m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00592)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PPARG
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by FTO | ||
| Cell Line | NB4 cell line | Homo sapiens |
|
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
|
GSE103494 | |
| Regulation |
![]() ![]() |
logFC: 2.20E+00 p-value: 2.69E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Both depletion of FTO and application of the FTO inhibitor FB23 or FB23-2 impaired osteogenic differentiation of human MSCs. Knockdown of Peroxisome proliferator-activated receptor gamma (PPARG) promoted FTO-induced expression of the osteoblast biomarkers ALPL and OPN during osteogenic differentiation. This study demonstrates the functional significance of the FTO-PPARG axis in promoting the osteogenesis of human MSCs and sheds light on the role of m6A modification in mediating osteoporosis and osteonecrosis. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Osteoporosis | ICD-11: FB83.1 | ||
| Pathway Response | Osteoclast differentiation | hsa04380 | ||
| In-vitro Model | hMSCs (Human osteogenesis of mesenchymal stem cells (HUXMA-01001, Cyagen Biosciences, Suzhou, China)) | |||
| In-vivo Model | Conditional knockout of Fto in bone in mice was generated as previously described. Throughout the study, mice were maintained on a 12 h: 12 h light:dark cycle in a specific pathogen-free facility. | |||
Low bone mass disorder [ICD-11: FB83]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Both depletion of FTO and application of the FTO inhibitor FB23 or FB23-2 impaired osteogenic differentiation of human MSCs. Knockdown of Peroxisome proliferator-activated receptor gamma (PPARG) promoted FTO-induced expression of the osteoblast biomarkers ALPL and OPN during osteogenic differentiation. This study demonstrates the functional significance of the FTO-PPARG axis in promoting the osteogenesis of human MSCs and sheds light on the role of m6A modification in mediating osteoporosis and osteonecrosis. | |||
| Responsed Disease | Osteoporosis [ICD-11: FB83.1] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Osteoclast differentiation | hsa04380 | ||
| In-vitro Model | hMSCs (Human osteogenesis of mesenchymal stem cells (HUXMA-01001, Cyagen Biosciences, Suzhou, China)) | |||
| In-vivo Model | Conditional knockout of Fto in bone in mice was generated as previously described. Throughout the study, mice were maintained on a 12 h: 12 h light:dark cycle in a specific pathogen-free facility. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03237 | ||
| Epigenetic Regulator | Lysine-specific demethylase 3B (KDM3B) | |
| Regulated Target | Histone H3 lysine 9 dimethylation (H3K9me2) | |
| Crosstalk relationship | m6A → Histone modification | |
| Disease | Preeclampsia | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00592)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE011524 | Click to Show/Hide the Full List | ||
| mod site | chr3:12308289-12308290:+ | [3] | |
| Sequence | GGTGGTTGAGGCTACAGTGAACCATGATCACACCACTGTAC | ||
| Transcript ID List | ENST00000397026.7; ENST00000651826.1; ENST00000497594.5; ENST00000651735.1; ENST00000397010.7; ENST00000652098.1; ENST00000643197.2; rmsk_889664; ENST00000397015.7; ENST00000455517.6; ENST00000652431.1; ENST00000643888.2; ENST00000438682.6; ENST00000650761.1; ENST00000397012.7; ENST00000644622.2; ENST00000309576.11; ENST00000652522.1; ENST00000397029.8 | ||
| External Link | RMBase: RNA-editing_site_94775 | ||
| mod ID: A2ISITE011525 | Click to Show/Hide the Full List | ||
