m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00593)
Target Name Heat shock factor protein 1 (HSF1)
Synonyms
HSF 1; Heat shock transcription factor 1; HSTF 1
    Click to Show/Hide
Gene Name HSF1
Chromosomal Location 8q24.3
Family HSF family
Function
Functions as a stress-inducible and DNA-binding transcription factor that plays a central role in the transcriptional activation of the heat shock response (HSR), leading to the expression of a large class of molecular chaperones heat shock proteins (HSPs) that protect cells from cellular insults' damage. In unstressed cells, is present in a HSP90-containing multichaperone complex that maintains it in a non-DNA-binding inactivated monomeric form. Upon exposure to heat and other stress stimuli, undergoes homotrimerization and activates HSP gene transcription through binding to site-specific heat shock elements (HSEs) present in the promoter regions of HSP genes. Upon heat shock stress, forms a chromatin-associated complex with TTC5/STRAP and p300/EP300 to stimulate HSR transcription, therefore increasing cell survival . Activation is reversible, and during the attenuation and recovery phase period of the HSR, returns to its unactivated form. Binds to inverted 5'-NGAAN-3' pentamer DNA sequences . Binds to chromatin at heat shock gene promoters. Plays also several other functions independently of its transcriptional activity. Involved in the repression of Ras-induced transcriptional activation of the c-fos gene in heat-stressed cells. Positively regulates pre-mRNA 3'-end processing and polyadenylation of HSP70 mRNA upon heat-stressed cells in a symplekin (SYMPK)-dependent manner . Plays a role in nuclear export of stress-induced HSP70 mRNA. Plays a role in the regulation of mitotic progression. Plays also a role as a negative regulator of non-homologous end joining (NHEJ) repair activity in a DNA damage-dependent manner. Involved in stress-induced cancer cell proliferation in a IER5-dependent manner; (Microbial infection) Plays a role in latent human immunodeficiency virus (HIV-1) transcriptional reactivation. Binds to the HIV-1 long terminal repeat promoter (LTR) to reactivate viral transcription by recruiting cellular transcriptional elongation factors, such as CDK9, CCNT1 and EP300.
    Click to Show/Hide
Gene ID 3297
Uniprot ID
HSF1_HUMAN
HGNC ID
HGNC:5224
KEGG ID
hsa:3297
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HSF1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line NB4 cell line Homo sapiens
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
 GSE103494
Regulation
logFC: -7.09E-01
p-value: 1.48E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary FTO significantly promotes MM cell proliferation, migration, and invasion by targeting Heat shock factor protein 1 (HSF1)/HSPs in a YTHDF2-dependent manner. FTO inhibition, especially when combined with bortezomib (BTZ) treatment, synergistically inhibited myeloma bone tumor formation and extramedullary spread in NCG mice.
Target Regulation Up regulation
Responsed Disease Multiple myeloma ICD-11: 2A83.1
 Disease Info 
Responsed Drug Bortezomib Approved
 Drug Info 
In-vitro Model RPMI-8226 Plasma cell myeloma Homo sapiens CVCL_0014
MM1.R Plasma cell myeloma Homo sapiens CVCL_8794
In-vivo Model A total of 3×106 RPMI8226/MM1R-Luc cells were intravenously injected into NCG mice to establish a disseminated human MM xenograft model. The in vivo antitumor effect of the FTO inhibitor MA2 combined with or without the first-line chemotherapeutic agent BTZ was evaluated as follows: 3 days post xenotransplantation, MA2 (20 mg/kg), or vehicle control was injected intraperitoneally (i.p.) daily for 10 days, and BTZ was injected intraperitoneally on days 1, 4, 8, and 11. Mouse serum was collected at specified time points during the treatment, and the tumor burden was monitored by detecting myeloma cell-secreted Lambda light chains via a Human Lambda ELISA Kit (Bethyl Laboratories, No. E88-116). Tumor development was monitored weekly after treatment with an in vivo imaging system (IVIS, SI Imaging, Lago, and LagoX). Luciferin (150 mg/kg, YEASEN, Shanghai, China) was injected intraperitoneally into the mice.
Multiple myeloma [ICD-11: 2A83]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary FTO significantly promotes MM cell proliferation, migration, and invasion by targeting Heat shock factor protein 1 (HSF1)/HSPs in a YTHDF2-dependent manner. FTO inhibition, especially when combined with bortezomib (BTZ) treatment, synergistically inhibited myeloma bone tumor formation and extramedullary spread in NCG mice.
