m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00546)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ADAMTS9
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | HUVEC cell line | Homo sapiens |
|
Treatment: shMETTL3 HUVEC cells
Control: shScramble HUVEC cells
|
GSE157544 | |
| Regulation |
![]() ![]() |
logFC: 8.11E-01 p-value: 4.51E-05 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 facilitates GC progression through the A disintegrin and metalloproteinase with thrombospondin motifs 9 (ADAMTS9)-mediated PI3K/AKT pathway. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | RNA stability | |||
| In-vitro Model | HGC-27 | Gastric carcinoma | Homo sapiens | CVCL_1279 |
| AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 | |
| In-vivo Model | For the formation of xenograft tumors, 5 × 106 AGS cells mixed in Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) were subcutaneously injected into BALB/c nude mice (5-week-old male). | |||
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 facilitates GC progression through the A disintegrin and metalloproteinase with thrombospondin motifs 9 (ADAMTS9)-mediated PI3K/AKT pathway. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | RNA stability | |||
| In-vitro Model | HGC-27 | Gastric carcinoma | Homo sapiens | CVCL_1279 |
| AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 | |
| In-vivo Model | For the formation of xenograft tumors, 5 × 106 AGS cells mixed in Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) were subcutaneously injected into BALB/c nude mice (5-week-old male). | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03655 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 trimethylation (H3K27me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Gastric cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00546)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE011980 | Click to Show/Hide the Full List | ||
| mod site | chr3:64532110-64532111:- | [2] | |
| Sequence | TCTCACCGTGGGTGTATAGTAGAATCACCTGAGGAATTTTT | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000481060.2; ENST00000467257.5; rmsk_988251 | ||
| External Link | RMBase: RNA-editing_site_97769 | ||
| mod ID: A2ISITE011981 | Click to Show/Hide the Full List | ||
| mod site | chr3:64631829-64631830:- | [2] | |
| Sequence | TCATGCAAAACAGTGGCAGGAACATTTAATACAGTACATTA | ||
| Transcript ID List | ENST00000482490.5; ENST00000295903.8; ENST00000475557.5; ENST00000498707.5 | ||
| External Link | RMBase: RNA-editing_site_97770 | ||
N6-methyladenosine (m6A)
| In total 57 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE061654 | Click to Show/Hide the Full List | ||
| mod site | chr3:64515766-64515767:- | [3] | |
| Sequence | GCAGTATTCTCCAACTCCAAACAAGCTCTAGAGTGCTCCAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000477180.1; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597215 | ||
| mod ID: M6ASITE061655 | Click to Show/Hide the Full List | ||
| mod site | chr3:64515810-64515811:- | [3] | |
| Sequence | AACCCTGCCCACTTCCAAAGACCAAAGAGATTAGGAAAAGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597216 | ||
| mod ID: M6ASITE061656 | Click to Show/Hide the Full List | ||
| mod site | chr3:64515829-64515830:- | [3] | |
| Sequence | GAAGACACTTGGTTTGAGAAACCCTGCCCACTTCCAAAGAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000498707.5; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597217 | ||
| mod ID: M6ASITE061657 | Click to Show/Hide the Full List | ||
| mod site | chr3:64515845-64515846:- | [3] | |
| Sequence | TTGCCAATGGCCCATGGAAGACACTTGGTTTGAGAAACCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000477180.1; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597218 | ||
| mod ID: M6ASITE061658 | Click to Show/Hide the Full List | ||
| mod site | chr3:64515993-64515994:- | [4] | |
| Sequence | ACGTTTGTGTGAAGAAATGAACTGTGGAGTACAAAATGCTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; A549; H1B; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000477180.1; ENST00000498707.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597219 | ||
| mod ID: M6ASITE061659 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516013-64516014:- | [5] | |
| Sequence | CATGCCCGCTGCAGTAATGGACGTTTGTGTGAAGAAATGAA | ||
