m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00560)

Target Name	Transcription factor E2F8 (E2F8)
Synonyms	E2F-8 Click to Show/Hide
Gene Name	E2F8
Chromosomal Location	11p15.1
Family	E2F/DP family
Function	Atypical E2F transcription factor that participates in various processes such as angiogenesis and polyploidization of specialized cells. Mainly acts as a transcription repressor that binds DNA independently of DP proteins and specifically recognizes the E2 recognition site 5'-TTTC[CG]CGC-3'. Directly represses transcription of classical E2F transcription factors such as E2F1: component of a feedback loop in S phase by repressing the expression of E2F1, thereby preventing p53/TP53-dependent apoptosis. Plays a key role in polyploidization of cells in placenta and liver by regulating the endocycle, probably by repressing genes promoting cytokinesis and antagonizing action of classical E2F proteins (E2F1, E2F2 and/or E2F3). Required for placental development by promoting polyploidization of trophoblast giant cells. Acts as a promoter of sprouting angiogenesis, possibly by acting as a transcription activator: associates with HIF1A, recognizes and binds the VEGFA promoter, which is different from canonical E2 recognition site, and activates expression of the VEGFA gene. Click to Show/Hide
Gene ID	79733
Uniprot ID	E2F8_HUMAN
HGNC ID	HGNC:24727
KEGG ID	hsa:79733

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

E2F8 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shControl AGS		GSE159425
Regulation		logFC: -8.62E-01 p-value: 7.08E-04
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between E2F8 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.18E+00	GSE63591

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Olaparib		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: -6.53E-01 p-value: 4.62E-05
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Olaparib		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 6 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Olaparib		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 5 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 6 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Olaparib		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Cisplatin [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Doxil [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Olaparib [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In breast cancer, accordingly YTHDF1 knockdown sensitizes breast cancer cells to Adriamycin and Cisplatin as well as Olaparib, a PARP inhibitor. Transcription factor E2F8 (E2F8) is a target molecule by YTHDF1 which modulates E2F8 mRNA stability and DNA damage repair in a METTL14-dependent manner.
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	RNA stability
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
In-vivo Model	1×10⁶ MDA-MB-231 cells were resuspended in 100 uL PBS with 50% Matrigel (Corning Costar, USA), and injected into the mammary fat pad of the mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 9 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02214		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Olaparib	Drug Info
Crosstalk ID: M6ACROT02216		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT02217		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Adriamycin	Drug Info
Crosstalk ID: M6ACROT02238		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Olaparib	Drug Info
Crosstalk ID: M6ACROT02240		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT02241		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Adriamycin	Drug Info
Crosstalk ID: M6ACROT02262		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Olaparib	Drug Info
Crosstalk ID: M6ACROT02264		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Cisplatin	Drug Info
Crosstalk ID: M6ACROT02265		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Adriamycin	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00560)

Transcription factor E2F8 (E2F8)

Adenosine-to-Inosine editing (A-to-I)

In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004580		Click to Show/Hide the Full List
mod site	chr11:19233625-19233626:-		[2]
Sequence	GCGTGGTGGCGTGCACCTGTAGTCCCAGTTACTCAGGAGGC
Transcript ID List	ENST00000527884.5; rmsk_3491527; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: RNA-editing_site_20802
mod ID: A2ISITE004581		Click to Show/Hide the Full List
mod site	chr11:19238845-19238846:-		[3]
Sequence	CCATTACTTTCAGTAGCAAAAGCCACAATTACTTTTGCACC
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4; ENST00000532666.1; rmsk_3491535
External Link	RMBase: RNA-editing_site_20803
mod ID: A2ISITE004582		Click to Show/Hide the Full List
mod site	chr11:19239677-19239678:-		[3]
Sequence	CCCCTCTTCAAAAATTCGTTAGTTTCATTACAACATTTCTG
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000532666.1; ENST00000250024.9
External Link	RMBase: RNA-editing_site_20804

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005112		Click to Show/Hide the Full List
mod site	chr11:19237389-19237390:-		[4]
Sequence	GGATTATTGTGTCATAAGTTCTTAGCACGATATCCTAATTA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000532666.1; ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m5C_site_7086