| mod site | chr3:12329055-12329056:+ | [3] | |
| Sequence | ATCCCAGCCCAGGTGGGCCAATTATTCAATTTTCAAGAATT | ||
| Transcript ID List | ENST00000651826.1; rmsk_889699; ENST00000397015.7; ENST00000643888.2; ENST00000397010.7; ENST00000651735.1; ENST00000652522.1; ENST00000644622.2; ENST00000397029.8; ENST00000455517.6; ENST00000397000.6; ENST00000309576.11; ENST00000643197.2; ENST00000438682.6; ENST00000497594.5; ENST00000397012.7; ENST00000650761.1; ENST00000652431.1; ENST00000397026.7; ENST00000652098.1 | ||
| External Link | RMBase: RNA-editing_site_94776 | ||
| mod ID: A2ISITE011526 | Click to Show/Hide the Full List | ||
| mod site | chr3:12388070-12388071:+ | [3] | |
| Sequence | GAGAAGTCAAGGAATATCATAAAATATCTATGATCACAATG | ||
| Transcript ID List | ENST00000397023.5; ENST00000287820.10; ENST00000650840.1; ENST00000650650.1; ENST00000643197.2; ENST00000652431.1; ENST00000643888.2; ENST00000397010.7; ENST00000644622.2; ENST00000397026.7; ENST00000396999.3; ENST00000497594.5; ENST00000652522.1; ENST00000397000.6; ENST00000397015.7; ENST00000309576.11; ENST00000651826.1; ENST00000477039.5; ENST00000651735.1; ENST00000397012.7; ENST00000652098.1; ENST00000650761.1 | ||
| External Link | RMBase: RNA-editing_site_94777 | ||
| mod ID: A2ISITE011527 | Click to Show/Hide the Full List | ||
| mod site | chr3:12418447-12418448:+ | [3] | |
| Sequence | GGGGGATAGTGGTAAACTGTATATAACTGCACAATGTATTA | ||
| Transcript ID List | ENST00000643197.2; ENST00000309576.11; ENST00000651735.1; ENST00000397023.5; ENST00000397015.7; ENST00000396999.3; ENST00000397026.7; ENST00000397000.6; ENST00000397012.7; ENST00000650840.1; ENST00000650761.1; ENST00000652098.1; ENST00000397010.7; ENST00000652431.1; ENST00000643888.2; ENST00000651826.1; ENST00000287820.10; ENST00000644622.2 | ||
| External Link | RMBase: RNA-editing_site_94778 | ||
N6-methyladenosine (m6A)
| In total 37 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE059564 | Click to Show/Hide the Full List | ||
| mod site | chr3:12287984-12287985:+ | [4] | |
| Sequence | CGCTTGGGTCGGCCTCGAGGACACCGGAGAGGGGCGCCACG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000643197.2; ENST00000397029.8; ENST00000397010.7; ENST00000643888.2; ENST00000309576.11; ENST00000651826.1; ENST00000397015.7; ENST00000650761.1 | ||
| External Link | RMBase: m6A_site_577271 | ||
| mod ID: M6ASITE059565 | Click to Show/Hide the Full List | ||
| mod site | chr3:12328186-12328187:+ | [5] | |
| Sequence | AGCGAAGAAAAAATTAAAGAACTAGAACAGAAAAAGTCCTA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652098.1; ENST00000455517.6; ENST00000397026.7; ENST00000652522.1; ENST00000497594.5; ENST00000652431.1; ENST00000397012.7; ENST00000651735.1; ENST00000397029.8; ENST00000309576.11; ENST00000397000.6; ENST00000419844.1; ENST00000397010.7; ENST00000650761.1; ENST00000643197.2; ENST00000438682.6; ENST00000644622.2; ENST00000651826.1; ENST00000397015.7; ENST00000643888.2 | ||
| External Link | RMBase: m6A_site_577272 | ||
| mod ID: M6ASITE059566 | Click to Show/Hide the Full List | ||
| mod site | chr3:12328192-12328193:+ | [5] | |
| Sequence | GAAAAAATTAAAGAACTAGAACAGAAAAAGTCCTACCTGGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652522.1; ENST00000651735.1; ENST00000455517.6; ENST00000643888.2; ENST00000643197.2; ENST00000397026.7; ENST00000652098.1; ENST00000397029.8; ENST00000397010.7; ENST00000652431.1; ENST00000651826.1; ENST00000497594.5; ENST00000397000.6; ENST00000419844.1; ENST00000309576.11; ENST00000438682.6; ENST00000644622.2; ENST00000650761.1; ENST00000397012.7; ENST00000397015.7 | ||