| Motif Score | 3.616982143 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000498707.5; ENST00000477180.1; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597220 | ||
| mod ID: M6ASITE061660 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516049-64516050:- | [6] | |
| Sequence | CTCTTCAGGCCATGAGCCTAACACCCTGCCGGTTTTCATGC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000498707.5; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597221 | ||
| mod ID: M6ASITE061661 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516091-64516092:- | [7] | |
| Sequence | CGATTGCCTTTTGCATGAAAACATCGGCTGGTGATGTGACT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; kidney; A549; H1B; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | MeRIP-seq; m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597222 | ||
| mod ID: M6ASITE061662 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516130-64516131:- | [4] | |
| Sequence | CACACCTGGAGAAATTCAGAACCAGGTTCTGAATCATCACG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; A549; hNPCs; Huh7; GSC-11; iSLK; TIME; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000498707.5; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597223 | ||
| mod ID: M6ASITE061663 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516191-64516192:- | [8] | |
| Sequence | CCAAGTTTACCAGTAGAAAGACACAGGATGCACAGAATGGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hNPCs; A549; Huh7; TIME; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597224 | ||
| mod ID: M6ASITE061664 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516309-64516310:- | [7] | |
| Sequence | CACGGTGCCTTGGTCTCTCCACAATCAAATGGAGGATCCCC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597225 | ||
| mod ID: M6ASITE061665 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516377-64516378:- | [8] | |
| Sequence | CTTTTTTGGAAGAGACTTAGACTTTATCCTTATTGTTGTTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; U2OS; A549; Huh7; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597226 | ||
| mod ID: M6ASITE061666 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516383-64516384:- | [8] | |
| Sequence | ATATGCCTTTTTTGGAAGAGACTTAGACTTTATCCTTATTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; U2OS; A549; Huh7; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000477180.1; ENST00000295903.8; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597227 | ||
| mod ID: M6ASITE061667 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516428-64516429:- | [8] | |
| Sequence | AATCACTTGGATGAAATAAGACCAGCTCTTTACCCTTATTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T; U2OS; A549; Huh7; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597228 | ||
| mod ID: M6ASITE061668 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516466-64516467:- | [7] | |
| Sequence | TGAAAGGGAGGAACGGAAGGACAATTTCCAGTGCACAGAAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; kidney; A549; Huh7; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000498707.5; ENST00000477180.1 | ||
| External Link | RMBase: m6A_site_597229 | ||
| mod ID: M6ASITE061669 | Click to Show/Hide the Full List | ||
| mod site | chr3:64516496-64516497:- | [9] | |
| Sequence | CATCCGACTCAGAAATATAAACACTTTTAATGAAAGGGAGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; A549; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000477180.1; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597230 | ||
| mod ID: M6ASITE061670 | Click to Show/Hide the Full List | ||
| mod site | chr3:64541908-64541909:- | [3] | |
| Sequence | GCAATGTTTAACCAATGAGGACCAACCCAGCCACTTATGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000481060.2; ENST00000498707.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597231 | ||
| mod ID: M6ASITE061671 | Click to Show/Hide the Full List | ||
| mod site | chr3:64546800-64546801:- | [3] | |
| Sequence | TCACCCCTGTTACCTGAGGGACTGCCCTGTCTCGGCCACCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000295903.8; ENST00000481060.2 | ||
| External Link | RMBase: m6A_site_597232 | ||
| mod ID: M6ASITE061672 | Click to Show/Hide the Full List | ||
| mod site | chr3:64546858-64546859:- | [3] | |
| Sequence | ATTATGAATACAGCTACCAAACCACCATCAACTGCCCAGGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000481060.2; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597233 | ||
