m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00550)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TRIM7
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | ARPE-19 cell line | Homo sapiens |
|
Treatment: shMETTL3 ARPE-19 cells
Control: shControl ARPE-19 cells
|
GSE202017 | |
| Regulation |
![]() ![]() |
logFC: -1.54E+00 p-value: 1.28E-03 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between TRIM7 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 7.18E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | E3 ubiquitin-protein ligase TRIM7 (TRIM7) mRNA stability was regulated by the METTL3/14-YTHDF2-mRNA in a decay-dependent manner. TRIM7 plays a key role in regulating metastasis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Osteosarcoma | ICD-11: 2B51 | ||
| Pathway Response | Ubiquitin mediated proteolysis | hsa04120 | ||
| Cell Process | Proteasome pathway degradation | |||
| In-vitro Model | U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 |
| SaOS-2 | Osteosarcoma | Homo sapiens | CVCL_0548 | |
| MG-63 | Osteosarcoma | Homo sapiens | CVCL_0426 | |
| HOS | Osteosarcoma | Homo sapiens | CVCL_0312 | |
| hFOB 1.19 | Normal | Homo sapiens | CVCL_3708 | |
| In-vivo Model | MG63 cells transduced with lentivirus expressing shTRIM7 or shNC, and SAOS2 cells transduced with lentivirus expressing TRIM7, BRMS1, TRIM7 plus BRMS1 or control vector, were injected via the tail vein into the nude mice (1 × 106 cells/mouse) (n = 11 per group). | |||
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL14-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: -1.06E+00 p-value: 1.08E-12 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | E3 ubiquitin-protein ligase TRIM7 (TRIM7) mRNA stability was regulated by the METTL3/14-YTHDF2-mRNA in a decay-dependent manner. TRIM7 plays a key role in regulating metastasis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Osteosarcoma | ICD-11: 2B51 | ||
| Pathway Response | Ubiquitin mediated proteolysis | hsa04120 | ||
| Cell Process | Proteasome pathway degradation | |||
| In-vitro Model | U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 |
| SaOS-2 | Osteosarcoma | Homo sapiens | CVCL_0548 | |
| MG-63 | Osteosarcoma | Homo sapiens | CVCL_0426 | |
| HOS | Osteosarcoma | Homo sapiens | CVCL_0312 | |
| hFOB 1.19 | Normal | Homo sapiens | CVCL_3708 | |
| In-vivo Model | MG63 cells transduced with lentivirus expressing shTRIM7 or shNC, and SAOS2 cells transduced with lentivirus expressing TRIM7, BRMS1, TRIM7 plus BRMS1 or control vector, were injected via the tail vein into the nude mice (1 × 106 cells/mouse) (n = 11 per group). | |||
YTH domain-containing family protein 2 (YTHDF2) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2 | ||
| Cell Line | Mouse-cerebellum granule cell | Mus musculus |
|
Treatment: YTHDF2 knockdown mouse-cerebellum granule cell
Control: Wild type mouse-cerebellum granule cell
|
GSE153688 | |
| Regulation |
![]() ![]() |
logFC: 1.15E+00 p-value: 8.92E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | E3 ubiquitin-protein ligase TRIM7 (TRIM7) mRNA stability was regulated by the METTL3/14-YTHDF2-mRNA in a decay-dependent manner. TRIM7 plays a key role in regulating metastasis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Osteosarcoma | ICD-11: 2B51 | ||
| Pathway Response | Ubiquitin mediated proteolysis | hsa04120 | ||
| Cell Process | Proteasome pathway degradation | |||
| In-vitro Model | U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 |
| SaOS-2 | Osteosarcoma | Homo sapiens | CVCL_0548 | |
| MG-63 | Osteosarcoma | Homo sapiens | CVCL_0426 | |
| HOS | Osteosarcoma | Homo sapiens | CVCL_0312 | |
| hFOB 1.19 | Normal | Homo sapiens | CVCL_3708 | |
| In-vivo Model | MG63 cells transduced with lentivirus expressing shTRIM7 or shNC, and SAOS2 cells transduced with lentivirus expressing TRIM7, BRMS1, TRIM7 plus BRMS1 or control vector, were injected via the tail vein into the nude mice (1 × 106 cells/mouse) (n = 11 per group). | |||
Osteosarcoma [ICD-11: 2B51]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | E3 ubiquitin-protein ligase TRIM7 (TRIM7) mRNA stability was regulated by the METTL3/14-YTHDF2-mRNA in a decay-dependent manner. TRIM7 plays a key role in regulating metastasis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. | |||
| Responsed Disease | Osteosarcoma [ICD-11: 2B51] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Ubiquitin mediated proteolysis | hsa04120 | ||
| Cell Process | Proteasome pathway degradation | |||
| In-vitro Model | U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 |
