General Information of the m6A Target Gene (ID: M6ATAR00603)
Target Name Homeobox protein Hox-A1 (HOXA1)
Synonyms
Homeobox protein Hox-1F
    Click to Show/Hide
Gene Name HOXA1
Chromosomal Location 7p15.2
Family Antp homeobox family, Labial subfamily
Function
Sequence-specific transcription factor (By similarity). Regulates multiple developmental processes including brainstem, inner and outer ear, abducens nerve and cardiovascular development and morphogenesis as well as cognition and behavior. Also part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis. Acts on the anterior body structures. Seems to act in the maintenance and/or generation of hindbrain segments (By similarity). Activates transcription in the presence of PBX1A and PKNOX1 (By similarity).
    Click to Show/Hide
Gene ID 3198
Uniprot ID
HXA1_HUMAN
HGNC ID
HGNC:5099
KEGG ID
hsa:3198
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HOXA1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Protein virilizer homolog (VIRMA) [WRITER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
Responsed Drug Gefitinib Approved
In-vitro Model Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
NHBE (Normal bronchial epithelial cells)
In-vivo Model PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Protein virilizer homolog (VIRMA) WRITER
Target Regulation Up regulation
Responsed Drug Gefitinib Approved
In-vitro Model Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
NHBE (Normal bronchial epithelial cells)
In-vivo Model PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice.
Gefitinib [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary m6A methyltransferase KIAA1429 was highly expressed in gefitinib-resistant NSCLC cells (PC9-GR), tissues, and closely related to unfavorable survival. KIAA1429 plays essential oncogenic roles in NSCLC gefitinib resistance, which provided a feasible therapeutic target for NSCLC.
Target Regulator Protein virilizer homolog (VIRMA) WRITER
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
In-vitro Model Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
NHBE (Normal bronchial epithelial cells)
In-vivo Model PC9-GR cells stably infected with KIAA1429-targeting shRNA and control were suspended in 100 uL of PBS with Matrigel matrix (BD Biosciences). Then, cells were injected into one of the flanks of BALB/c nude mice.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00603)
Homeobox protein Hox-A1 (HOXA1)
N6-methyladenosine (m6A)
In total 27 m6A sequence/site(s) in this target gene
mod ID: M6ASITE079300 Click to Show/Hide the Full List
mod site chr7:27093458-27093459:- [2]
Sequence TTTGATGTCCCCAAAGTACCACACTGAGTTCTATCAGTTAT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000355633.5; ENST00000343060.4; ENST00000643460.1
External Link RMBase: m6A_site_751186
mod ID: M6ASITE079301 Click to Show/Hide the Full List
mod site chr7:27093484-27093485:- [2]
Sequence AATAGTCTTTTGCATGTCGCACAATGTTTGATGTCCCCAAA
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751187
mod ID: M6ASITE079302 Click to Show/Hide the Full List
mod site chr7:27093534-27093535:- [2]
Sequence TTGTTAATGTGATGGATGGCACAATGAATGTATATTTTGTG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751188
mod ID: M6ASITE079303 Click to Show/Hide the Full List
mod site chr7:27093795-27093796:- [3]
Sequence GAAAAAATTCCCTCATTTAAACCCAATCAGATGCCTCAGAG
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751189
mod ID: M6ASITE079305 Click to Show/Hide the Full List
mod site chr7:27094113-27094114:- [3]
Sequence AGTTCCCTTTGCCAACAGAAACATGCCAGAAGGAATCTTCT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751190
mod ID: M6ASITE079306 Click to Show/Hide the Full List
mod site chr7:27094168-27094169:- [3]
Sequence CTTTTAGGAGAATTCACAGAACCTACTGTTCCTTTCAGATG
Motif Score 2.930744048
Cell/Tissue List HEK293T; Huh7; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751191
mod ID: M6ASITE079307 Click to Show/Hide the Full List
mod site chr7:27094249-27094250:- [2]
Sequence AGAGACTTGGTGCGGGGTTAACACCTTCATCCAGATTGGGT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000643460.1; ENST00000343060.4; ENST00000355633.5
External Link RMBase: m6A_site_751192
mod ID: M6ASITE079308 Click to Show/Hide the Full List
mod site chr7:27094265-27094266:- [4]
Sequence CAGATAATTCTGGACCAGAGACTTGGTGCGGGGTTAACACC
Motif Score 3.319380952
Cell/Tissue List HEK293T; Huh7; HEK293A-TOA; MSC; TIME; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751193
mod ID: M6ASITE079309 Click to Show/Hide the Full List
mod site chr7:27094272-27094273:- [4]
Sequence ATATTTGCAGATAATTCTGGACCAGAGACTTGGTGCGGGGT
Motif Score 3.622404762
Cell/Tissue List HEK293T; Huh7; HEK293A-TOA; MSC; TIME; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000343060.4; ENST00000643460.1; ENST00000355633.5
External Link RMBase: m6A_site_751194
mod ID: M6ASITE079310 Click to Show/Hide the Full List
mod site chr7:27094391-27094392:- [5]