| mod ID: M6ASITE061673 | Click to Show/Hide the Full List | ||
| mod site | chr3:64546922-64546923:- | [3] | |
| Sequence | ACCTGTGGAAAAGGCTACAAACAAAGGCTTGTCTCGTGCAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000481060.2; ENST00000295903.8; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597234 | ||
| mod ID: M6ASITE061674 | Click to Show/Hide the Full List | ||
| mod site | chr3:64550162-64550163:- | [3] | |
| Sequence | ACCCTTTTTAATGGTAATAAACCAGTAGTAATCATAGCATG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000481060.2; ENST00000482490.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597235 | ||
| mod ID: M6ASITE061675 | Click to Show/Hide the Full List | ||
| mod site | chr3:64550876-64550877:- | [3] | |
| Sequence | TCAGAGGTACCGTCCTGGGAACTGTAACCATCGTCAGCTCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000481060.2; ENST00000498707.5; ENST00000482490.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597236 | ||
| mod ID: M6ASITE061676 | Click to Show/Hide the Full List | ||
| mod site | chr3:64550952-64550953:- | [3] | |
| Sequence | CGTGAGCAAGCGGCCGGTGGACCGTGAAAGCTGTAGTTTGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000498707.5; ENST00000481060.2; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597237 | ||
| mod ID: M6ASITE061677 | Click to Show/Hide the Full List | ||
| mod site | chr3:64551052-64551053:- | [3] | |
| Sequence | GTATTTAACAGTGCACCAAGACCTGCGGCGAAGGCTCCAGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000482490.5; ENST00000481060.2; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597238 | ||
| mod ID: M6ASITE061678 | Click to Show/Hide the Full List | ||
| mod site | chr3:64561649-64561650:- | [3] | |
| Sequence | GAGTGCAACCCATACACCAGACCGGAGTCGGAACGCGACTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000482490.5; ENST00000295903.8; ENST00000481060.2 | ||
| External Link | RMBase: m6A_site_597240 | ||
| mod ID: M6ASITE061679 | Click to Show/Hide the Full List | ||
| mod site | chr3:64561672-64561673:- | [3] | |
| Sequence | CACACAAAATAGCCAGAGAGACCGAGTGCAACCCATACACC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000295903.8; ENST00000481060.2; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597241 | ||
| mod ID: M6ASITE061680 | Click to Show/Hide the Full List | ||
| mod site | chr3:64561693-64561694:- | [3] | |
| Sequence | ATGTGGGCTGTCAGATCGGAACACACAAAATAGCCAGAGAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000481060.2; ENST00000295903.8; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597242 | ||
| mod ID: M6ASITE061681 | Click to Show/Hide the Full List | ||
| mod site | chr3:64596895-64596896:- | [3] | |
| Sequence | GACTGTGTGGAGAGAATAAAACCTGATGAGCAAAGAGCCTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000498707.5; ENST00000295903.8; ENST00000481060.2 | ||
| External Link | RMBase: m6A_site_597246 | ||
| mod ID: M6ASITE061682 | Click to Show/Hide the Full List | ||
| mod site | chr3:64601960-64601961:- | [3] | |
| Sequence | TCGGTGGAAACCAGTGGAGAACTGGCCCCTGGGGAGCAGTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000482490.5; ENST00000498707.5; ENST00000481060.2 | ||
| External Link | RMBase: m6A_site_597247 | ||
| mod ID: M6ASITE061683 | Click to Show/Hide the Full List | ||
| mod site | chr3:64601971-64601972:- | [3] | |
| Sequence | CACCCATGTGCTCGGTGGAAACCAGTGGAGAACTGGCCCCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000482490.5; ENST00000481060.2; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597248 | ||
| mod ID: M6ASITE061684 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602022-64602023:- | [3] | |
| Sequence | GCACCCCTTCCAAAATGAGGACTATCGTCCCCGGAGCGCCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000481060.2; ENST00000482490.5; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597249 | ||
| mod ID: M6ASITE061685 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602058-64602059:- | [3] | |
| Sequence | ATGCCCTCAAAGGACCCCAGACAGTGGCTTAGCTCAGCACC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000295903.8; ENST00000481060.2; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597250 | ||
| mod ID: M6ASITE061686 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602065-64602066:- | [3] | |