Responsed Disease Multiple myeloma [ICD-11: 2A83.1]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Bortezomib Approved
 Drug Info 
In-vitro Model RPMI-8226 Plasma cell myeloma Homo sapiens CVCL_0014
MM1.R Plasma cell myeloma Homo sapiens CVCL_8794
In-vivo Model A total of 3×106 RPMI8226/MM1R-Luc cells were intravenously injected into NCG mice to establish a disseminated human MM xenograft model. The in vivo antitumor effect of the FTO inhibitor MA2 combined with or without the first-line chemotherapeutic agent BTZ was evaluated as follows: 3 days post xenotransplantation, MA2 (20 mg/kg), or vehicle control was injected intraperitoneally (i.p.) daily for 10 days, and BTZ was injected intraperitoneally on days 1, 4, 8, and 11. Mouse serum was collected at specified time points during the treatment, and the tumor burden was monitored by detecting myeloma cell-secreted Lambda light chains via a Human Lambda ELISA Kit (Bethyl Laboratories, No. E88-116). Tumor development was monitored weekly after treatment with an in vivo imaging system (IVIS, SI Imaging, Lago, and LagoX). Luciferin (150 mg/kg, YEASEN, Shanghai, China) was injected intraperitoneally into the mice.
Bortezomib [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary FTO significantly promotes MM cell proliferation, migration, and invasion by targeting Heat shock factor protein 1 (HSF1)/HSPs in a YTHDF2-dependent manner. FTO inhibition, especially when combined with bortezomib (BTZ) treatment, synergistically inhibited myeloma bone tumor formation and extramedullary spread in NCG mice.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Multiple myeloma ICD-11: 2A83.1
 Disease Info 
In-vitro Model RPMI-8226 Plasma cell myeloma Homo sapiens CVCL_0014
MM1.R Plasma cell myeloma Homo sapiens CVCL_8794
In-vivo Model A total of 3×106 RPMI8226/MM1R-Luc cells were intravenously injected into NCG mice to establish a disseminated human MM xenograft model. The in vivo antitumor effect of the FTO inhibitor MA2 combined with or without the first-line chemotherapeutic agent BTZ was evaluated as follows: 3 days post xenotransplantation, MA2 (20 mg/kg), or vehicle control was injected intraperitoneally (i.p.) daily for 10 days, and BTZ was injected intraperitoneally on days 1, 4, 8, and 11. Mouse serum was collected at specified time points during the treatment, and the tumor burden was monitored by detecting myeloma cell-secreted Lambda light chains via a Human Lambda ELISA Kit (Bethyl Laboratories, No. E88-116). Tumor development was monitored weekly after treatment with an in vivo imaging system (IVIS, SI Imaging, Lago, and LagoX). Luciferin (150 mg/kg, YEASEN, Shanghai, China) was injected intraperitoneally into the mice.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05277
 Crosstalk Info 
Epigenetic Regulator hsa-miR-455-3p
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00593)
Heat shock factor protein 1 (HSF1)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003065 Click to Show/Hide the Full List
mod site chr8:144292776-144292777:+ [3]
Sequence TCGAGACCAGCCCGGACAATATGGCAAAACCCCAGCTCTAC
Transcript ID List rmsk_2679014; ENST00000528838.6; ENST00000533240.5; ENST00000528988.1; ENST00000400780.8
External Link RMBase: RNA-editing_site_133851
mod ID: A2ISITE003066 Click to Show/Hide the Full List
mod site chr8:144302746-144302747:+ [3]
Sequence TGGGAGGATCTCTTGATCCCAGGAGGTAGAGGTTGCAGTGA
Transcript ID List rmsk_2679036; ENST00000528988.1; ENST00000528838.6; ENST00000533240.5; ENST00000400780.8
External Link RMBase: RNA-editing_site_133852
5-methylcytidine (m5C)
In total 9 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004370 Click to Show/Hide the Full List
mod site chr8:144291774-144291775:+ [4]
Sequence GAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528838.6; ENST00000528988.1; ENST00000400780.8
External Link RMBase: m5C_site_42148
mod ID: M5CSITE004371 Click to Show/Hide the Full List
mod site chr8:144291775-144291776:+ [4]
Sequence AGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528838.6; ENST00000528988.1; ENST00000400780.8
