m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00581)

Target Name	Transgelin (SM22alpha)
Synonyms	22 kDa actin-binding protein; Protein WS3-10; Smooth muscle protein 22-alpha; SM22-alpha Click to Show/Hide
Gene Name	SM22alpha
Chromosomal Location	11q23.3
Family	Calponin family
Function	Actin cross-linking/gelling protein (By similarity). Involved in calcium interactions and contractile properties of the cell that may contribute to replicative senescence. Click to Show/Hide
Gene ID	6876
Uniprot ID	TAGL_HUMAN
HGNC ID	HGNC:11553
KEGG ID	hsa:6876

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SM22alpha can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	TPC_1 cell line	Homo sapiens
Treatment: FTO overexpression TPC_1 cells Control: TPC_1 cells		GSE199206
Regulation		logFC: 6.14E-01 p-value: 1.66E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	FTO knockdown elevated Transgelin (SM22alpha) expression and m6A-binding protein IGF2BP2 enhanced SM22alpha mRNA stability by recognizing and binding to m6A methylation modified mRNA. m6A methylation-mediated elevation of SM22alpha restrained VSMC proliferation and migration and ameliorated intimal hyperplasia in T2DM.
Target Regulation	Down regulation
Responsed Disease	Type 2 diabetes mellitus	ICD-11: 5A11	Disease Info
In-vitro Model	VSMC (Human aortic vascular smooth muscle cells)

Type 2 diabetes mellitus [ICD-11: 5A11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	FTO knockdown elevated Transgelin (SM22alpha) expression and m6A-binding protein IGF2BP2 enhanced SM22alpha mRNA stability by recognizing and binding to m6A methylation modified mRNA. m6A methylation-mediated elevation of SM22alpha restrained VSMC proliferation and migration and ameliorated intimal hyperplasia in T2DM.
Responsed Disease	Type 2 diabetes mellitus [ICD-11: 5A11]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	VSMC (Human aortic vascular smooth muscle cells)

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00581)

Transgelin (SM22alpha)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005371		Click to Show/Hide the Full List
mod site	chr11:117201513-117201514:+
Sequence	GCAGCAAAGAACTGACATTTCGAGGAGCTCTGCTAAGGGCC
Cell/Tissue List	frontalcortex
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000533863.1; ENST00000278968.10; ENST00000529792.5; ENST00000525531.5; ENST00000392951.8
External Link	RMBase: m5C_site_8979

N6-methyladenosine (m6A)