| External Link | RMBase: m6A_site_577273 | ||
| mod ID: M6ASITE059567 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379745-12379746:+ | [6] | |
| Sequence | GATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTGG | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000309576.11; ENST00000651735.1; ENST00000644622.2; ENST00000397015.7; ENST00000652431.1; ENST00000397010.7; ENST00000397029.8; ENST00000652522.1; ENST00000438682.6; ENST00000455517.6; ENST00000643197.2; ENST00000397026.7; ENST00000643888.2; ENST00000397023.5; ENST00000396999.3; ENST00000650840.1; ENST00000650761.1; ENST00000287820.10; ENST00000497594.5; ENST00000652098.1; ENST00000477039.5; ENST00000397000.6; ENST00000650650.1; ENST00000397012.7; ENST00000651826.1 | ||
| External Link | RMBase: m6A_site_577274 | ||
| mod ID: M6ASITE059568 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379784-12379785:+ | [5] | |
| Sequence | GGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000497594.5; ENST00000396999.3; ENST00000287820.10; ENST00000397026.7; ENST00000651826.1; ENST00000652431.1; ENST00000644622.2; ENST00000652522.1; ENST00000397015.7; ENST00000438682.6; ENST00000455517.6; ENST00000643888.2; ENST00000650840.1; ENST00000477039.5; ENST00000397000.6; ENST00000651735.1; ENST00000397029.8; ENST00000643197.2; ENST00000397023.5; ENST00000397012.7; ENST00000650761.1; ENST00000650650.1; ENST00000397010.7; ENST00000652098.1; ENST00000309576.11 | ||
| External Link | RMBase: m6A_site_577275 | ||
| mod ID: M6ASITE059569 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379848-12379849:+ | [7] | |
| Sequence | TTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000650761.1; ENST00000309576.11; ENST00000652522.1; ENST00000644622.2; ENST00000397015.7; ENST00000397000.6; ENST00000643197.2; ENST00000396999.3; ENST00000643888.2; ENST00000497594.5; ENST00000652098.1; ENST00000652431.1; ENST00000650650.1; ENST00000397012.7; ENST00000397029.8; ENST00000651735.1; ENST00000287820.10; ENST00000477039.5; ENST00000397026.7; ENST00000397023.5; ENST00000650840.1; ENST00000651826.1; ENST00000438682.6; ENST00000397010.7 | ||
| External Link | RMBase: m6A_site_577276 | ||
| mod ID: M6ASITE059570 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379859-12379860:+ | [5] | |
| Sequence | TTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000397015.7; ENST00000397026.7; ENST00000497594.5; ENST00000309576.11; ENST00000651735.1; ENST00000397012.7; ENST00000396999.3; ENST00000438682.6; ENST00000652522.1; ENST00000477039.5; ENST00000650840.1; ENST00000643197.2; ENST00000652098.1; ENST00000643888.2; ENST00000651826.1; ENST00000650761.1; ENST00000644622.2; ENST00000652431.1; ENST00000397029.8; ENST00000287820.10; ENST00000397010.7; ENST00000650650.1; ENST00000397000.6; ENST00000397023.5 | ||
| External Link | RMBase: m6A_site_577277 | ||
| mod ID: M6ASITE059571 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379876-12379877:+ | [5] | |
| Sequence | AAGACATTCCATTCACAAGAACAGATCCAGTGGTTGCAGAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650761.1; ENST00000652431.1; ENST00000397010.7; ENST00000652522.1; ENST00000652098.1; ENST00000397023.5; ENST00000650650.1; ENST00000397000.6; ENST00000497594.5; ENST00000651826.1; ENST00000643197.2; ENST00000644622.2; ENST00000397012.7; ENST00000651735.1; ENST00000396999.3; ENST00000650840.1; ENST00000397026.7; ENST00000643888.2; ENST00000287820.10; ENST00000397029.8; ENST00000309576.11; ENST00000477039.5; ENST00000397015.7; ENST00000438682.6 | ||
