m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00561)
Target Name Potassium voltage-gated channel subfamily H member 6 (KCNH6)
Synonyms
Ether-a-go-go-related gene potassium channel 2; ERG-2; Eag-related protein 2; Ether-a-go-go-related protein 2; hERG-2; hERG2; Voltage-gated potassium channel subunit Kv11.2
    Click to Show/Hide
Gene Name KCNH6
Chromosomal Location 17q23.3
Family Potassium channel family, H (Eag) (TC 1.A.1.20) subfamily, Kv11.2/KCNH6 sub-subfamily
Function
Pore-forming (alpha) subunit of voltage-gated potassium channel. Elicits a slowly activating, rectifying current (By similarity). Channel properties may be modulated by cAMP and subunit assembly.
    Click to Show/Hide
Gene ID 81033
Uniprot ID
KCNH6_HUMAN
HGNC ID
HGNC:18862
KEGG ID
hsa:81033
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KCNH6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Embryonic stem cells Mus musculus
Treatment: METTL3 knockout mESCs
Control: Wild type mESCs
 GSE156481
Regulation
logFC: 1.67E+00
p-value: 2.01E-04
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between KCNH6 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 4.49E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Lowering m6A levels through silencing METTL3 suppresses the FMT process in vitro and in vivo. m6A modification regulates EMT by modulating the translation of Potassium voltage-gated channel subfamily H member 6 (KCNH6) mRNA in a YTHDF1-dependent manner. Manipulation of m6A modification through targeting METTL3 becomes a promising strategy for the treatment of idiopathic pulmonary fibrosis.
Target Regulation Up regulation
Responsed Disease Idiopathic pulmonary fibrosis ICD-11: CB03.4
 Disease Info 
In-vitro Model WI-38 Normal Homo sapiens CVCL_0579
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Animals were bred and housed in the pathogen-free facility of the Laboratory Animal Center of Shanghai General Hospital (Shanghai, China). All lungs were collected 4 weeks after BLM treatment for histology and further study. Lung microsections (5 uM) were applied to Masson's trichrome and Sirius red staining to visualize fibrotic lesions.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Lowering m6A levels through silencing METTL3 suppresses the FMT process in vitro and in vivo. m6A modification regulates EMT by modulating the translation of Potassium voltage-gated channel subfamily H member 6 (KCNH6) mRNA in a YTHDF1-dependent manner. Manipulation of m6A modification through targeting METTL3 becomes a promising strategy for the treatment of idiopathic pulmonary fibrosis.
Target Regulation Up regulation
Responsed Disease Idiopathic pulmonary fibrosis ICD-11: CB03.4
 Disease Info 
In-vitro Model WI-38 Normal Homo sapiens CVCL_0579
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Animals were bred and housed in the pathogen-free facility of the Laboratory Animal Center of Shanghai General Hospital (Shanghai, China). All lungs were collected 4 weeks after BLM treatment for histology and further study. Lung microsections (5 uM) were applied to Masson's trichrome and Sirius red staining to visualize fibrotic lesions.
Idiopathic interstitial pneumonitis [ICD-11: CB03]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Lowering m6A levels through silencing METTL3 suppresses the FMT process in vitro and in vivo. m6A modification regulates EMT by modulating the translation of Potassium voltage-gated channel subfamily H member 6 (KCNH6) mRNA in a YTHDF1-dependent manner. Manipulation of m6A modification through targeting METTL3 becomes a promising strategy for the treatment of idiopathic pulmonary fibrosis.
Responsed Disease Idiopathic pulmonary fibrosis [ICD-11: CB03.4]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model WI-38 Normal Homo sapiens CVCL_0579
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Animals were bred and housed in the pathogen-free facility of the Laboratory Animal Center of Shanghai General Hospital (Shanghai, China). All lungs were collected 4 weeks after BLM treatment for histology and further study. Lung microsections (5 uM) were applied to Masson's trichrome and Sirius red staining to visualize fibrotic lesions.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Lowering m6A levels through silencing METTL3 suppresses the FMT process in vitro and in vivo. m6A modification regulates EMT by modulating the translation of Potassium voltage-gated channel subfamily H member 6 (KCNH6) mRNA in a YTHDF1-dependent manner. Manipulation of m6A modification through targeting METTL3 becomes a promising strategy for the treatment of idiopathic pulmonary fibrosis.