External Link RMBase: m5C_site_42149
mod ID: M5CSITE004372 Click to Show/Hide the Full List
mod site chr8:144291776-144291777:+ [4]
Sequence GATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528838.6; ENST00000528988.1; ENST00000400780.8
External Link RMBase: m5C_site_42150
mod ID: M5CSITE004373 Click to Show/Hide the Full List
mod site chr8:144291777-144291778:+ [4]
Sequence ATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528988.1; ENST00000400780.8; ENST00000528838.6
External Link RMBase: m5C_site_42151
mod ID: M5CSITE004374 Click to Show/Hide the Full List
mod site chr8:144291790-144291791:+ [4]
Sequence TGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000400780.8; ENST00000528838.6; ENST00000528988.1
External Link RMBase: m5C_site_42152
mod ID: M5CSITE004375 Click to Show/Hide the Full List
mod site chr8:144291791-144291792:+ [4]
Sequence GGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528988.1; ENST00000528838.6; ENST00000400780.8
External Link RMBase: m5C_site_42153
mod ID: M5CSITE004376 Click to Show/Hide the Full List
mod site chr8:144291792-144291793:+ [4]
Sequence GGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000528838.6; ENST00000400780.8; ENST00000528988.1
External Link RMBase: m5C_site_42154
mod ID: M5CSITE004377 Click to Show/Hide the Full List
mod site chr8:144312683-144312684:+
Sequence CCTCTTCCCCTGCCCCTCTTCCTCTCCGCATGGCCAAGTCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000532338.5; ENST00000528838.6; ENST00000527328.5; ENST00000614796.1; ENST00000530661.1; ENST00000400780.8
External Link RMBase: m5C_site_42155
mod ID: M5CSITE004378 Click to Show/Hide the Full List
mod site chr8:144312913-144312914:+
Sequence ATTGCCTGTGACAGGGATGACAGGGACAGGCCTCCCTGCTC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000527328.5; ENST00000528838.6; ENST00000532338.5; ENST00000530661.1; ENST00000614796.1; ENST00000400780.8
External Link RMBase: m5C_site_42156
N6-methyladenosine (m6A)
In total 29 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087363 Click to Show/Hide the Full List
mod site chr8:144291845-144291846:+ [5]
Sequence GACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000528838.6; ENST00000400780.8; ENST00000528988.1
External Link RMBase: m6A_site_813308
mod ID: M6ASITE087364 Click to Show/Hide the Full List
mod site chr8:144308912-144308913:+ [6]
Sequence GTCTCCCTTTCAGAGCGGGAACAGCTTCCACGTGTTCGACC
Motif Score 2.951386905
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000400780.8; ENST00000528838.6; ENST00000528988.1; ENST00000533240.5
External Link RMBase: m6A_site_813309
mod ID: M6ASITE087365 Click to Show/Hide the Full List
mod site chr8:144308975-144308976:+ [5]
Sequence GCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000533240.5; ENST00000528988.1; ENST00000528838.6; ENST00000400780.8
External Link RMBase: m6A_site_813310
mod ID: M6ASITE087366 Click to Show/Hide the Full List
mod site chr8:144309475-144309476:+ [6]
Sequence TGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGG
Motif Score 2.053113095
Cell/Tissue List brain; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000529630.1; ENST00000528988.1; ENST00000534314.5; ENST00000528199.5; ENST00000400780.8; ENST00000533240.5; ENST00000532338.5; ENST00000528838.6
External Link RMBase: m6A_site_813311
mod ID: M6ASITE087367 Click to Show/Hide the Full List
mod site chr8:144309514-144309515:+ [5]
Sequence GGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCAT
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000529630.1; ENST00000400780.8; ENST00000533240.5; ENST00000528838.6; ENST00000528199.5; ENST00000534314.5; ENST00000532338.5; ENST00000528988.1
External Link RMBase: m6A_site_813312
mod ID: M6ASITE087368 Click to Show/Hide the Full List
mod site chr8:144309568-144309569:+ [5]
Sequence CCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000533240.5; ENST00000534314.5; ENST00000528199.5; ENST00000529630.1; ENST00000528838.6; ENST00000528988.1; ENST00000532338.5; ENST00000400780.8