N6-methyladenosine (m6A)

In total 69 m6A sequence/site(s) in this target gene
mod ID: M6ASITE004312		Click to Show/Hide the Full List
mod site	chr11:19224149-19224150:-		[5]
Sequence	ATCTTTTTGTAAAGTTTGCAACAATCCTCAATCAAGTCTAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134371
mod ID: M6ASITE004313		Click to Show/Hide the Full List
mod site	chr11:19224262-19224263:-		[6]
Sequence	CATTCCCTTAAACATTTTGCACAAAGAAAATGCTGTGTGAT
Motif Score	2.830589286
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134372
mod ID: M6ASITE004314		Click to Show/Hide the Full List
mod site	chr11:19224297-19224298:-		[6]
Sequence	CCTCTAAGCAAATATGCTTGACATGCCTAACACAGCATTCC
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134373
mod ID: M6ASITE004315		Click to Show/Hide the Full List
mod site	chr11:19224322-19224323:-		[6]
Sequence	AAGTAACTGTATTAAAGTTTACTTCCCTCTAAGCAAATATG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134374
mod ID: M6ASITE004316		Click to Show/Hide the Full List
mod site	chr11:19224409-19224410:-		[6]
Sequence	AAATAAAAGTAAAATGTTGAACTCTAAGATATATTAACTTC
Motif Score	3.373380952
Cell/Tissue List	HEK293T; Huh7
Seq Type List	DART-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134375
mod ID: M6ASITE004317		Click to Show/Hide the Full List
mod site	chr11:19224432-19224433:-		[6]
Sequence	TAAGTTTAGCTTTCAATCCTACAAAATAAAAGTAAAATGTT
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134376
mod ID: M6ASITE004318		Click to Show/Hide the Full List
mod site	chr11:19224581-19224582:-		[7]
Sequence	TACACAGACTGATTTGGAGAACACATTCTCTGAAAATACTG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; A549; Huh7; HEK293A-TOA; TREX; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134377
mod ID: M6ASITE004319		Click to Show/Hide the Full List
mod site	chr11:19224594-19224595:-		[7]
Sequence	AATAGAGAAAATGTACACAGACTGATTTGGAGAACACATTC
Motif Score	3.319380952
Cell/Tissue List	HEK293T; A549; Huh7; HEK293A-TOA; TREX; TIME
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134378
mod ID: M6ASITE004320		Click to Show/Hide the Full List
mod site	chr11:19224600-19224601:-		[6]
Sequence	TTGTTTAATAGAGAAAATGTACACAGACTGATTTGGAGAAC
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134379
mod ID: M6ASITE004321		Click to Show/Hide the Full List
mod site	chr11:19224653-19224654:-		[6]
Sequence	CAGAGGATGTCCATTAATCAACAGATGTTGGCTTAGTTTAA
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134380
mod ID: M6ASITE004322		Click to Show/Hide the Full List
mod site	chr11:19224687-19224688:-		[8]
Sequence	CTCTTTGTCCCACAGCGAAAACTGGAAGTCTCAACAGAGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134381
mod ID: M6ASITE004323		Click to Show/Hide the Full List
mod site	chr11:19224710-19224711:-		[8]
Sequence	CTAATAAAACCTCCTTAGGAACTCTCTTTGTCCCACAGCGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134382
mod ID: M6ASITE004324		Click to Show/Hide the Full List
mod site	chr11:19224722-19224723:-		[8]
Sequence	ATTTTGAGGGTGCTAATAAAACCTCCTTAGGAACTCTCTTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134383
mod ID: M6ASITE004325		Click to Show/Hide the Full List
mod site	chr11:19224774-19224775:-		[8]
Sequence	TTCTTCCGTACCCCAGGTGGACCCACCAAGCCAACCAGCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134384
mod ID: M6ASITE004326		Click to Show/Hide the Full List
mod site	chr11:19225555-19225556:-		[5]
Sequence	ATTTTCCCTCTTTTCATGTAACACCGTTGAAGCTAATGGTC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000527884.5; ENST00000529188.1; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134385
mod ID: M6ASITE004327		Click to Show/Hide the Full List