Responsed Disease Idiopathic pulmonary fibrosis [ICD-11: CB03.4]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model WI-38 Normal Homo sapiens CVCL_0579
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model Animals were bred and housed in the pathogen-free facility of the Laboratory Animal Center of Shanghai General Hospital (Shanghai, China). All lungs were collected 4 weeks after BLM treatment for histology and further study. Lung microsections (5 uM) were applied to Masson's trichrome and Sirius red staining to visualize fibrotic lesions.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03632
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 9 lactylation (H3K9la)
Crosstalk relationship Histone modification → m6A
Disease Pulmonary fibrosis
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00561)
Potassium voltage-gated channel subfamily H member 6 (KCNH6)
N6-methyladenosine (m6A)
In total 17 m6A sequence/site(s) in this target gene
mod ID: M6ASITE034599 Click to Show/Hide the Full List
mod site chr17:63533919-63533920:+ [2]
Sequence CGCGGATGTGCTGCCGGAGTACAAGCTGCAGGCGCCGCGCA
Motif Score 2.856142857
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000583465.1; ENST00000456941.6; ENST00000583023.1; ENST00000580652.5; ENST00000581784.5; ENST00000314672.9
External Link RMBase: m6A_site_376623
mod ID: M6ASITE034600 Click to Show/Hide the Full List
mod site chr17:63533964-63533965:+ [2]
Sequence CCGCTGGACCATCCTGCACTACAGCCCCTTCAAGGCCGTGT
Motif Score 2.078666667
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000581784.5; ENST00000583023.1; ENST00000580652.5; ENST00000314672.9; ENST00000456941.6; ENST00000583465.1
External Link RMBase: m6A_site_376624
mod ID: M6ASITE034601 Click to Show/Hide the Full List
mod site chr17:63535879-63535880:+ [3]
Sequence ACACAAGATCGGCTGGCTGGACAGCCTGGGTGTGCAGCTTG
Motif Score 3.643047619
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000583023.1; ENST00000581784.5; ENST00000583465.1; ENST00000314672.9; ENST00000456941.6; ENST00000580652.5
External Link RMBase: m6A_site_376625
mod ID: M6ASITE034602 Click to Show/Hide the Full List
mod site chr17:63535948-63535949:+ [2]
Sequence CTCGGGCCCCTCGGTGCAGGACAAGTATGTCACAGCCCTCT
Motif Score 3.643047619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000583465.1; ENST00000314672.9; ENST00000580652.5; ENST00000583023.1; ENST00000581784.5; ENST00000456941.6
External Link RMBase: m6A_site_376626
mod ID: M6ASITE034603 Click to Show/Hide the Full List
mod site chr17:63538563-63538564:+ [2]
Sequence CACCCACGCGCCGCCTGGGGACACGCTGGTGCACCTCGGCG
Motif Score 3.643047619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000583023.1; ENST00000314672.9; ENST00000583465.1; ENST00000456941.6; ENST00000581784.5
External Link RMBase: m6A_site_376627
mod ID: M6ASITE034604 Click to Show/Hide the Full List
mod site chr17:63545693-63545694:+ [3]
Sequence TCACCTGGCTGTGGCAACGGACAAAACTCTGGCACCATCCT
Motif Score 3.643047619
Cell/Tissue List H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000456941.6; ENST00000583465.1; ENST00000583023.1; ENST00000314672.9; ENST00000581784.5
External Link RMBase: m6A_site_376628
mod ID: M6ASITE034605 Click to Show/Hide the Full List
mod site chr17:63545698-63545699:+ [3]
Sequence TGGCTGTGGCAACGGACAAAACTCTGGCACCATCCTCAGAA
Motif Score 2.627720238
Cell/Tissue List H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000581784.5; ENST00000583465.1; ENST00000583023.1; ENST00000456941.6; ENST00000314672.9
External Link RMBase: m6A_site_376629
mod ID: M6ASITE034606 Click to Show/Hide the Full List