| SaOS-2 | Osteosarcoma | Homo sapiens | CVCL_0548 | |
| MG-63 | Osteosarcoma | Homo sapiens | CVCL_0426 | |
| HOS | Osteosarcoma | Homo sapiens | CVCL_0312 | |
| hFOB 1.19 | Normal | Homo sapiens | CVCL_3708 | |
| In-vivo Model | MG63 cells transduced with lentivirus expressing shTRIM7 or shNC, and SAOS2 cells transduced with lentivirus expressing TRIM7, BRMS1, TRIM7 plus BRMS1 or control vector, were injected via the tail vein into the nude mice (1 × 106 cells/mouse) (n = 11 per group). | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | E3 ubiquitin-protein ligase TRIM7 (TRIM7) mRNA stability was regulated by the METTL3/14-YTHDF2-mRNA in a decay-dependent manner. TRIM7 plays a key role in regulating metastasis and chemoresistance in osteosarcoma through ubiquitination of BRMS1. | |||
| Responsed Disease | Osteosarcoma [ICD-11: 2B51] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Ubiquitin mediated proteolysis | hsa04120 | ||
| Cell Process | Proteasome pathway degradation | |||
| In-vitro Model | U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 |
| SaOS-2 | Osteosarcoma | Homo sapiens | CVCL_0548 | |
| MG-63 | Osteosarcoma | Homo sapiens | CVCL_0426 | |
| HOS | Osteosarcoma | Homo sapiens | CVCL_0312 | |
| hFOB 1.19 | Normal | Homo sapiens | CVCL_3708 | |
| In-vivo Model | MG63 cells transduced with lentivirus expressing shTRIM7 or shNC, and SAOS2 cells transduced with lentivirus expressing TRIM7, BRMS1, TRIM7 plus BRMS1 or control vector, were injected via the tail vein into the nude mice (1 × 106 cells/mouse) (n = 11 per group). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00550)
| In total 46 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE073034 | Click to Show/Hide the Full List | ||
| mod site | chr5:181193941-181193942:- | [2] | |
| Sequence | GGTGAGGAGATGAAAATGAAACTATGAGCTGTCTTTGGAGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702502 | ||
| mod ID: M6ASITE073035 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194141-181194142:- | [2] | |
| Sequence | CACAAATATGCTCCTGACGGACTCAGGAAAATGCCAACAGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; GM12878; LCLs; Jurkat; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000504241.1; ENST00000393315.5 | ||
| External Link | RMBase: m6A_site_702503 | ||
| mod ID: M6ASITE073036 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194174-181194175:- | [2] | |
| Sequence | AAAGATGCAGCCAGCTCTAAACAACACACAGAGCACAAATA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; LCLs; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702504 | ||
| mod ID: M6ASITE073037 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194218-181194219:- | [2] | |
| Sequence | CTGGAACTTTGAAACACAAAACACAAGTTGGCACTTACAAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; HepG2; LCLs; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000393315.5; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702505 | ||
| mod ID: M6ASITE073038 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194225-181194226:- | [2] | |
| Sequence | TTTGCTTCTGGAACTTTGAAACACAAAACACAAGTTGGCAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; LCLs; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702506 | ||
| mod ID: M6ASITE073039 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194233-181194234:- | [2] | |
| Sequence | TTTTTGTTTTTGCTTCTGGAACTTTGAAACACAAAACACAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; LCLs; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000274773.12; ENST00000393315.5; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702507 | ||
| mod ID: M6ASITE073040 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194257-181194258:- | [2] | |
| Sequence | GTGTGAGCCGCTGTACCCGAACTTTTTTTGTTTTTGCTTCT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549; LCLs; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702509 | ||
| mod ID: M6ASITE073042 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194333-181194334:- | [2] | |
| Sequence | GTTGCCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGATCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702511 | ||
| mod ID: M6ASITE073043 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194368-181194369:- | [2] | |
| Sequence | TTTTAATTTTCTTTTAAGAGACTGGGTCTTGCTATGTTGCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; TIME; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702514 | ||
| mod ID: M6ASITE073044 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194406-181194407:- | [2] | |