In total 27 m6A sequence/site(s) in this target gene
mod ID: M6ASITE008741		Click to Show/Hide the Full List
mod site	chr11:117199346-117199347:+		[2]
Sequence	CCACGGCGGCAGCCCTTTAAACCCCTCACCCAGCCAGCGCC
Motif Score	2.185083333
Cell/Tissue List	H1A; H1B; fibroblasts; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000392951.8
External Link	RMBase: m6A_site_164868
mod ID: M6ASITE008742		Click to Show/Hide the Full List
mod site	chr11:117199384-117199385:+		[3]
Sequence	GCCCCATCCTGTCTGTCCGAACCCAGACACAAGTCTTCACT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; fibroblasts; Jurkat; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000392951.8; ENST00000525531.5
External Link	RMBase: m6A_site_164869
mod ID: M6ASITE008743		Click to Show/Hide the Full List
mod site	chr11:117199390-117199391:+		[3]
Sequence	TCCTGTCTGTCCGAACCCAGACACAAGTCTTCACTCCTTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; H1A; H1B; fibroblasts; Jurkat; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000525531.5; ENST00000392951.8
External Link	RMBase: m6A_site_164870
mod ID: M6ASITE008744		Click to Show/Hide the Full List
mod site	chr11:117199478-117199479:+		[3]
Sequence	GGAAGTTGGGCTGGAGCTGGACAGGAGCAGTGGGTGCATTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; H1A; H1B; fibroblasts; Jurkat; CD4T; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000392951.8; ENST00000278968.10; ENST00000525531.5
External Link	RMBase: m6A_site_164871
mod ID: M6ASITE008745		Click to Show/Hide the Full List
mod site	chr11:117199553-117199554:+		[3]
Sequence	CCAGCTCCCTGGCTAGGGAAACCCACCCTCTCAGTCAGCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; Jurkat; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000525531.5; ENST00000392951.8
External Link	RMBase: m6A_site_164872
mod ID: M6ASITE008746		Click to Show/Hide the Full List
mod site	chr11:117199632-117199633:+		[4]
Sequence	GCGTCCTGGATCTCTCTCAGACTGGGCAGCCCCGGGCTCAT
Motif Score	3.319380952
Cell/Tissue List	HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000525531.5; ENST00000392951.8; ENST00000278968.10
External Link	RMBase: m6A_site_164873
mod ID: M6ASITE008747		Click to Show/Hide the Full List
mod site	chr11:117199698-117199699:+		[4]
Sequence	GTGCAGAGGAATTGATGGAAACCACCGGGGTGAGAGGGAGG
Motif Score	2.185083333
Cell/Tissue List	HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000392951.8; ENST00000278968.10; ENST00000525531.5
External Link	RMBase: m6A_site_164874
mod ID: M6ASITE008748		Click to Show/Hide the Full List
mod site	chr11:117199817-117199818:+		[4]
Sequence	TCTGTTGCCCCTCCAGGAGAACTTCCAAGGAGGTGAGGAGT
Motif Score	3.373380952
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000525531.5; ENST00000392951.8; ENST00000278968.10
External Link	RMBase: m6A_site_164875
mod ID: M6ASITE008749		Click to Show/Hide the Full List
mod site	chr11:117201231-117201232:+		[5]
Sequence	TCATCCCCAGTGCTCAGAGAACTGGGTCCTCAGAAGTGGTC
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000529792.5; ENST00000392951.8; ENST00000278968.10; ENST00000525531.5; ENST00000533863.1
External Link	RMBase: m6A_site_164876
mod ID: M6ASITE008750		Click to Show/Hide the Full List
mod site	chr11:117201277-117201278:+		[5]
Sequence	CCCACTTTACACATAAGGAAACAGACGCAAGGAGGAGAGGG
Motif Score	2.20572619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000529792.5; ENST00000525531.5; ENST00000392951.8; ENST00000533863.1; ENST00000278968.10
External Link	RMBase: m6A_site_164877
mod ID: M6ASITE008751		Click to Show/Hide the Full List
mod site	chr11:117201334-117201335:+		[5]
Sequence	ACTTCGATGAGTCCGTGTGAACTCTGTTCCGTGTGAGCTGC
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000533863.1; ENST00000525531.5; ENST00000529792.5; ENST00000392951.8
External Link	RMBase: m6A_site_164878
mod ID: M6ASITE008752		Click to Show/Hide the Full List
mod site	chr11:117201412-117201413:+		[5]
Sequence	GCTGGAGTGGGCAGCAAAGAACTGACATTTTGAGGTCAGTT
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000533863.1; ENST00000525531.5; ENST00000529792.5; ENST00000392951.8
External Link	RMBase: m6A_site_164879
mod ID: M6ASITE008753		Click to Show/Hide the Full List
mod site	chr11:117201693-117201694:+		[5]
Sequence	GGCTGGGCAGCTGGCCTGGGACCAGTGGGGTGTGATAGTGT
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000392951.8; ENST00000533863.1; ENST00000278968.10; ENST00000529792.5; ENST00000525531.5
External Link	RMBase: m6A_site_164880
mod ID: M6ASITE008754		Click to Show/Hide the Full List
mod site	chr11:117202789-117202790:+		[5]
Sequence	TTTACTGACCCCTGCTCTAGACCTCCAAAGACCTGGTATCC
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000530649.5; ENST00000392951.8; ENST00000533863.1; ENST00000532870.5; ENST00000525531.5; ENST00000278968.10; ENST00000529792.5
External Link	RMBase: m6A_site_164881
mod ID: M6ASITE008755		Click to Show/Hide the Full List
mod site	chr11:117202799-117202800:+		[5]
Sequence	CCTGCTCTAGACCTCCAAAGACCTGGTATCCTCTTTCCTGG
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000392951.8; ENST00000532870.5; ENST00000529792.5; ENST00000525531.5; ENST00000533863.1; ENST00000530649.5; ENST00000278968.10
External Link	RMBase: m6A_site_164882
mod ID: M6ASITE008756		Click to Show/Hide the Full List