| Sequence | TGTCACCATGCCCTCAAAGGACCCCAGACAGTGGCTTAGCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000482490.5; ENST00000481060.2; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597251 | ||
| mod ID: M6ASITE061687 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602094-64602095:- | [3] | |
| Sequence | TATCCCAGAAACTGACCAGGACTGTTCCATGTCACCATGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000482490.5; ENST00000498707.5; ENST00000481060.2 | ||
| External Link | RMBase: m6A_site_597252 | ||
| mod ID: M6ASITE061688 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602100-64602101:- | [5] | |
| Sequence | GGATTATATCCCAGAAACTGACCAGGACTGTTCCATGTCAC | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000295903.8; ENST00000481060.2; ENST00000498707.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597253 | ||
| mod ID: M6ASITE061689 | Click to Show/Hide the Full List | ||
| mod site | chr3:64602104-64602105:- | [3] | |
| Sequence | ACCAGGATTATATCCCAGAAACTGACCAGGACTGTTCCATG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000481060.2; ENST00000295903.8; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597254 | ||
| mod ID: M6ASITE061690 | Click to Show/Hide the Full List | ||
| mod site | chr3:64603931-64603932:- | [3] | |
| Sequence | TGGGCAATGGAAGGCCTTGGACTGGAGCTCTGTAAGCCAGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000481060.2; ENST00000498707.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597255 | ||
| mod ID: M6ASITE061691 | Click to Show/Hide the Full List | ||
| mod site | chr3:64603987-64603988:- | [3] | |
| Sequence | GCCTGTGCTACCCTGCCTAGACCAGTGGCAAAGGAAGAATG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000481060.2; ENST00000498707.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597256 | ||
| mod ID: M6ASITE061692 | Click to Show/Hide the Full List | ||
| mod site | chr3:64614913-64614914:- | [3] | |
| Sequence | CTTTGAAATAAGAGAATTAGACCCCAGGGAGTGACCTCTCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475557.5; ENST00000498707.5; ENST00000482490.5; ENST00000481060.2; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597257 | ||
| mod ID: M6ASITE061693 | Click to Show/Hide the Full List | ||
| mod site | chr3:64641852-64641853:- | [3] | |
| Sequence | GCCATTCGAGAGTGCAACAGACCAGAGTAAGTCCTAGAATG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475557.5; ENST00000295903.8; ENST00000498707.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597258 | ||
| mod ID: M6ASITE061694 | Click to Show/Hide the Full List | ||
| mod site | chr3:64641875-64641876:- | [3] | |
| Sequence | CATGTGGAGGGGGCATCAAAACAGCCATTCGAGAGTGCAAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000482490.5; ENST00000498707.5; ENST00000475557.5 | ||
| External Link | RMBase: m6A_site_597259 | ||
| mod ID: M6ASITE061695 | Click to Show/Hide the Full List | ||
| mod site | chr3:64641896-64641897:- | [3] | |
| Sequence | CCTTTGGAACCTGCTCCAGAACATGTGGAGGGGGCATCAAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000295903.8; ENST00000498707.5; ENST00000475557.5 | ||
| External Link | RMBase: m6A_site_597260 | ||
| mod ID: M6ASITE061696 | Click to Show/Hide the Full List | ||
| mod site | chr3:64641908-64641909:- | [3] | |
| Sequence | GAAGTTGGAGTCCCTTTGGAACCTGCTCCAGAACATGTGGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000498707.5; ENST00000482490.5; ENST00000475557.5 | ||
| External Link | RMBase: m6A_site_597261 | ||
| mod ID: M6ASITE061697 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658535-64658536:- | [3] | |
| Sequence | GGTTTCATACCATGGAGAAAACCTTCAACACTATATTTTAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000459780.1; ENST00000295903.8; ENST00000475557.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597262 | ||
| mod ID: M6ASITE061698 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658565-64658566:- | [3] | |
| Sequence | AGAAGTCTTGGTGGTGGCAGACAACAGAATGGTTTCATACC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000459780.1; ENST00000295903.8; ENST00000475557.5; ENST00000482490.5 | ||
| External Link | RMBase: m6A_site_597263 | ||
| mod ID: M6ASITE061699 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658617-64658618:- | [8] | |