| External Link | RMBase: m6A_site_577278 | ||
| mod ID: M6ASITE059572 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379898-12379899:+ | [7] | |
| Sequence | AGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000650761.1; ENST00000397026.7; ENST00000652098.1; ENST00000497594.5; ENST00000397029.8; ENST00000651735.1; ENST00000396999.3; ENST00000652431.1; ENST00000397012.7; ENST00000477039.5; ENST00000650840.1; ENST00000644622.2; ENST00000651826.1; ENST00000650650.1; ENST00000309576.11; ENST00000652522.1; ENST00000643888.2; ENST00000287820.10; ENST00000397023.5; ENST00000397000.6; ENST00000643197.2; ENST00000438682.6; ENST00000397010.7; ENST00000397015.7 | ||
| External Link | RMBase: m6A_site_577279 | ||
| mod ID: M6ASITE059573 | Click to Show/Hide the Full List | ||
| mod site | chr3:12379914-12379915:+ | [5] | |
| Sequence | GATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000643888.2; ENST00000650761.1; ENST00000397029.8; ENST00000397012.7; ENST00000650650.1; ENST00000497594.5; ENST00000309576.11; ENST00000652522.1; ENST00000397000.6; ENST00000652431.1; ENST00000651826.1; ENST00000438682.6; ENST00000397023.5; ENST00000397015.7; ENST00000397026.7; ENST00000644622.2; ENST00000643197.2; ENST00000287820.10; ENST00000397010.7; ENST00000652098.1; ENST00000650840.1; ENST00000651735.1; ENST00000396999.3; ENST00000477039.5 | ||
| External Link | RMBase: m6A_site_577280 | ||
| mod ID: M6ASITE059574 | Click to Show/Hide the Full List | ||
| mod site | chr3:12381378-12381379:+ | [7] | |
| Sequence | TTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAAGAGC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000651826.1; ENST00000652431.1; ENST00000497594.5; ENST00000643197.2; ENST00000438682.6; ENST00000477039.5; ENST00000644622.2; ENST00000397026.7; ENST00000651735.1; ENST00000652522.1; ENST00000650840.1; ENST00000397029.8; ENST00000397023.5; ENST00000650650.1; ENST00000396999.3; ENST00000287820.10; ENST00000652098.1; ENST00000643888.2; ENST00000309576.11; ENST00000397000.6; ENST00000397012.7; ENST00000397010.7; ENST00000397015.7; ENST00000650761.1 | ||
| External Link | RMBase: m6A_site_577281 | ||
| mod ID: M6ASITE059575 | Click to Show/Hide the Full List | ||
| mod site | chr3:12392628-12392629:+ | [7] | |
| Sequence | TGCAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000397015.7; ENST00000397000.6; ENST00000651826.1; ENST00000497594.5; ENST00000397010.7; ENST00000397023.5; ENST00000287820.10; ENST00000643197.2; ENST00000652522.1; ENST00000652098.1; ENST00000650650.1; ENST00000397026.7; ENST00000396999.3; ENST00000651735.1; ENST00000652431.1; ENST00000397012.7; ENST00000644622.2; ENST00000650761.1; ENST00000477039.5; ENST00000309576.11; ENST00000643888.2; ENST00000650840.1 | ||
| External Link | RMBase: m6A_site_577282 | ||
| mod ID: M6ASITE059576 | Click to Show/Hide the Full List | ||
| mod site | chr3:12405993-12405994:+ | [7] | |
| Sequence | GACCTCCGGGCCCTGGCAAAACATTTGTATGACTCATACAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; Huh7 | ||
| Seq Type List | MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651735.1; ENST00000643197.2; ENST00000650840.1; ENST00000652431.1; ENST00000650650.1; ENST00000397010.7; ENST00000643888.2; ENST00000287820.10; ENST00000397023.5; ENST00000497594.5; ENST00000397026.7; ENST00000397015.7; ENST00000652098.1; ENST00000396999.3; ENST00000397000.6; ENST00000477039.5; ENST00000652522.1; ENST00000644622.2; ENST00000650761.1; ENST00000651826.1; ENST00000309576.11; ENST00000397012.7 | ||
| External Link | RMBase: m6A_site_577283 | ||