mod site chr17:63545718-63545719:+ [3]
Sequence ACTCTGGCACCATCCTCAGAACAGGAACAGCCTGAGGGGCT
Motif Score 2.951386905
Cell/Tissue List H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000456941.6; ENST00000583465.1; ENST00000583023.1; ENST00000314672.9; ENST00000581784.5
External Link RMBase: m6A_site_376630
mod ID: M6ASITE034607 Click to Show/Hide the Full List
mod site chr17:63545724-63545725:+ [3]
Sequence GCACCATCCTCAGAACAGGAACAGCCTGAGGGGCTCTGGCC
Motif Score 2.951386905
Cell/Tissue List H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000583465.1; ENST00000314672.9; ENST00000583023.1; ENST00000581784.5; ENST00000456941.6
External Link RMBase: m6A_site_376631
mod ID: M6ASITE034608 Click to Show/Hide the Full List
mod site chr17:63545784-63545785:+ [3]
Sequence CATCCCCTGGAAGTACAAGGACTCATCTGTGGTCCCTGCTT
Motif Score 4.065041667
Cell/Tissue List H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000583465.1; ENST00000456941.6; ENST00000314672.9; ENST00000583023.1; ENST00000581784.5
External Link RMBase: m6A_site_376632
mod ID: M6ASITE034609 Click to Show/Hide the Full List
mod site chr17:63545820-63545821:+ [2]
Sequence TGCTTCTCCTCCCTCCCTGAACACCTTGGCTCTGTTCCCAA
Motif Score 2.951386905
Cell/Tissue List kidney; H1A; H1B; hNPCs
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000581784.5; ENST00000456941.6; ENST00000314672.9; ENST00000583465.1; ENST00000583023.1
External Link RMBase: m6A_site_376633
mod ID: M6ASITE034610 Click to Show/Hide the Full List
mod site chr17:63545849-63545850:+ [3]
Sequence CTCTGTTCCCAAGCAGCTGGACTTCCAGAGACATGGCTCAG
Motif Score 4.065041667
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000583465.1; ENST00000583023.1; ENST00000456941.6; ENST00000314672.9; ENST00000581784.5
External Link RMBase: m6A_site_376634
mod ID: M6ASITE034611 Click to Show/Hide the Full List
mod site chr17:63545859-63545860:+ [2]
Sequence AAGCAGCTGGACTTCCAGAGACATGGCTCAGATCCTGGATT
Motif Score 2.897386905
Cell/Tissue List kidney; H1A; H1B; hNPCs
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000456941.6; ENST00000583023.1; ENST00000581784.5; ENST00000583465.1; ENST00000314672.9
External Link RMBase: m6A_site_376635
mod ID: M6ASITE034612 Click to Show/Hide the Full List
mod site chr17:63545902-63545903:+ [3]
Sequence CAGGGAGTTGGGGCCACTGAACTCCAAGATAAAGACACCAT
Motif Score 3.373380952
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000581784.5; ENST00000314672.9; ENST00000583465.1; ENST00000456941.6; ENST00000583023.1
External Link RMBase: m6A_site_376636
mod ID: M6ASITE034613 Click to Show/Hide the Full List
mod site chr17:63545916-63545917:+ [3]
Sequence CACTGAACTCCAAGATAAAGACACCATGAGGGGACTGAAGG
Motif Score 2.897386905
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000456941.6; ENST00000583023.1; ENST00000581784.5; ENST00000583465.1; ENST00000314672.9
External Link RMBase: m6A_site_376637
mod ID: M6ASITE034614 Click to Show/Hide the Full List
mod site chr17:63545929-63545930:+ [3]
Sequence GATAAAGACACCATGAGGGGACTGAAGGTGGGCAAGGTGAG
Motif Score 4.065041667
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000581784.5; ENST00000583023.1; ENST00000314672.9; ENST00000583465.1; ENST00000456941.6
External Link RMBase: m6A_site_376638
mod ID: M6ASITE034615 Click to Show/Hide the Full List
mod site chr17:63546033-63546034:+ [3]
Sequence GGCCGAGGCGGGCGGATCAGACCATCCTGGCTAACACGGTG
Motif Score 2.876744048
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000583023.1; ENST00000581784.5; rmsk_4741408; ENST00000314672.9; ENST00000583465.1
External Link RMBase: m6A_site_376639