m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00603)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HOXA1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Protein virilizer homolog (VIRMA) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| Responsed Drug | Gefitinib | Approved | ||
| In-vitro Model | Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line) | |||
| PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 | |
| NHBE (Normal bronchial epithelial cells) | ||||
| In-vivo Model | PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice. | |||
Lung cancer [ICD-11: 2C25]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC. | |||
| Responsed Disease | Non-small-cell lung carcinoma [ICD-11: 2C25.Y] | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Gefitinib | Approved | ||
| In-vitro Model | Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line) | |||
| PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 | |
| NHBE (Normal bronchial epithelial cells) | ||||
| In-vivo Model | PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice. | |||
Gefitinib
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC. | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Non-small-cell lung carcinoma | ICD-11: 2C25.Y | ||
| In-vitro Model | Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line) | |||
| PC-9 | Lung adenocarcinoma | Homo sapiens | CVCL_B260 | |
| NHBE (Normal bronchial epithelial cells) | ||||
| In-vivo Model | PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00603)
| In total 27 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE079300 | Click to Show/Hide the Full List | ||
| mod site | chr7:27093458-27093459:- | [2] | |
| Sequence | TTTGATGTCCCCAAAGTACCACACTGAGTTCTATCAGTTAT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000343060.4; ENST00000643460.1 | ||
| External Link | RMBase: m6A_site_751186 | ||
| mod ID: M6ASITE079301 | Click to Show/Hide the Full List | ||
| mod site | chr7:27093484-27093485:- | [2] | |
| Sequence | AATAGTCTTTTGCATGTCGCACAATGTTTGATGTCCCCAAA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751187 | ||
| mod ID: M6ASITE079302 | Click to Show/Hide the Full List | ||
| mod site | chr7:27093534-27093535:- | [2] | |
| Sequence | TTGTTAATGTGATGGATGGCACAATGAATGTATATTTTGTG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751188 | ||
| mod ID: M6ASITE079303 | Click to Show/Hide the Full List | ||
| mod site | chr7:27093795-27093796:- | [3] | |
| Sequence | GAAAAAATTCCCTCATTTAAACCCAATCAGATGCCTCAGAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751189 | ||
| mod ID: M6ASITE079305 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094113-27094114:- | [3] | |
| Sequence | AGTTCCCTTTGCCAACAGAAACATGCCAGAAGGAATCTTCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751190 | ||
| mod ID: M6ASITE079306 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094168-27094169:- | [3] | |
| Sequence | CTTTTAGGAGAATTCACAGAACCTACTGTTCCTTTCAGATG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; Huh7; iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751191 | ||
| mod ID: M6ASITE079307 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094249-27094250:- | [2] | |
| Sequence | AGAGACTTGGTGCGGGGTTAACACCTTCATCCAGATTGGGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000343060.4; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751192 | ||
| mod ID: M6ASITE079308 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094265-27094266:- | [4] | |
| Sequence | CAGATAATTCTGGACCAGAGACTTGGTGCGGGGTTAACACC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; Huh7; HEK293A-TOA; MSC; TIME; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751193 | ||
| mod ID: M6ASITE079309 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094272-27094273:- | [4] | |
| Sequence | ATATTTGCAGATAATTCTGGACCAGAGACTTGGTGCGGGGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; Huh7; HEK293A-TOA; MSC; TIME; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000643460.1; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751194 | ||
| mod ID: M6ASITE079310 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094391-27094392:- | [5] | |
| Sequence | AGGCATCTCCTTGGGCTGGGACTTCTTACCCAAAGCACATG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751195 | ||
| mod ID: M6ASITE079311 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094421-27094422:- | [5] | |
| Sequence | TGAGGCGGCTCCAGCCCCAGACAACAGCCCAGGCATCTCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751196 | ||
| mod ID: M6ASITE079312 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094461-27094462:- | [5] | |