mod site	chr11:19225589-19225590:-		[6]
Sequence	ATTCCAGTGACATCATCTGAACTCACTGCTGTTAATTTTCC
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000529188.1; ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134386
mod ID: M6ASITE004328		Click to Show/Hide the Full List
mod site	chr11:19225600-19225601:-		[5]
Sequence	TTCCAGGTGTTATTCCAGTGACATCATCTGAACTCACTGCT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000529188.1; ENST00000527884.5
External Link	RMBase: m6A_site_134387
mod ID: M6ASITE004329		Click to Show/Hide the Full List
mod site	chr11:19225748-19225749:-		[6]
Sequence	TTCCCCAAACCACAGGATTTACAGCTCCCCAATTGCAGGTG
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000529188.1; ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134388
mod ID: M6ASITE004330		Click to Show/Hide the Full List
mod site	chr11:19225863-19225864:-		[8]
Sequence	CCTTCCTCCTTGTTTTCTAGACCTTGTTCCCATCAGGATAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000529188.1; ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134389
mod ID: M6ASITE004331		Click to Show/Hide the Full List
mod site	chr11:19225885-19225886:-		[8]
Sequence	TGTATTTGTGTGTAAAATAAACCCTTCCTCCTTGTTTTCTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000529188.1; ENST00000250024.9
External Link	RMBase: m6A_site_134390
mod ID: M6ASITE004332		Click to Show/Hide the Full List
mod site	chr11:19226074-19226075:-		[8]
Sequence	CCACAGGTGGCATTTAAGAAACATGTTCTGCATTATTCGGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; hESCs; GM12878; Jurkat; peripheral-blood; GSC-11; TIME; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4; ENST00000529188.1
External Link	RMBase: m6A_site_134391
mod ID: M6ASITE004333		Click to Show/Hide the Full List
mod site	chr11:19229471-19229472:-		[8]
Sequence	TTTAAAGAGGACCTAAAAGGACTTGAAAATGTCTCCGCAGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; MM6; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134392
mod ID: M6ASITE004334		Click to Show/Hide the Full List
mod site	chr11:19229481-19229482:-		[8]
Sequence	CAAAAAGAAATTTAAAGAGGACCTAAAAGGACTTGAAAATG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; MM6; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134393
mod ID: M6ASITE004335		Click to Show/Hide the Full List
mod site	chr11:19229511-19229512:-		[8]
Sequence	GAGGGCAAGCATGCTCGAGGACAGTGGTTCCAAAAAGAAAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MM6; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134394
mod ID: M6ASITE004336		Click to Show/Hide the Full List
mod site	chr11:19229563-19229564:-		[8]
Sequence	GGCAAGGGGCAAAGAGCCGAACCAGGGAGCCAGCTGGAGAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134395
mod ID: M6ASITE004337		Click to Show/Hide the Full List
mod site	chr11:19229659-19229660:-		[6]
Sequence	AAGACTCCACAGATGCCACCACTGAGAAGGCAGCCAATGAT
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134396
mod ID: M6ASITE004338		Click to Show/Hide the Full List
mod site	chr11:19229676-19229677:-		[8]
Sequence	TAAAGCTACTGGCTCAAAAGACTCCACAGATGCCACCACTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; Huh7; HEK293A-TOA; MSC; TIME; TREX; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134397
mod ID: M6ASITE004339		Click to Show/Hide the Full List
mod site	chr11:19229919-19229920:-		[8]
Sequence	CAAACCAGTAGCCCCTCTGGACCCCCCAGTGAATGCTGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134398
mod ID: M6ASITE004340		Click to Show/Hide the Full List
mod site	chr11:19229936-19229937:-		[8]
Sequence	GCAAGATCTGGACCCTGCAAACCAGTAGCCCCTCTGGACCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134399