| Sequence | AGGAGAGCAAAGCTTCTGGAACTTTATTTACTCTTTCTTTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549; Jurkat; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000274773.12; ENST00000393315.5 | ||
| External Link | RMBase: m6A_site_702515 | ||
| mod ID: M6ASITE073045 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194477-181194478:- | [2] | |
| Sequence | ACCAACACGTGCTCTCACAAACCCCTGACTCCCGCACTTTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; LCLs; H1299; Jurkat; GSC-11; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702516 | ||
| mod ID: M6ASITE073046 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194581-181194582:- | [2] | |
| Sequence | CTTTGAGTGACAAGCCCGGGACAACAGCCAGTGGGCATCAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; fibroblasts; LCLs; H1299; Jurkat; GSC-11; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702517 | ||
| mod ID: M6ASITE073047 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194614-181194615:- | [2] | |
| Sequence | TGGGCCAGAACTGGAAGGAGACATCTGTCCCGTCTTTGAGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; fibroblasts; LCLs; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000393315.5; ENST00000393319.7; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702518 | ||
| mod ID: M6ASITE073048 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194625-181194626:- | [2] | |
| Sequence | AGAGGACAGTCTGGGCCAGAACTGGAAGGAGACATCTGTCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; fibroblasts; LCLs; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000393315.5; ENST00000393319.7; ENST00000274773.12; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702519 | ||
| mod ID: M6ASITE073050 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194640-181194641:- | [2] | |
| Sequence | CTGTGCTCCCAGCTCAGAGGACAGTCTGGGCCAGAACTGGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; fibroblasts; LCLs; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393319.7; ENST00000274773.12; ENST00000504241.1; ENST00000393315.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702520 | ||
| mod ID: M6ASITE073051 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194708-181194709:- | [2] | |
| Sequence | CTGCCTTGAGAGGTTGTGGGACCTCTGGATCCAGCTGACCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; HepG2; fibroblasts; LCLs; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000393315.5; ENST00000422067.2; ENST00000393319.7; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702521 | ||
| mod ID: M6ASITE073052 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194741-181194742:- | [2] | |
| Sequence | TCATGGCTGCTGCCTTCTGGACAGCTGCCAGCTCTGCCTTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; HepG2; Jurkat; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000274773.12; ENST00000422067.2; ENST00000393319.7; ENST00000393315.5 | ||
| External Link | RMBase: m6A_site_702522 | ||
| mod ID: M6ASITE073053 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194835-181194836:- | [2] | |
| Sequence | AGGGTGCCTGGCTCCCTAAAACAATGTCAAAGCCAGTCCTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; GM12878; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000393315.5; ENST00000393319.7; ENST00000504241.1; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702523 | ||
| mod ID: M6ASITE073054 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194972-181194973:- | [2] | |
| Sequence | CAGGGGAACAGGGGCTTTGGACTCCTGAGGGTGTTCCCTTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; GM12878; LCLs; Jurkat; GSC-11; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000393315.5; ENST00000422067.2; ENST00000504241.1; ENST00000393319.7 | ||
| External Link | RMBase: m6A_site_702524 | ||
| mod ID: M6ASITE073055 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194985-181194986:- | [2] | |
| Sequence | GTGGCCAACCGAGCAGGGGAACAGGGGCTTTGGACTCCTGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; GM12878; LCLs; MM6; Jurkat; GSC-11; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000422067.2; ENST00000274773.12; ENST00000393319.7; ENST00000393315.5 | ||
| External Link | RMBase: m6A_site_702525 | ||
| mod ID: M6ASITE073056 | Click to Show/Hide the Full List | ||
| mod site | chr5:181194998-181194999:- | [3] | |
| Sequence | CAGGAGAGTGACTGTGGCCAACCGAGCAGGGGAACAGGGGC | ||
| Motif Score | 2.153267857 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393315.5; ENST00000422067.2; ENST00000393319.7; ENST00000504241.1; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702526 | ||
| mod ID: M6ASITE073057 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195032-181195033:- | [2] | |