| Sequence | AAAAGAGGACCCACAGAAGGACAAAACGTTTTTTATCCTAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; hNPCs; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000475557.5; ENST00000295903.8; ENST00000498707.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597264 | ||
| mod ID: M6ASITE061700 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658629-64658630:- | [8] | |
| Sequence | ACAACACAAGAGAAAAGAGGACCCACAGAAGGACAAAACGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; hNPCs; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000459780.1; ENST00000482490.5; ENST00000475557.5; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597265 | ||
| mod ID: M6ASITE061701 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658649-64658650:- | [6] | |
| Sequence | TGCTTATGGTAATAAGACGGACAACACAAGAGAAAAGAGGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T; hNPCs; A549; Huh7; HEC-1-A | ||
| Seq Type List | MAZTER-seq; MeRIP-seq; m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000498707.5; ENST00000482490.5; ENST00000295903.8; ENST00000475557.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597266 | ||
| mod ID: M6ASITE061702 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658697-64658698:- | [8] | |
| Sequence | TGGTGACGTAGCAGCATTAAACAGCGGCTTAGCAACAGAGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hNPCs; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000482490.5; ENST00000498707.5; ENST00000459780.1; ENST00000475557.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597267 | ||
| mod ID: M6ASITE061703 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658755-64658756:- | [9] | |
| Sequence | ACAGTAAAGACAAGAAGAAAACCAGAGCAAGAAAATGGGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hNPCs; Huh7; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000475557.5; ENST00000459780.1; ENST00000295903.8; ENST00000482490.5; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597268 | ||
| mod ID: M6ASITE061704 | Click to Show/Hide the Full List | ||
| mod site | chr3:64658766-64658767:- | [9] | |
| Sequence | CAAAAATAGGCACAGTAAAGACAAGAAGAAAACCAGAGCAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hNPCs; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000475557.5; ENST00000295903.8; ENST00000498707.5; ENST00000482490.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597269 | ||
| mod ID: M6ASITE061705 | Click to Show/Hide the Full List | ||
| mod site | chr3:64686900-64686901:- | [3] | |
| Sequence | CGAGTGAACGCTCTCGGAGAACCCTTTCCCACGAACGTCCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475557.5; ENST00000459780.1; ENST00000498707.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597275 | ||
| mod ID: M6ASITE061706 | Click to Show/Hide the Full List | ||
| mod site | chr3:64686953-64686954:- | [3] | |
| Sequence | CCGCAGTGAAATTATTAGAGACCCTGAGCGAATACGAAATC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000475557.5; ENST00000498707.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597276 | ||
| mod ID: M6ASITE061707 | Click to Show/Hide the Full List | ||
| mod site | chr3:64687562-64687563:- | [3] | |
| Sequence | CGCGGCGGCCGTGCGCAAGGACAGGCTGCACCCGAGGCAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000295903.8; ENST00000475557.5; ENST00000498707.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597277 | ||
| mod ID: M6ASITE061708 | Click to Show/Hide the Full List | ||
| mod site | chr3:64687610-64687611:- | [3] | |
| Sequence | GCTAACGCTCCTGGTGCGGGACCTGGCCGAGATGGGGAGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000459780.1; ENST00000475557.5; ENST00000295903.8 | ||
| External Link | RMBase: m6A_site_597278 | ||
| mod ID: M6ASITE061709 | Click to Show/Hide the Full List | ||
| mod site | chr3:64687801-64687802:- | [10] | |
| Sequence | GACGGGACCCTCGCAGCGAGACCTCAGCGACTCCTAAAGTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | GSC-11; HEK293T; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000498707.5; ENST00000459780.1 | ||
| External Link | RMBase: m6A_site_597279 | ||
| mod ID: M6ASITE061710 | Click to Show/Hide the Full List | ||
| mod site | chr3:64687815-64687816:- | [10] | |
| Sequence | CTCAGCCGAGCGCAGACGGGACCCTCGCAGCGAGACCTCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | GSC-11; HEK293T; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000459780.1; ENST00000498707.5 | ||
| External Link | RMBase: m6A_site_597280 | ||
References