mod ID: M6ASITE004341		Click to Show/Hide the Full List
mod site	chr11:19230635-19230636:-		[5]
Sequence	CAGTAGCCCTATCAAGACCAACAAAGGTATGTTTTCAGGAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134400
mod ID: M6ASITE004342		Click to Show/Hide the Full List
mod site	chr11:19230721-19230722:-		[5]
Sequence	GGGAAACCAAACTTTACTCGACACCCATCTCTTATCAAATT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134401
mod ID: M6ASITE004343		Click to Show/Hide the Full List
mod site	chr11:19230745-19230746:-		[6]
Sequence	GCCAAAAACCTCTTTTCCACACGTGGGAAACCAAACTTTAC
Motif Score	2.058863095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134402
mod ID: M6ASITE004344		Click to Show/Hide the Full List
mod site	chr11:19234359-19234360:-		[5]
Sequence	TGGATAAAAGCAAGTTTAAAAGTAAGTGTCATGACTGCCAT
Motif Score	1.756488095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134403
mod ID: M6ASITE004345		Click to Show/Hide the Full List
mod site	chr11:19234499-19234500:-		[8]
Sequence	TTCTGTAAACAGCCGCAAAGACAAGTCTTTAAGGGTAATGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134404
mod ID: M6ASITE004346		Click to Show/Hide the Full List
mod site	chr11:19234511-19234512:-		[8]
Sequence	CTTCTCTAAAGCTTCTGTAAACAGCCGCAAAGACAAGTCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134405
mod ID: M6ASITE004347		Click to Show/Hide the Full List
mod site	chr11:19234768-19234769:-		[8]
Sequence	CCAGACATGTGTTTTGTGGAACTCCCTGGAGTGGAATTTCG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134406
mod ID: M6ASITE004348		Click to Show/Hide the Full List
mod site	chr11:19234784-19234785:-		[8]
Sequence	TGGCCCAAATGGACACCCAGACATGTGTTTTGTGGAACTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134407
mod ID: M6ASITE004349		Click to Show/Hide the Full List
mod site	chr11:19234792-19234793:-		[8]
Sequence	TCAAACACTGGCCCAAATGGACACCCAGACATGTGTTTTGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134408
mod ID: M6ASITE004350		Click to Show/Hide the Full List
mod site	chr11:19234808-19234809:-		[8]
Sequence	GGATCATATCATCAAATCAAACACTGGCCCAAATGGACACC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134409
mod ID: M6ASITE004351		Click to Show/Hide the Full List
mod site	chr11:19234944-19234945:-		[6]
Sequence	GGCGACACAATCTCAACAAAACCCTTGGCACCTTGAAGAGC
Motif Score	2.185083333
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq; DART-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134410
mod ID: M6ASITE004352		Click to Show/Hide the Full List
mod site	chr11:19234974-19234975:-		[6]
Sequence	GCCTCGCCAAAAACAGGTACACTTGGCACGGGCGACACAAT
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134411
mod ID: M6ASITE004353		Click to Show/Hide the Full List
mod site	chr11:19234982-19234983:-
Sequence	GGTGAGCCGCCTCGCCAAAAACAGGTACACTTGGCACGGGC
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134412
mod ID: M6ASITE004354		Click to Show/Hide the Full List
mod site	chr11:19237333-19237334:-		[6]
Sequence	GAATAATGACATCTGCCTTGACGAAGTGGCAGAGGAACTTA
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134413
mod ID: M6ASITE004355		Click to Show/Hide the Full List
mod site	chr11:19237345-19237346:-		[6]
Sequence	CAACCCTGCTGTGAATAATGACATCTGCCTTGACGAAGTGG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134414
mod ID: M6ASITE004356		Click to Show/Hide the Full List
mod site	chr11:19237467-19237468:-		[5]
Sequence	TTACCTTTTCCTTTGTAGGAACACTTATCTGGAGATGAATT
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000532666.1; ENST00000620009.4; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134415
mod ID: M6ASITE004357		Click to Show/Hide the Full List
mod site	chr11:19237920-19237921:-		[6]