| mod ID: M6ASITE059577 | Click to Show/Hide the Full List | ||
| mod site | chr3:12406030-12406031:+ | [6] | |
| Sequence | ACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCG | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000651735.1; ENST00000652431.1; ENST00000397010.7; ENST00000643888.2; ENST00000650840.1; ENST00000309576.11; ENST00000497594.5; ENST00000397000.6; ENST00000651826.1; ENST00000397023.5; ENST00000652098.1; ENST00000644622.2; ENST00000477039.5; ENST00000397015.7; ENST00000652522.1; ENST00000287820.10; ENST00000397026.7; ENST00000396999.3; ENST00000650761.1; ENST00000643197.2; ENST00000397012.7; ENST00000650650.1 | ||
| External Link | RMBase: m6A_site_577284 | ||
| mod ID: M6ASITE059578 | Click to Show/Hide the Full List | ||
| mod site | chr3:12406066-12406067:+ | [8] | |
| Sequence | GGGCGATCTTGACAGGAAAGACAACAGACAAATCAGTTAGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000644622.2; ENST00000477039.5; ENST00000650761.1; ENST00000652522.1; ENST00000397015.7; ENST00000287820.10; ENST00000643888.2; ENST00000650650.1; ENST00000397010.7; ENST00000397023.5; ENST00000652098.1; ENST00000650840.1; ENST00000397026.7; ENST00000643197.2; ENST00000652431.1; ENST00000651735.1; ENST00000497594.5; ENST00000397012.7; ENST00000651826.1; ENST00000397000.6; ENST00000309576.11; ENST00000396999.3 | ||
| External Link | RMBase: m6A_site_577285 | ||
| mod ID: M6ASITE059579 | Click to Show/Hide the Full List | ||
| mod site | chr3:12406073-12406074:+ | [8] | |
| Sequence | CTTGACAGGAAAGACAACAGACAAATCAGTTAGTTCTCTTC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000644622.2; ENST00000497594.5; ENST00000652431.1; ENST00000651826.1; ENST00000652522.1; ENST00000397010.7; ENST00000287820.10; ENST00000397026.7; ENST00000397000.6; ENST00000397015.7; ENST00000397023.5; ENST00000309576.11; ENST00000643888.2; ENST00000397012.7; ENST00000477039.5; ENST00000650840.1; ENST00000651735.1; ENST00000650650.1; ENST00000652098.1; ENST00000650761.1; ENST00000643197.2; ENST00000396999.3 | ||
| External Link | RMBase: m6A_site_577286 | ||
| mod ID: M6ASITE059580 | Click to Show/Hide the Full List | ||
| mod site | chr3:12416762-12416763:+ | [9] | |
| Sequence | GAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000397026.7; ENST00000650650.1; ENST00000397023.5; ENST00000652098.1; ENST00000643888.2; ENST00000643197.2; ENST00000651826.1; ENST00000397012.7; ENST00000396999.3; ENST00000397000.6; ENST00000287820.10; ENST00000309576.11; ENST00000650761.1; ENST00000652522.1; ENST00000652431.1; ENST00000651735.1; ENST00000644622.2; ENST00000397010.7; ENST00000397015.7; ENST00000650840.1 | ||
| External Link | RMBase: m6A_site_577287 | ||
| mod ID: M6ASITE059581 | Click to Show/Hide the Full List | ||
| mod site | chr3:12416896-12416897:+ | [10] | |
| Sequence | TCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTC | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000651826.1; ENST00000644622.2; ENST00000287820.10; ENST00000652098.1; ENST00000652522.1; ENST00000650761.1; ENST00000643197.2; ENST00000396999.3; ENST00000397010.7; ENST00000397026.7; ENST00000397012.7; ENST00000397023.5; ENST00000650650.1; ENST00000651735.1; ENST00000650840.1; ENST00000397015.7; ENST00000643888.2; ENST00000652431.1; ENST00000309576.11; ENST00000397000.6 | ||
| External Link | RMBase: m6A_site_577288 | ||
| mod ID: M6ASITE059582 | Click to Show/Hide the Full List | ||
| mod site | chr3:12416902-12416903:+ | [6] | |
| Sequence | TTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCA | ||