External Link RMBase: m6A_site_813313
mod ID: M6ASITE087369 Click to Show/Hide the Full List
mod site chr8:144309793-144309794:+ [5]
Sequence GTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGACA
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000533240.5; ENST00000528838.6; ENST00000529630.1; ENST00000532338.5; ENST00000400780.8; ENST00000528199.5; ENST00000534314.5
External Link RMBase: m6A_site_813314
mod ID: M6ASITE087370 Click to Show/Hide the Full List
mod site chr8:144311244-144311245:+ [5]
Sequence CCAGCAACAGAAAGTCGTCAACAAGGTGGGGGCAGGGCCAG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000534314.5; ENST00000527328.5; ENST00000400780.8; ENST00000532338.5; ENST00000531447.2; ENST00000533130.1; ENST00000528199.5; ENST00000528838.6; ENST00000533240.5
External Link RMBase: m6A_site_813315
mod ID: M6ASITE087371 Click to Show/Hide the Full List
mod site chr8:144311521-144311522:+ [6]
Sequence CAGCCCCCTGATGCTGAACGACAGTGGCTCAGCACATTCCA
Motif Score 2.865571429
Cell/Tissue List brain; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000531447.2; ENST00000533130.1; ENST00000528838.6; ENST00000400780.8; ENST00000534314.5; ENST00000527328.5; ENST00000532338.5
External Link RMBase: m6A_site_813316
mod ID: M6ASITE087372 Click to Show/Hide the Full List
mod site chr8:144311534-144311535:+ [5]
Sequence CTGAACGACAGTGGCTCAGCACATTCCATGCCCAAGTATAG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000400780.8; ENST00000533130.1; ENST00000532338.5; ENST00000528838.6; ENST00000527328.5; ENST00000534314.5; ENST00000531447.2
External Link RMBase: m6A_site_813317
mod ID: M6ASITE087373 Click to Show/Hide the Full List
mod site chr8:144311733-144311734:+ [7]
Sequence CTACAGCAGCTCCAGCCTCTACGCCCCTGATGCTGTGGCCA
Motif Score 2.05260119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000528838.6; ENST00000532338.5; ENST00000534314.5; ENST00000400780.8; ENST00000527328.5; ENST00000533130.1
External Link RMBase: m6A_site_813318
mod ID: M6ASITE087374 Click to Show/Hide the Full List
mod site chr8:144311775-144311776:+ [5]
Sequence CTCTGGACCCATCATCTCCGACATCACCGAGCTGGCTCCTG
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000533130.1; ENST00000530661.1; ENST00000528838.6; ENST00000400780.8; ENST00000534314.5; ENST00000527328.5; ENST00000532338.5
External Link RMBase: m6A_site_813319
mod ID: M6ASITE087375 Click to Show/Hide the Full List
mod site chr8:144312066-144312067:+ [5]
Sequence CGGGCGCCCATCTTCCGTGGACACCCTCTTGTCCCCGACCG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000400780.8; ENST00000527328.5; ENST00000534314.5; ENST00000532338.5; ENST00000528838.6; ENST00000530661.1
External Link RMBase: m6A_site_813320
mod ID: M6ASITE087376 Click to Show/Hide the Full List
mod site chr8:144312168-144312169:+ [5]
Sequence GGACGCCAGGGGCCACACGGACACCGAGGGCCGGCCTCCCT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000527328.5; ENST00000400780.8; ENST00000532338.5; ENST00000530661.1; ENST00000528838.6
External Link RMBase: m6A_site_813321
mod ID: M6ASITE087377 Click to Show/Hide the Full List
mod site chr8:144312240-144312241:+ [5]
Sequence CCTCAGCGTAGCCTGCCTGGACAAGTGAGTGCCGCCCACCC
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000527328.5; ENST00000530661.1; ENST00000532338.5; ENST00000528838.6; ENST00000400780.8
External Link RMBase: m6A_site_813322
mod ID: M6ASITE087378 Click to Show/Hide the Full List
mod site chr8:144313596-144313597:+ [6]
Sequence CAGCCACGGCTTCAGCGTGGACACCAGTGCCCTGCTGGACG
Motif Score 3.643047619
Cell/Tissue List HEK293; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000527328.5; ENST00000528842.1; ENST00000528838.6; ENST00000532338.5; ENST00000400780.8; ENST00000614796.1; ENST00000530661.1
External Link RMBase: m6A_site_813323
mod ID: M6ASITE087379 Click to Show/Hide the Full List
mod site chr8:144313873-144313874:+ [5]
Sequence CCCCTCGGTGACCGTGCCCGACATGAGCCTGCCTGACCTTG
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000532338.5; ENST00000528842.1; ENST00000528838.6; ENST00000530661.1; ENST00000400780.8; ENST00000527328.5; ENST00000614796.1