Sequence	TGTGAGCCCTGAGATCCGCAACAGAGATCAGAAAAGGGGTT
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4; ENST00000532666.1
External Link	RMBase: m6A_site_134416
mod ID: M6ASITE004358		Click to Show/Hide the Full List
mod site	chr11:19237969-19237970:-		[6]
Sequence	AGGGAGAGCCGTGGACACCGACAGCCAACCTGAAAATGCTC
Motif Score	2.865571429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9; ENST00000532666.1
External Link	RMBase: m6A_site_134417
mod ID: M6ASITE004359		Click to Show/Hide the Full List
mod site	chr11:19237975-19237976:-		[8]
Sequence	GCTCTCAGGGAGAGCCGTGGACACCGACAGCCAACCTGAAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000532666.1; ENST00000620009.4
External Link	RMBase: m6A_site_134418
mod ID: M6ASITE004360		Click to Show/Hide the Full List
mod site	chr11:19238017-19238018:-		[5]
Sequence	CTGACTTTGGCCCTTTAACCACACCTACCAAGCCCAAGGAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000532666.1; ENST00000250024.9
External Link	RMBase: m6A_site_134419
mod ID: M6ASITE004361		Click to Show/Hide the Full List
mod site	chr11:19238089-19238090:-		[8]
Sequence	ATAAAAGGGGACTAATGAAAACACCTCTGAAAGAATCCACC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000250024.9; ENST00000527884.5; ENST00000532666.1; ENST00000620009.4
External Link	RMBase: m6A_site_134420
mod ID: M6ASITE004362		Click to Show/Hide the Full List
mod site	chr11:19238099-19238100:-		[8]
Sequence	TGTGAGCCACATAAAAGGGGACTAATGAAAACACCTCTGAA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000532666.1; ENST00000250024.9; ENST00000620009.4
External Link	RMBase: m6A_site_134421
mod ID: M6ASITE004363		Click to Show/Hide the Full List
mod site	chr11:19238111-19238112:-		[5]
Sequence	GAAAATCTCTTTTGTGAGCCACATAAAAGGGGACTAATGAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000250024.9; ENST00000532666.1; ENST00000527884.5; ENST00000620009.4
External Link	RMBase: m6A_site_134422
mod ID: M6ASITE004364		Click to Show/Hide the Full List
mod site	chr11:19240125-19240126:-		[6]
Sequence	TCTAAATGTATGAGGAATTTACAGAATGGAGAACGAAAAGG
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000532666.1; ENST00000620009.4
External Link	RMBase: m6A_site_134423
mod ID: M6ASITE004365		Click to Show/Hide the Full List
mod site	chr11:19240190-19240191:-		[8]
Sequence	CAATTGATTGGACTACTTGAACCATCGGGATTTGGGGAGGA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000532666.1; ENST00000620009.4; ENST00000527884.5; ENST00000250024.9
External Link	RMBase: m6A_site_134424
mod ID: M6ASITE004366		Click to Show/Hide the Full List
mod site	chr11:19240199-19240200:-		[8]
Sequence	CTTTTAGTACAATTGATTGGACTACTTGAACCATCGGGATT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9; ENST00000532666.1
External Link	RMBase: m6A_site_134425
mod ID: M6ASITE004367		Click to Show/Hide the Full List
mod site	chr11:19240220-19240221:-		[8]
Sequence	TTTTCTTTAAGGATATTAAAACTTTTAGTACAATTGATTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4; ENST00000532666.1
External Link	RMBase: m6A_site_134426
mod ID: M6ASITE004368		Click to Show/Hide the Full List
mod site	chr11:19240550-19240551:-		[8]
Sequence	TCCGGAGCCCTGATCTGCGAACAGGTGGGTGCTTCCTAAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000527884.5; ENST00000532666.1
External Link	RMBase: m6A_site_134427
mod ID: M6ASITE004369		Click to Show/Hide the Full List
mod site	chr11:19240590-19240591:-		[8]
Sequence	GTCGCGTGCGCTCAGCTGGGACCTGGGCTCGTGCGCTTAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000527884.5; ENST00000250024.9; ENST00000532666.1
External Link	RMBase: m6A_site_134428
mod ID: M6ASITE004370		Click to Show/Hide the Full List