| Motif Score | 2.925321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000397010.7; ENST00000287820.10; ENST00000651735.1; ENST00000397015.7; ENST00000643197.2; ENST00000652522.1; ENST00000652431.1; ENST00000397012.7; ENST00000397026.7; ENST00000397023.5; ENST00000396999.3; ENST00000652098.1; ENST00000643888.2; ENST00000650650.1; ENST00000651826.1; ENST00000309576.11; ENST00000650840.1; ENST00000650761.1; ENST00000397000.6; ENST00000644622.2 | ||
| External Link | RMBase: m6A_site_577289 | ||
| mod ID: M6ASITE059583 | Click to Show/Hide the Full List | ||
| mod site | chr3:12416913-12416914:+ | [10] | |
| Sequence | TTGACTTGAACGACCAAGTAACTCTCCTCAAATATGGAGTC | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000396999.3; ENST00000397010.7; ENST00000287820.10; ENST00000397026.7; ENST00000397015.7; ENST00000309576.11; ENST00000650840.1; ENST00000397012.7; ENST00000652522.1; ENST00000650650.1; ENST00000644622.2; ENST00000397000.6; ENST00000643197.2; ENST00000643888.2; ENST00000652431.1; ENST00000652098.1; ENST00000397023.5; ENST00000651826.1; ENST00000651735.1; ENST00000650761.1 | ||
| External Link | RMBase: m6A_site_577290 | ||
| mod ID: M6ASITE059584 | Click to Show/Hide the Full List | ||
| mod site | chr3:12416947-12416948:+ | [6] | |
| Sequence | TGGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000651826.1; ENST00000651735.1; ENST00000397015.7; ENST00000397023.5; ENST00000397012.7; ENST00000652431.1; ENST00000397010.7; ENST00000652522.1; ENST00000396999.3; ENST00000650840.1; ENST00000650650.1; ENST00000644622.2; ENST00000650761.1; ENST00000287820.10; ENST00000643888.2; ENST00000397026.7; ENST00000643197.2; ENST00000309576.11; ENST00000397000.6; ENST00000652098.1 | ||
| External Link | RMBase: m6A_site_577291 | ||
| mod ID: M6ASITE059585 | Click to Show/Hide the Full List | ||
| mod site | chr3:12417012-12417013:+ | [6] | |
| Sequence | CCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000652098.1; ENST00000643197.2; ENST00000397010.7; ENST00000652431.1; ENST00000309576.11; ENST00000397015.7; ENST00000650761.1; ENST00000643888.2; ENST00000651826.1; ENST00000397026.7; ENST00000651735.1; ENST00000644622.2; ENST00000397000.6; ENST00000650650.1; ENST00000396999.3; ENST00000650840.1; ENST00000287820.10; ENST00000397012.7; ENST00000397023.5; ENST00000652522.1 | ||
| External Link | RMBase: m6A_site_577292 | ||
| mod ID: M6ASITE059586 | Click to Show/Hide the Full List | ||
| mod site | chr3:12433933-12433934:+ | [5] | |
| Sequence | GAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; hESC-HEK293T; A549; Huh7; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000397023.5; ENST00000397012.7; ENST00000397026.7; ENST00000644622.2; ENST00000651735.1; ENST00000651826.1; ENST00000397015.7; ENST00000397000.6; ENST00000309576.11; ENST00000643197.2; ENST00000652431.1; ENST00000650761.1; ENST00000287820.10; ENST00000643888.2; ENST00000397010.7; ENST00000652098.1 | ||
| External Link | RMBase: m6A_site_577293 | ||
| mod ID: M6ASITE059587 | Click to Show/Hide the Full List | ||
| mod site | chr3:12433942-12433943:+ | [5] | |
| Sequence | GCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; Huh7; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000397015.7; ENST00000651826.1; ENST00000643888.2; ENST00000397012.7; ENST00000309576.11; ENST00000650761.1; ENST00000397026.7; ENST00000397010.7; ENST00000643197.2; ENST00000652098.1; ENST00000397023.5; ENST00000287820.10; ENST00000397000.6; ENST00000644622.2; ENST00000651735.1; ENST00000652431.1 | ||
| External Link | RMBase: m6A_site_577294 | ||