| Sequence | CCCAAGAGAGCCTGCTACAGACACAACCCCGAGGCAGGAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; A549; hESC-HEK293T; HepG2; MM6; Jurkat; GSC-11; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000393315.5; ENST00000422067.2; ENST00000504241.1; ENST00000393319.7 | ||
| External Link | RMBase: m6A_site_702527 | ||
| mod ID: M6ASITE073058 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195265-181195266:- | [2] | |
| Sequence | GTCCTTCTACGCTGTGGAGGACATGCGCCACCTCTACACCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; Jurkat; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000393319.7; ENST00000393315.5; ENST00000422067.2; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702528 | ||
| mod ID: M6ASITE073059 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195304-181195305:- | [4] | |
| Sequence | GCGCGTGCGGGTGGCCCTGGACCTGGAGGTGGGAGCCGTGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; Jurkat | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000393315.5; ENST00000504241.1; ENST00000393319.7; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702529 | ||
| mod ID: M6ASITE073061 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195586-181195587:- | [2] | |
| Sequence | CCTCGGCGAGCGGGCCCAGGACCTGCCCAACCACCCCTGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000504241.1; ENST00000422067.2; ENST00000393319.7; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702530 | ||
| mod ID: M6ASITE073062 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195702-181195703:- | [2] | |
| Sequence | AGGGGCCTGGCTGCGTGGGGACATTTCTCCCTGTCTCTGTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000393319.7; ENST00000422067.2; ENST00000504241.1 | ||
| External Link | RMBase: m6A_site_702531 | ||
| mod ID: M6ASITE073063 | Click to Show/Hide the Full List | ||
| mod site | chr5:181195730-181195731:- | [2] | |
| Sequence | TCGGGCGCGGCCCTGCAAAGACTGTGCCAGGGGCCTGGCTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000504241.1; ENST00000274773.12; ENST00000393315.5; ENST00000393319.7; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702532 | ||
| mod ID: M6ASITE073064 | Click to Show/Hide the Full List | ||
| mod site | chr5:181199882-181199883:- | [2] | |
| Sequence | TCAGCAGCCAGATCCAGGAGACAGCTCAAAAGCCTGACCTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; Jurkat; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000393315.5; ENST00000274773.12; ENST00000393319.7 | ||
| External Link | RMBase: m6A_site_702535 | ||
| mod ID: M6ASITE073065 | Click to Show/Hide the Full List | ||
| mod site | chr5:181199944-181199945:- | [2] | |
| Sequence | GGCACAGAAGCAGAATGAGAACCTGGCCCAGCTCGGGGTTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; Jurkat; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000274773.12; ENST00000393315.5; ENST00000393319.7 | ||
| External Link | RMBase: m6A_site_702537 | ||
| mod ID: M6ASITE073066 | Click to Show/Hide the Full List | ||
| mod site | chr5:181199979-181199980:- | [2] | |
| Sequence | CTGCTAGGCCGCCTGGAGGAACTGTCCCGGGAGGTGGCACA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Jurkat; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000422067.2; ENST00000393319.7; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702538 | ||
| mod ID: M6ASITE073067 | Click to Show/Hide the Full List | ||
| mod site | chr5:181200078-181200079:- | [2] | |
| Sequence | CTTCTCCTCCTGGGACAGAAACAGATGGCAGCGGAGCAGGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393319.7; ENST00000274773.12; ENST00000393315.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702539 | ||
| mod ID: M6ASITE073069 | Click to Show/Hide the Full List | ||
| mod site | chr5:181200084-181200085:- | [2] | |
| Sequence | CTCCAACTTCTCCTCCTGGGACAGAAACAGATGGCAGCGGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000393319.7; ENST00000393315.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702540 | ||
| mod ID: M6ASITE073070 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203326-181203327:- | [5] | |
| Sequence | GCTAAAATAATTATTGCAAAACAACTGGCTTAAACTGGAGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000509199.1; ENST00000274773.12; ENST00000393315.5; ENST00000334421.5 | ||
| External Link | RMBase: m6A_site_702541 | ||
| mod ID: M6ASITE073071 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203374-181203375:- | [5] | |
| Sequence | TCCACATAATTGTTGTACAAACCAGAGCTTTTTAAAGTGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; A549; HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000334421.5; ENST00000274773.12; ENST00000393315.5; ENST00000509199.1 | ||
| External Link | RMBase: m6A_site_702542 | ||