mod site	chr11:19240631-19240632:-		[8]
Sequence	ATCCAGGCATCTAGATGCAGACTTGTACCCAGTTACTTGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000532666.1; ENST00000527884.5
External Link	RMBase: m6A_site_134429
mod ID: M6ASITE004371		Click to Show/Hide the Full List
mod site	chr11:19240692-19240693:-		[6]
Sequence	CTGTCAAGCGACCTCCCACGACTTTACTGCTGAGCCTGTGC
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000527884.5; ENST00000250024.9; ENST00000620009.4; ENST00000532666.1
External Link	RMBase: m6A_site_134430
mod ID: M6ASITE004372		Click to Show/Hide the Full List
mod site	chr11:19240718-19240719:-		[8]
Sequence	GCTTTGGGACTGAATTTGGAACTTTCCTGTCAAGCGACCTC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000250024.9; ENST00000620009.4; ENST00000527884.5; ENST00000532666.1
External Link	RMBase: m6A_site_134431
mod ID: M6ASITE004373		Click to Show/Hide the Full List
mod site	chr11:19240730-19240731:-		[8]
Sequence	TGCATACTTGGAGCTTTGGGACTGAATTTGGAACTTTCCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000250024.9; ENST00000532666.1
External Link	RMBase: m6A_site_134432
mod ID: M6ASITE004374		Click to Show/Hide the Full List
mod site	chr11:19240745-19240746:-		[6]
Sequence	CTTTAAATGCCCAACTGCATACTTGGAGCTTTGGGACTGAA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000532666.1; ENST00000250024.9; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134433
mod ID: M6ASITE004375		Click to Show/Hide the Full List
mod site	chr11:19240768-19240769:-		[8]
Sequence	AAAAAAGTCTTAATTATAAGACTCTTTAAATGCCCAACTGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532666.1; ENST00000527884.5; ENST00000620009.4; ENST00000250024.9
External Link	RMBase: m6A_site_134434
mod ID: M6ASITE004376		Click to Show/Hide the Full List
mod site	chr11:19240842-19240843:-		[8]
Sequence	GGTGTGAACTGGCCACCCGAACAGGGAGTAAATAGTGCTTT
Motif Score	2.951386905
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620009.4; ENST00000250024.9; ENST00000532666.1; ENST00000527884.5
External Link	RMBase: m6A_site_134435
mod ID: M6ASITE004377		Click to Show/Hide the Full List
mod site	chr11:19240855-19240856:-		[8]
Sequence	AGTCTAACGCCGTGGTGTGAACTGGCCACCCGAACAGGGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000620009.4; ENST00000532666.1; ENST00000250024.9; ENST00000527884.5
External Link	RMBase: m6A_site_134436
mod ID: M6ASITE004378		Click to Show/Hide the Full List
mod site	chr11:19240921-19240922:-		[9]
Sequence	GAGCGAGTGGCGGCCGGGGGACAGTACCTGCTTGCCTTATT
Motif Score	3.643047619
Cell/Tissue List	Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000250024.9; ENST00000532666.1; ENST00000620009.4; ENST00000527884.5
External Link	RMBase: m6A_site_134437
mod ID: M6ASITE004379		Click to Show/Hide the Full List
mod site	chr11:19241413-19241414:-		[9]
Sequence	CGGCTCCCGCCGTGAGGTGGACTGACAGGTCAGCGGGACGC
Motif Score	4.065041667
Cell/Tissue List	Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000532666.1
External Link	RMBase: m6A_site_134438
mod ID: M6ASITE004380		Click to Show/Hide the Full List
mod site	chr11:19241507-19241508:-		[9]
Sequence	CACCTCGGCGCTGCGGAAAGACTGACTGCCAGGTACGCGGG
Motif Score	3.319380952
Cell/Tissue List	Jurkat; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000527884.5; ENST00000620009.4; ENST00000532666.1
External Link	RMBase: m6A_site_134439

Ref 1	YTHDF1 promotes breast cancer cell growth, DNA damage repair and chemoresistance. Cell Death Dis. 2022 Mar 12;13(3):230. doi: 10.1038/s41419-022-04672-5.
Ref 2	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 7	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map