| mod ID: M6ASITE059588 | Click to Show/Hide the Full List | ||
| mod site | chr3:12433952-12433953:+ | [7] | |
| Sequence | GACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000652431.1; ENST00000397026.7; ENST00000643197.2; ENST00000309576.11; ENST00000397012.7; ENST00000644622.2; ENST00000651826.1; ENST00000650761.1; ENST00000643888.2; ENST00000287820.10; ENST00000397015.7; ENST00000397010.7; ENST00000397000.6; ENST00000651735.1; ENST00000397023.5; ENST00000652098.1 | ||
| External Link | RMBase: m6A_site_577295 | ||
| mod ID: M6ASITE059589 | Click to Show/Hide the Full List | ||
| mod site | chr3:12433981-12433982:+ | [5] | |
| Sequence | GGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; CD4T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000397023.5; ENST00000397010.7; ENST00000652098.1; ENST00000397015.7; ENST00000643888.2; ENST00000651826.1; ENST00000651735.1; ENST00000397000.6; ENST00000643197.2; ENST00000652431.1; ENST00000397012.7; ENST00000397026.7; ENST00000309576.11; ENST00000287820.10; ENST00000644622.2; ENST00000650761.1 | ||
| External Link | RMBase: m6A_site_577296 | ||
| mod ID: M6ASITE059590 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434028-12434029:+ | [6] | |
| Sequence | CCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000397026.7; ENST00000397012.7; ENST00000650761.1; ENST00000287820.10; ENST00000397000.6; ENST00000309576.11; ENST00000651826.1; ENST00000643888.2; ENST00000651735.1; ENST00000643197.2; ENST00000397023.5; ENST00000644622.2; ENST00000397010.7; ENST00000652431.1; ENST00000652098.1; ENST00000397015.7 | ||
| External Link | RMBase: m6A_site_577297 | ||
| mod ID: M6ASITE059591 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434032-12434033:+ | [5] | |
| Sequence | GCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; CD4T; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000397000.6; ENST00000644622.2; ENST00000650761.1; ENST00000652098.1; ENST00000287820.10; ENST00000397010.7; ENST00000652431.1; ENST00000651735.1; ENST00000643888.2; ENST00000309576.11; ENST00000651826.1; ENST00000397012.7; ENST00000397026.7; ENST00000397015.7; ENST00000643197.2; ENST00000397023.5 | ||
| External Link | RMBase: m6A_site_577298 | ||
| mod ID: M6ASITE059592 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434039-12434040:+ | [5] | |
| Sequence | CAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; CD4T; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651826.1; ENST00000397026.7; ENST00000643197.2; ENST00000397023.5; ENST00000287820.10; ENST00000651735.1; ENST00000650761.1; ENST00000643888.2; ENST00000309576.11; ENST00000652431.1; ENST00000397000.6; ENST00000397010.7; ENST00000652098.1; ENST00000644622.2; ENST00000397012.7; ENST00000397015.7 | ||
| External Link | RMBase: m6A_site_577299 | ||
| mod ID: M6ASITE059593 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434054-12434055:+ | [5] | |
| Sequence | CTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; CD4T; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652431.1; ENST00000644622.2; ENST00000287820.10; ENST00000397026.7; ENST00000397023.5; ENST00000397012.7; ENST00000643888.2; ENST00000652098.1; ENST00000309576.11; ENST00000397015.7; ENST00000651826.1; ENST00000651735.1; ENST00000650761.1; ENST00000643197.2; ENST00000397000.6; ENST00000397010.7 | ||
| External Link | RMBase: m6A_site_577300 | ||
| mod ID: M6ASITE059594 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434091-12434092:+ | [5] | |