| mod ID: M6ASITE073072 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203444-181203445:- | [2] | |
| Sequence | GTTGGAGTGTGTGCTATGGAACCGCAGAATCGATTTCAGAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; LCLs; Jurkat; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000334421.5; ENST00000393315.5; ENST00000274773.12; ENST00000509199.1 | ||
| External Link | RMBase: m6A_site_702543 | ||
| mod ID: M6ASITE073073 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203493-181203494:- | [2] | |
| Sequence | GACATTACAGAGGCCTGAGAACTCAGCACCAGGGCTCGGTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; H1A; LCLs; MM6; Jurkat; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422067.2; ENST00000274773.12; ENST00000334421.5; ENST00000393315.5; ENST00000509199.1 | ||
| External Link | RMBase: m6A_site_702544 | ||
| mod ID: M6ASITE073074 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203512-181203513:- | [2] | |
| Sequence | ACCCGCAGGCCCCCCGTGGGACATTACAGAGGCCTGAGAAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; H1A; LCLs; MM6; Jurkat; GSC-11; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000509199.1; ENST00000393315.5; ENST00000274773.12; ENST00000334421.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702545 | ||
| mod ID: M6ASITE073075 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203593-181203594:- | [2] | |
| Sequence | CTTGAAGAAGGAACTGGAGGACTGTGAGGTGTTCCGGTCCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; H1A; A549; Jurkat; GSC-11; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000274773.12; ENST00000509199.1; ENST00000334421.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702546 | ||
| mod ID: M6ASITE073076 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203601-181203602:- | [2] | |
| Sequence | CTGAGGGTCTTGAAGAAGGAACTGGAGGACTGTGAGGTGTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; H1A; A549; Jurkat; GSC-11; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000334421.5; ENST00000274773.12; ENST00000422067.2; ENST00000393315.5; ENST00000509199.1 | ||
| External Link | RMBase: m6A_site_702547 | ||
| mod ID: M6ASITE073077 | Click to Show/Hide the Full List | ||
| mod site | chr5:181203811-181203812:- | [2] | |
| Sequence | TGGGGAAGCAAGATCCCGAGACCTTCAGAGTCACCTCGCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; U2OS; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000422067.2; ENST00000393315.5; ENST00000334421.5; ENST00000509199.1 | ||
| External Link | RMBase: m6A_site_702548 | ||
| mod ID: M6ASITE073078 | Click to Show/Hide the Full List | ||
| mod site | chr5:181204147-181204148:- | [2] | |
| Sequence | TCGTGGAACTGAGTGAGAGGACCTCGCCAAGATGTCCAGGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393315.5; ENST00000422067.2; ENST00000334421.5; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702549 | ||
| mod ID: M6ASITE073080 | Click to Show/Hide the Full List | ||
| mod site | chr5:181204160-181204161:- | [2] | |
| Sequence | CAAAGTCCCCACCTCGTGGAACTGAGTGAGAGGACCTCGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000334421.5; ENST00000393315.5; ENST00000422067.2 | ||
| External Link | RMBase: m6A_site_702550 | ||
| mod ID: M6ASITE073081 | Click to Show/Hide the Full List | ||
| mod site | chr5:181204705-181204706:- | [2] | |
| Sequence | CGCTGCGGGCAGCATGGCGAACCCTTCAAGCTCTACTGCCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000334421.5; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702551 | ||
| mod ID: M6ASITE073082 | Click to Show/Hide the Full List | ||
| mod site | chr5:181205076-181205077:- | [2] | |
| Sequence | GACCGCGGACCGGCCCCGGAACCGGCGCCGAGGCTCTAGCG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; Jurkat; GSC-11; HEK293T; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000334421.5; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702552 | ||
| mod ID: M6ASITE073083 | Click to Show/Hide the Full List | ||
| mod site | chr5:181205088-181205089:- | [2] | |
| Sequence | TGGCGGCTGTGGGACCGCGGACCGGCCCCGGAACCGGCGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; Jurkat; GSC-11; HEK293T; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000334421.5; ENST00000274773.12 | ||
| External Link | RMBase: m6A_site_702553 | ||
| mod ID: M6ASITE073084 | Click to Show/Hide the Full List | ||
| mod site | chr5:181205095-181205096:- | [2] | |
| Sequence | GCGCGCATGGCGGCTGTGGGACCGCGGACCGGCCCCGGAAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; Jurkat; GSC-11; HEK293T; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274773.12; ENST00000334421.5 | ||
| External Link | RMBase: m6A_site_702554 | ||
References





