m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00532)
Target Name Mothers against decapentaplegic homolog 2 (SMAD2)
Synonyms
MAD homolog 2; Mothers against DPP homolog 2; JV18-1; Mad-related protein 2; hMAD-2; SMAD family member 2; SMAD 2; Smad2; hSMAD2
    Click to Show/Hide
Gene Name SMAD2
Chromosomal Location 18q21.1
Family Dwarfin/SMAD family
Function
Receptor-regulated SMAD (R-SMAD) that is an intracellular signal transducer and transcriptional modulator activated by TGF-beta (transforming growth factor) and activin type 1 receptor kinases. Binds the TRE element in the promoter region of many genes that are regulated by TGF-beta and, on formation of the SMAD2/SMAD4 complex, activates transcription. May act as a tumor suppressor in colorectal carcinoma. Positively regulates PDPK1 kinase activity by stimulating its dissociation from the 14-3-3 protein YWHAQ which acts as a negative regulator.
    Click to Show/Hide
Gene ID 4087
Uniprot ID
SMAD2_HUMAN
HGNC ID
HGNC:6768
KEGG ID
hsa:4087
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SMAD2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HNRNPA2B1, as an m6A reader, is critical in OSCC development. Its expression is significantly associated with the prognosis of Oral Squamous Cell Carcinoma(OSCC). m6A acts as a proto-oncogene that promotes the OSCC proliferation, migration, and invasion through the EMT progression via the LINE-1/TGF-beta1/Snail/Mothers against decapentaplegic homolog 2 (SMAD2) signaling pathway.
Target Regulation Up regulation
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E.0
 Disease Info 
Pathway Response TGF-beta signaling pathway hsa04350
In-vitro Model SCC-4 Tongue squamous cell carcinoma Homo sapiens CVCL_1684
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary YTHDF2 inhibits the migration and invasion of lung adenocarcinoma cells by regulating the FAM83D-TGFbeta1-Mothers against decapentaplegic homolog 2 (SMAD2) pathway, which will play an important role in lung cancer metastasis.
Target Regulation Down regulation
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response mRNA surveillance pathway hsa03015
Cell Process Epithelial-mesenchymal transition
In-vitro Model NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
Head and neck squamous carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary HNRNPA2B1, as an m6A reader, is critical in OSCC development. Its expression is significantly associated with the prognosis of Oral Squamous Cell Carcinoma(OSCC). m6A acts as a proto-oncogene that promotes the OSCC proliferation, migration, and invasion through the EMT progression via the LINE-1/TGF-beta1/Snail/Mothers against decapentaplegic homolog 2 (SMAD2) signaling pathway.
Responsed Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response TGF-beta signaling pathway hsa04350
In-vitro Model SCC-4 Tongue squamous cell carcinoma Homo sapiens CVCL_1684
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary YTHDF2 inhibits the migration and invasion of lung adenocarcinoma cells by regulating the FAM83D-TGFbeta1-Mothers against decapentaplegic homolog 2 (SMAD2) pathway, which will play an important role in lung cancer metastasis.
Responsed Disease Lung cancer [ICD-11: 2C25]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Pathway Response mRNA surveillance pathway hsa03015
Cell Process Epithelial-mesenchymal transition
In-vitro Model NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02139
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship DNA modification → m6A
Disease Lung cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00532)
Mothers against decapentaplegic homolog 2 (SMAD2)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008617 Click to Show/Hide the Full List
mod site chr18:47812562-47812563:- [3]
Sequence TCATGATAGTGAATTCTCACAGGATCTGATGGTTTTATAAA
Transcript ID List ENST00000262160.11; rmsk_4855081
External Link RMBase: RNA-editing_site_63461
mod ID: A2ISITE008618 Click to Show/Hide the Full List
mod site chr18:47850913-47850914:- [3]
Sequence ATATACACATTGACATAAATATGTATACATGTATACGTAGT
Transcript ID List ENST00000586040.5; ENST00000262160.11; ENST00000591214.5; ENST00000402690.6; ENST00000356825.8
External Link RMBase: RNA-editing_site_63462
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001494 Click to Show/Hide the Full List
mod site chr18:47840610-47840611:- [4]
Sequence GATCAGCAGATATGGGCCATCTGTTTTTAAAGTATGTTGTA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000356825.8; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m5C_site_20994
mod ID: M5CSITE001495 Click to Show/Hide the Full List
mod site chr18:47841857-47841858:- [4]
Sequence AGTATTAACTCAGATGGGATCCCCTTCAGTGCGTTGCTCAA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8; ENST00000586040.5
External Link RMBase: m5C_site_20995
N6-methyladenosine (m6A)
In total 81 m6A sequence/site(s) in this target gene
mod ID: M6ASITE036979 Click to Show/Hide the Full List
mod site chr18:47809105-47809106:- [5]
Sequence TCTGTGATCTGTTGTTGAGAACTGCTGCTGAGAATTCTTCC
Motif Score 3.373380952
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400675