External Link RMBase: m6A_site_813324
mod ID: M6ASITE087380 Click to Show/Hide the Full List
mod site chr8:144314184-144314185:+ [5]
Sequence GCTGGACCCCGGCTCCGTGGACACCGGGAGCAACGACCTGC
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000528842.1; ENST00000527328.5; ENST00000614796.1; ENST00000528838.6; ENST00000532338.5; ENST00000400780.8
External Link RMBase: m6A_site_813325
mod ID: M6ASITE087381 Click to Show/Hide the Full List
mod site chr8:144314451-144314452:+ [5]
Sequence GCCGCCATAGCCCCAGTAGGACAAACGGGCTCGGGTCTGGG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000528838.6; ENST00000527328.5; ENST00000614796.1; ENST00000532338.5; ENST00000400780.8
External Link RMBase: m6A_site_813326
mod ID: M6ASITE087382 Click to Show/Hide the Full List
mod site chr8:144314561-144314562:+ [5]
Sequence TTGGTTGGGGCTTCACAGCCACACCTGGACTGACCCTGCAG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000527328.5; ENST00000532338.5; ENST00000614796.1; ENST00000400780.8; ENST00000528838.6
External Link RMBase: m6A_site_813327
mod ID: M6ASITE087383 Click to Show/Hide the Full List
mod site chr8:144314569-144314570:+ [7]
Sequence GGCTTCACAGCCACACCTGGACTGACCCTGCAGGTTGTTCA
Motif Score 4.065041667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000400780.8; ENST00000528838.6; ENST00000527328.5; ENST00000532338.5; ENST00000614796.1
External Link RMBase: m6A_site_813328
mod ID: M6ASITE087384 Click to Show/Hide the Full List
mod site chr8:144314573-144314574:+ [7]
Sequence TCACAGCCACACCTGGACTGACCCTGCAGGTTGTTCATAGT
Motif Score 2.839113095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000614796.1; ENST00000532338.5; ENST00000400780.8; ENST00000528838.6; ENST00000527328.5
External Link RMBase: m6A_site_813329
mod ID: M6ASITE087385 Click to Show/Hide the Full List
mod site chr8:144314616-144314617:+ [7]
Sequence GAATTGTATTTTGGATTTTTACACAACTGTCCCGTTCCCCG
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000527328.5; ENST00000614796.1; ENST00000528838.6; ENST00000532338.5; ENST00000400780.8
External Link RMBase: m6A_site_813330
mod ID: M6ASITE087386 Click to Show/Hide the Full List
mod site chr8:144314618-144314619:+ [7]
Sequence ATTGTATTTTGGATTTTTACACAACTGTCCCGTTCCCCGCT
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000532338.5; ENST00000400780.8; ENST00000614796.1; ENST00000527328.5; ENST00000528838.6
External Link RMBase: m6A_site_813331
mod ID: M6ASITE087387 Click to Show/Hide the Full List
mod site chr8:144314621-144314622:+ [7]
Sequence GTATTTTGGATTTTTACACAACTGTCCCGTTCCCCGCTCCA
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000614796.1; ENST00000532338.5; ENST00000400780.8; ENST00000527328.5; ENST00000528838.6
External Link RMBase: m6A_site_813332
mod ID: M6ASITE087388 Click to Show/Hide the Full List
mod site chr8:144314680-144314681:+ [5]
Sequence TACACACAGTGGATGGACGGACAAGACAGGCAGAGATCTAT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000532338.5; ENST00000527328.5; ENST00000614796.1; ENST00000528838.6
External Link RMBase: m6A_site_813333
mod ID: M6ASITE094768 Click to Show/Hide the Full List
mod site KZ208914.1:42364-42365:+ [8]
Sequence GATGCTGTGGCCAGCTCTGGACCCATCATCTCCGACATCAC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000643217.1; ENST00000644444.1; ENST00000644450.1; ENST00000646252.2; ENST00000646233.1; ENST00000643951.1
External Link RMBase: m6A_site_882248
mod ID: M6ASITE094769 Click to Show/Hide the Full List
mod site KZ208914.1:42721-42722:+ [9]
Sequence TCCATCCTGCGGGAGAGTGAACCTGCCCCCGCCTCCGTCAC
Motif Score 2.930744048
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000643217.1; ENST00000644450.1; ENST00000646252.2; ENST00000644444.1; ENST00000646970.1
External Link RMBase: m6A_site_882249
mod ID: M6ASITE094770 Click to Show/Hide the Full List
mod site KZ208914.1:42771-42772:+ [9]
Sequence GGACGCCAGGGGCCACACGGACACCGAGGGCCGGCCTCCCT
Motif Score 3.643047619
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000644444.1; ENST00000644450.1; ENST00000646970.1; ENST00000646252.2; ENST00000643217.1
External Link RMBase: m6A_site_882250