| Sequence | CCCGGGGTCTTCTACCTCAGACACTCTGACTACCTCCCACT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000643460.1; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751197 | ||
| mod ID: M6ASITE079313 | Click to Show/Hide the Full List | ||
| mod site | chr7:27094695-27094696:- | [2] | |
| Sequence | GGAGAAGGAGTTCCACTTCAACAAGTACCTGACGCGCGCCC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000343060.4; ENST00000643460.1 | ||
| External Link | RMBase: m6A_site_751198 | ||
| mod ID: M6ASITE079314 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095263-27095264:- | ||
| Sequence | TCAAAAGAAACCCTCCCAAAACAGGTCAGTCCTGCTGGTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000355633.5; ENST00000643460.1 | ||
| External Link | RMBase: m6A_site_751199 | ||
| mod ID: M6ASITE079316 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095274-27095275:- | ||
| Sequence | CTGGATGAAAGTCAAAAGAAACCCTCCCAAAACAGGTCAGT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000355633.5; ENST00000643460.1 | ||
| External Link | RMBase: m6A_site_751200 | ||
| mod ID: M6ASITE079317 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095302-27095303:- | [3] | |
| Sequence | AGACATCTTCTCCAGCGCAGACTTTTGACTGGATGAAAGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000343060.4; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751201 | ||
| mod ID: M6ASITE079318 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095320-27095321:- | [3] | |
| Sequence | GTCGCTCCCCCGCATCGGAGACATCTTCTCCAGCGCAGACT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751202 | ||
| mod ID: M6ASITE079319 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095417-27095418:- | [6] | |
| Sequence | TACATTCACCACTCATATGGACAGGAGCACCAGAGCCTGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; Huh7; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000343060.4; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751203 | ||
| mod ID: M6ASITE079320 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095604-27095605:- | [6] | |
| Sequence | TCCAAGCTATGGCTCACAGAACTTCAGTGCGCCTTACAGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000643460.1; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751204 | ||
| mod ID: M6ASITE079321 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095658-27095659:- | [6] | |
| Sequence | TACCTACCAGACTTCCGGGAACCTGGGGGTGTCCTACTCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751205 | ||
| mod ID: M6ASITE079322 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095668-27095669:- | [6] | |
| Sequence | CCCAGCCGGCTACCTACCAGACTTCCGGGAACCTGGGGGTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; A549; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000343060.4; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751206 | ||
| mod ID: M6ASITE079323 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095809-27095810:- | [2] | |
| Sequence | ACCCCTCGGACCATAGGATTACAACTTTCCAGTCGTGCGCG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000343060.4; ENST00000355633.5; ENST00000643460.1 | ||
| External Link | RMBase: m6A_site_751207 | ||
| mod ID: M6ASITE079324 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095820-27095821:- | [7] | |
| Sequence | AGCCCGAGCCTACCCCTCGGACCATAGGATTACAACTTTCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; HeLa; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000355633.5; ENST00000643460.1; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751208 | ||
| mod ID: M6ASITE079325 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095848-27095849:- | [5] | |
| Sequence | TTAGCAGTGGCGACTCGGGGACCTGCTCAGCCCGAGCCTAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000343060.4; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751209 | ||
| mod ID: M6ASITE079327 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095892-27095893:- | [5] | |
| Sequence | GATGGACAATGCAAGAATGAACTCCTTCCTGGAATACCCCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751210 | ||
| mod ID: M6ASITE079328 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095907-27095908:- | [5] | |
| Sequence | GGTCACTCAGTGACAGATGGACAATGCAAGAATGAACTCCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000643460.1; ENST00000355633.5; ENST00000343060.4 | ||
| External Link | RMBase: m6A_site_751211 | ||
| mod ID: M6ASITE079329 | Click to Show/Hide the Full List | ||
| mod site | chr7:27095931-27095932:- | [5] | |
| Sequence | GTCACGCCGGGCTTCGCAGGACCAGGTCACTCAGTGACAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000343060.4; ENST00000643460.1; ENST00000355633.5 | ||
| External Link | RMBase: m6A_site_751212 | ||
References