mod site	chr11:117203011-117203012:+		[6]
Sequence	CCTGCTTTAGCTTTCCCCAGACATGGCCAACAAGGGTCCTT
Motif Score	2.897386905
Cell/Tissue List	kidney; iSLK; endometrial
Seq Type List	m6A-REF-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000525531.5; ENST00000392951.8; ENST00000530649.5; ENST00000529792.5; ENST00000532870.5; ENST00000533863.1; ENST00000278968.10
External Link	RMBase: m6A_site_164883
mod ID: M6ASITE008757		Click to Show/Hide the Full List
mod site	chr11:117203149-117203150:+		[5]
Sequence	CCCTGATGTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCC
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000392951.8; ENST00000278968.10; ENST00000532870.5; ENST00000529622.1; ENST00000530649.5; ENST00000533863.1; ENST00000529792.5; ENST00000525531.5
External Link	RMBase: m6A_site_164884
mod ID: M6ASITE008758		Click to Show/Hide the Full List
mod site	chr11:117203325-117203326:+		[7]
Sequence	GATTCTGAGCAAGCTGGTGAACAGCCTGTACCCTGATGGCT
Motif Score	2.951386905
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000530649.5; ENST00000392951.8; ENST00000532870.5; ENST00000278968.10; ENST00000533863.1; ENST00000525531.5; ENST00000529792.5; ENST00000529622.1
External Link	RMBase: m6A_site_164885
mod ID: M6ASITE008759		Click to Show/Hide the Full List
mod site	chr11:117203370-117203371:+		[7]
Sequence	GCCGGTGAAGGTGCCCGAGAACCCACCCTCCATGGTCTTCA
Motif Score	2.930744048
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000529622.1; ENST00000532870.5; ENST00000392951.8; ENST00000533863.1; ENST00000529792.5; ENST00000530649.5; ENST00000525531.5
External Link	RMBase: m6A_site_164886
mod ID: M6ASITE008760		Click to Show/Hide the Full List
mod site	chr11:117203433-117203434:+		[7]
Sequence	GTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTG
Motif Score	4.065041667
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000533863.1; ENST00000529622.1; ENST00000530649.5; ENST00000392951.8; ENST00000525531.5; ENST00000532870.5
External Link	RMBase: m6A_site_164887
mod ID: M6ASITE008761		Click to Show/Hide the Full List
mod site	chr11:117203450-117203451:+		[8]
Sequence	AGGACTATGGGGTCATCAAGACTGACATGTTCCAGACTGTT
Motif Score	3.319380952
Cell/Tissue List	CD34; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000532870.5; ENST00000533863.1; ENST00000530649.5; ENST00000392951.8; ENST00000525531.5; ENST00000529622.1; ENST00000278968.10
External Link	RMBase: m6A_site_164888
mod ID: M6ASITE008762		Click to Show/Hide the Full List
mod site	chr11:117203465-117203466:+		[8]
Sequence	TCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGT
Motif Score	3.319380952
Cell/Tissue List	CD34; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000533863.1; ENST00000392951.8; ENST00000530649.5; ENST00000525531.5; ENST00000532870.5; ENST00000529622.1; ENST00000278968.10
External Link	RMBase: m6A_site_164889
mod ID: M6ASITE008763		Click to Show/Hide the Full List
mod site	chr11:117203787-117203788:+		[8]
Sequence	CTGTCTTCTCACAGGCAAAGACATGGCAGCAGTGCAGAGGA
Motif Score	2.897386905
Cell/Tissue List	CD34; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000530649.5; ENST00000533863.1; ENST00000278968.10; ENST00000525531.5; ENST00000532870.5; ENST00000529622.1; ENST00000392951.8
External Link	RMBase: m6A_site_164890
mod ID: M6ASITE008764		Click to Show/Hide the Full List
mod site	chr11:117203807-117203808:+		[8]
Sequence	ACATGGCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGC
Motif Score	3.622404762
Cell/Tissue List	CD34; HepG2; MM6; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000278968.10; ENST00000525531.5; ENST00000533863.1; ENST00000392951.8; ENST00000530649.5; ENST00000529622.1; ENST00000532870.5
External Link	RMBase: m6A_site_164891
mod ID: M6ASITE008765		Click to Show/Hide the Full List
mod site	chr11:117204169-117204170:+		[5]
Sequence	GATCAGAAAACGGGTGGAAAACACACAGTTCTACCAAGTCT
Motif Score	2.20572619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000392951.8; ENST00000529622.1; ENST00000530649.5; ENST00000532870.5; ENST00000525531.5; ENST00000533863.1; ENST00000278968.10
External Link	RMBase: m6A_site_164892
mod ID: M6ASITE008766		Click to Show/Hide the Full List
mod site	chr11:117204706-117204707:+		[3]
Sequence	CAAAAGCCCATTGAAGAAGAACCAGCCCAGCCTGCCCCCTA
Motif Score	2.930744048
Cell/Tissue List	HeLa; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532870.5; ENST00000533863.1; ENST00000530649.5; ENST00000278968.10
External Link	RMBase: m6A_site_164896
mod ID: M6ASITE008767		Click to Show/Hide the Full List
mod site	chr11:117204756-117204757:+		[3]
Sequence	GGAATATTTTTGGGGTTGGAACTCAAAAAAAAAAAAAAAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000530649.5; ENST00000278968.10; ENST00000533863.1; ENST00000532870.5
External Link	RMBase: m6A_site_164898

Ref 1	M(6)A methylation-mediated elevation of SM22Alpha?inhibits the proliferation and migration of?vascular smooth muscle cells and ameliorates?intimal hyperplasia in type 2 diabetes mellitus. Biol Chem. 2021 Dec 7;403(3):317-329. doi: 10.1515/hsz-2021-0296. Print 2022 Feb 23.
Ref 2	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 7	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map