| Sequence | AGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; MM6; Huh7; HEK293A-TOA; iSLK; MSC; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq | ||
| Transcript ID List | ENST00000643888.2; ENST00000397012.7; ENST00000651735.1; ENST00000651826.1; ENST00000652431.1; ENST00000397015.7; ENST00000309576.11; ENST00000650761.1; ENST00000397026.7; ENST00000287820.10; ENST00000643197.2; ENST00000644622.2; ENST00000397023.5; ENST00000397000.6; ENST00000652098.1; ENST00000397010.7 | ||
| External Link | RMBase: m6A_site_577301 | ||
| mod ID: M6ASITE059595 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434095-12434096:+ | [6] | |
| Sequence | GATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000287820.10; ENST00000397023.5; ENST00000643197.2; ENST00000652098.1; ENST00000397010.7; ENST00000652431.1; ENST00000309576.11; ENST00000651826.1; ENST00000651735.1; ENST00000650761.1; ENST00000397015.7; ENST00000644622.2; ENST00000397026.7; ENST00000397000.6; ENST00000397012.7; ENST00000643888.2 | ||
| External Link | RMBase: m6A_site_577302 | ||
| mod ID: M6ASITE059596 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434134-12434135:+ | [5] | |
| Sequence | CCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000397000.6; ENST00000652431.1; ENST00000397012.7; ENST00000643888.2; ENST00000651826.1; ENST00000397010.7; ENST00000650761.1; ENST00000644622.2; ENST00000652098.1; ENST00000651735.1; ENST00000397026.7; ENST00000397015.7; ENST00000397023.5; ENST00000287820.10; ENST00000309576.11; ENST00000643197.2 | ||
| External Link | RMBase: m6A_site_577303 | ||
| mod ID: M6ASITE059597 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434140-12434141:+ | [6] | |
| Sequence | GGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCC | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000397023.5; ENST00000397012.7; ENST00000650761.1; ENST00000644622.2; ENST00000397000.6; ENST00000309576.11; ENST00000643888.2; ENST00000651735.1; ENST00000287820.10; ENST00000397010.7; ENST00000652098.1; ENST00000652431.1; ENST00000397026.7; ENST00000643197.2; ENST00000397015.7; ENST00000651826.1 | ||
| External Link | RMBase: m6A_site_577304 | ||
| mod ID: M6ASITE059598 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434211-12434212:+ | [7] | |
| Sequence | CTATTCTGAGGGAAAATCTGACACCTAAGAAATTTACTGTG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000651735.1; ENST00000397010.7; ENST00000309576.11; ENST00000650761.1; ENST00000397015.7; ENST00000397012.7; ENST00000651826.1; ENST00000397023.5; ENST00000397026.7; ENST00000397000.6; ENST00000287820.10 | ||
| External Link | RMBase: m6A_site_577305 | ||
| mod ID: M6ASITE059599 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434226-12434227:+ | [6] | |
| Sequence | ATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000651735.1; ENST00000397010.7; ENST00000651826.1; ENST00000650761.1; ENST00000397026.7; ENST00000397015.7; ENST00000397012.7; ENST00000309576.11; ENST00000397023.5; ENST00000287820.10 | ||
| External Link | RMBase: m6A_site_577306 | ||
| mod ID: M6ASITE059600 | Click to Show/Hide the Full List | ||
| mod site | chr3:12434296-12434297:+ | [7] | |
| Sequence | TATGCATATTGTTTATAAAGACACATTTACAATTTACTTTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T; Huh7; iSLK | ||
| Seq Type List | MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651826.1; ENST00000397010.7; ENST00000309576.11; ENST00000397026.7; ENST00000651735.1; ENST00000397023.5; ENST00000650761.1; ENST00000287820.10; ENST00000397012.7; ENST00000397015.7 | ||
| External Link | RMBase: m6A_site_577307 | ||
References

