:54295693-54295694:+ [8]
Sequence TTCTTTGGACTTCTGAAGAGACCACTCAATCCATCCATGTA
Motif Score 2.876744048
Cell/Tissue List U2OS; fibroblasts; Huh7; HEK293A-TOA; MSC; TREX; GSCs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637864
mod ID: M6ASITE065770 Click to Show/Hide the Full List
mod site chr4:54295727-54295728:+ [8]
Sequence CCATGTACTTCCCTCTTGAAACCTGATGTCAGCTGCTGTTG
Motif Score 2.185083333
Cell/Tissue List U2OS; fibroblasts; Huh7; HEK293A-TOA; MSC; TREX
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637865
mod ID: M6ASITE065771 Click to Show/Hide the Full List
mod site chr4:54295749-54295750:+ [8]
Sequence CTGATGTCAGCTGCTGTTGAACTTTTTAAAGAAGTGCATGA
Motif Score 3.373380952
Cell/Tissue List U2OS; fibroblasts; Huh7; MSC; TREX
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637866
mod ID: M6ASITE065772 Click to Show/Hide the Full List
mod site chr4:54295773-54295774:+ [8]
Sequence TTTAAAGAAGTGCATGAAAAACCATTTTTGAACCTTAAAAG
Motif Score 2.185083333
Cell/Tissue List U2OS; fibroblasts; Huh7; MSC; TREX
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637867
mod ID: M6ASITE065773 Click to Show/Hide the Full List
mod site chr4:54295784-54295785:+ [8]
Sequence GCATGAAAAACCATTTTTGAACCTTAAAAGGTACTGGTACT
Motif Score 2.930744048
Cell/Tissue List U2OS; fibroblasts; Huh7; MSC; TREX
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637868
mod ID: M6ASITE065774 Click to Show/Hide the Full List
mod site chr4:54297475-54297476:+ [3]
Sequence ACGTTTGTGTTTCTAGAATCACAGCTCAAGCATTCTGTTTA
Motif Score 2.047297619
Cell/Tissue List brain; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637869
mod ID: M6ASITE065775 Click to Show/Hide the Full List
mod site chr4:54298096-54298097:+ [3]
Sequence GATACTTACATGTTCCCAAAACAATGGTGTGGTGAATGTGT
Motif Score 2.20572619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000257290.10
External Link RMBase: m6A_site_637870