Sequence AGGCATCTCCTTGGGCTGGGACTTCTTACCCAAAGCACATG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751195
mod ID: M6ASITE079311 Click to Show/Hide the Full List
mod site chr7:27094421-27094422:- [5]
Sequence TGAGGCGGCTCCAGCCCCAGACAACAGCCCAGGCATCTCCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751196
mod ID: M6ASITE079312 Click to Show/Hide the Full List
mod site chr7:27094461-27094462:- [5]
Sequence CCCGGGGTCTTCTACCTCAGACACTCTGACTACCTCCCACT
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000343060.4; ENST00000643460.1; ENST00000355633.5
External Link RMBase: m6A_site_751197
mod ID: M6ASITE079313 Click to Show/Hide the Full List
mod site chr7:27094695-27094696:- [2]
Sequence GGAGAAGGAGTTCCACTTCAACAAGTACCTGACGCGCGCCC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000355633.5; ENST00000343060.4; ENST00000643460.1
External Link RMBase: m6A_site_751198
mod ID: M6ASITE079314 Click to Show/Hide the Full List
mod site chr7:27095263-27095264:-
Sequence TCAAAAGAAACCCTCCCAAAACAGGTCAGTCCTGCTGGTTG
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000343060.4; ENST00000355633.5; ENST00000643460.1
External Link RMBase: m6A_site_751199
mod ID: M6ASITE079316 Click to Show/Hide the Full List
mod site chr7:27095274-27095275:-
Sequence CTGGATGAAAGTCAAAAGAAACCCTCCCAAAACAGGTCAGT
Motif Score 2.185083333
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000343060.4; ENST00000355633.5; ENST00000643460.1
External Link RMBase: m6A_site_751200
mod ID: M6ASITE079317 Click to Show/Hide the Full List
mod site chr7:27095302-27095303:- [3]
Sequence AGACATCTTCTCCAGCGCAGACTTTTGACTGGATGAAAGTC
Motif Score 3.319380952
Cell/Tissue List HEK293T; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000343060.4; ENST00000355633.5
External Link RMBase: m6A_site_751201
mod ID: M6ASITE079318 Click to Show/Hide the Full List
mod site chr7:27095320-27095321:- [3]
Sequence GTCGCTCCCCCGCATCGGAGACATCTTCTCCAGCGCAGACT
Motif Score 2.897386905
Cell/Tissue List HEK293T; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751202
mod ID: M6ASITE079319 Click to Show/Hide the Full List
mod site chr7:27095417-27095418:- [6]
Sequence TACATTCACCACTCATATGGACAGGAGCACCAGAGCCTGGC
Motif Score 3.643047619
Cell/Tissue List HEK293T; Huh7; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000643460.1; ENST00000343060.4; ENST00000355633.5
External Link RMBase: m6A_site_751203
mod ID: M6ASITE079320 Click to Show/Hide the Full List
mod site chr7:27095604-27095605:- [6]
Sequence TCCAAGCTATGGCTCACAGAACTTCAGTGCGCCTTACAGCC
Motif Score 3.373380952
Cell/Tissue List HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000343060.4; ENST00000643460.1; ENST00000355633.5
External Link RMBase: m6A_site_751204
mod ID: M6ASITE079321 Click to Show/Hide the Full List
mod site chr7:27095658-27095659:- [6]
Sequence TACCTACCAGACTTCCGGGAACCTGGGGGTGTCCTACTCCC
Motif Score 2.930744048
Cell/Tissue List HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751205
mod ID: M6ASITE079322 Click to Show/Hide the Full List
mod site chr7:27095668-27095669:- [6]
Sequence CCCAGCCGGCTACCTACCAGACTTCCGGGAACCTGGGGGTG
Motif Score 3.319380952
Cell/Tissue List HEK293T; A549; Huh7; HEK293A-TOA; MSC
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000643460.1; ENST00000343060.4; ENST00000355633.5
External Link RMBase: m6A_site_751206
mod ID: M6ASITE079323 Click to Show/Hide the Full List
mod site chr7:27095809-27095810:- [2]
Sequence ACCCCTCGGACCATAGGATTACAACTTTCCAGTCGTGCGCG
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000343060.4; ENST00000355633.5; ENST00000643460.1
External Link RMBase: m6A_site_751207
mod ID: M6ASITE079324 Click to Show/Hide the Full List
mod site chr7:27095820-27095821:- [7]
Sequence AGCCCGAGCCTACCCCTCGGACCATAGGATTACAACTTTCC
Motif Score 3.622404762
Cell/Tissue List HEK293T; HeLa; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000355633.5; ENST00000643460.1; ENST00000343060.4
External Link RMBase: m6A_site_751208
mod ID: M6ASITE079325 Click to Show/Hide the Full List
mod site chr7:27095848-27095849:- [5]
Sequence TTAGCAGTGGCGACTCGGGGACCTGCTCAGCCCGAGCCTAC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000343060.4; ENST00000355633.5
External Link RMBase: m6A_site_751209
mod ID: M6ASITE079327 Click to Show/Hide the Full List
mod site chr7:27095892-27095893:- [5]
Sequence GATGGACAATGCAAGAATGAACTCCTTCCTGGAATACCCCA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751210
mod ID: M6ASITE079328 Click to Show/Hide the Full List
mod site chr7:27095907-27095908:- [5]
Sequence GGTCACTCAGTGACAGATGGACAATGCAAGAATGAACTCCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000643460.1; ENST00000355633.5; ENST00000343060.4
External Link RMBase: m6A_site_751211
mod ID: M6ASITE079329 Click to Show/Hide the Full List
mod site chr7:27095931-27095932:- [5]
Sequence GTCACGCCGGGCTTCGCAGGACCAGGTCACTCAGTGACAGA
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000343060.4; ENST00000643460.1; ENST00000355633.5
External Link RMBase: m6A_site_751212