mod ID: M6ASITE036980 Click to Show/Hide the Full List
mod site chr18:47809136-47809137:- [5]
Sequence CCCAGAGATGCCCGAGGAGGACAGCCTTGTTTCTGTGATCT
Motif Score 3.643047619
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400676
mod ID: M6ASITE036981 Click to Show/Hide the Full List
mod site chr18:47809210-47809211:- [5]
Sequence TCTGACCCCCAAGTACAGGGACTGCCTCTTTCCGTAACGGC
Motif Score 4.065041667
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400677
mod ID: M6ASITE036982 Click to Show/Hide the Full List
mod site chr18:47809246-47809247:- [5]
Sequence GGAAAGAAGAAACTAGAGAAACTGGAATGCTTCCTATCTGA
Motif Score 2.627720238
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400678
mod ID: M6ASITE036983 Click to Show/Hide the Full List
mod site chr18:47809255-47809256:- [5]
Sequence AGAGGAAGGGGAAAGAAGAAACTAGAGAAACTGGAATGCTT
Motif Score 2.627720238
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400679
mod ID: M6ASITE036984 Click to Show/Hide the Full List
mod site chr18:47809284-47809285:- [5]
Sequence TCTGCCATATGCTTCAAGGAACTGAATAAAGAGGAAGGGGA
Motif Score 3.373380952
Cell/Tissue List HeLa; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400680
mod ID: M6ASITE036985 Click to Show/Hide the Full List
mod site chr18:47810268-47810269:- [5]
Sequence AAGGCTCAGGAGGTTTGGGGACAGGGAAATGACTTGGTTGG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400681
mod ID: M6ASITE036986 Click to Show/Hide the Full List
mod site chr18:47820434-47820435:- [6]
Sequence CTAATAAACTCTGAATTTAAACAACTTTTTTCCCAATAAAA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400682
mod ID: M6ASITE036987 Click to Show/Hide the Full List
mod site chr18:47820447-47820448:- [6]
Sequence TTTGAAACAACCTCTAATAAACTCTGAATTTAAACAACTTT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400683
mod ID: M6ASITE036988 Click to Show/Hide the Full List
mod site chr18:47820461-47820462:- [6]
Sequence GTCTTGTTTCCATATTTGAAACAACCTCTAATAAACTCTGA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400684
mod ID: M6ASITE036989 Click to Show/Hide the Full List
mod site chr18:47821162-47821163:- [6]
Sequence TCAGGATCTTCAAGAAGAAAACTCTACCTCAAGAAATGAAA
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400685
mod ID: M6ASITE036990 Click to Show/Hide the Full List
mod site chr18:47821198-47821199:- [6]
Sequence CAAGATACAGCAAAGGTTGAACTTGTGAGATATAAATCAGG
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400686
mod ID: M6ASITE036991 Click to Show/Hide the Full List
mod site chr18:47821290-47821291:- [5]
Sequence AGAGTTATCACCCCTGCCAAACAAAAAGATGTACCTTCTTA
Motif Score 2.20572619
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400687
mod ID: M6ASITE036992 Click to Show/Hide the Full List
mod site chr18:47824025-47824026:- [7]
Sequence AACTAAAAGTCAGTGTTAAAACCCTTTTAGCCACCTTTGAG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400688
mod ID: M6ASITE036993 Click to Show/Hide the Full List
mod site chr18:47826134-47826135:- [5]
Sequence ATCTAATATACATAAGGAAGACAAAAGCAAAGGATTGTGTT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400689
mod ID: M6ASITE036994 Click to Show/Hide the Full List
mod site chr18:47827981-47827982:- [5]
Sequence AGGCGCTCCTCACTTCCCAGACTGGGCGGCCGGGCTGAGGG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400690
mod ID: M6ASITE036995 Click to Show/Hide the Full List
mod site chr18:47828075-47828076:- [5]
Sequence GGGGTGGCGGTCGGGCAGAGACACTCCTCACATCCCAGACG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11
External Link RMBase: m6A_site_400691
mod ID: M6ASITE036996 Click to Show/Hide the Full List
mod site chr18:47832405-47832406:- [5]
Sequence CACTTTTTTATTAGGAAGAAACCCAAGAAAATTTACTGTAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400692
mod ID: M6ASITE036997 Click to Show/Hide the Full List
mod site chr18:47832444-47832445:- [5]
Sequence TGGCATTGAATAGCCTTGGGACTGGTGTAGTTTTATCAACA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400693
mod ID: M6ASITE036998 Click to Show/Hide the Full List
mod site chr18:47835052-47835053:- [5]
Sequence AACAGTTCTGCAGTTGTTGAACTAGATCACAGCATTGTAGG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400694
mod ID: M6ASITE036999 Click to Show/Hide the Full List
mod site chr18:47835071-47835072:- [5]
Sequence CTACAGCGATTAAGATGAGAACAGTTCTGCAGTTGTTGAAC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400695
mod ID: M6ASITE037000 Click to Show/Hide the Full List
mod site chr18:47835092-47835093:- [5]
Sequence AAAAGAGTAAAGAAAGAAAAACTACAGCGATTAAGATGAGA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400696
mod ID: M6ASITE037001 Click to Show/Hide the Full List
mod site chr18:47835219-47835220:- [5]
Sequence CCAAATTGGTACTTTCTTAGACCAGTGTAACCTCACACCTC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000356825.8; ENST00000402690.6
External Link RMBase: m6A_site_400697
mod ID: M6ASITE037002 Click to Show/Hide the Full List
mod site chr18:47835241-47835242:- [5]
Sequence ACTGTTTGACAAAATATAGAACCCAAATTGGTACTTTCTTA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000262160.11; ENST00000356825.8
External Link RMBase: m6A_site_400698
mod ID: M6ASITE037003 Click to Show/Hide the Full List
mod site chr18:47835266-47835267:- [5]
Sequence AGTTTTGAATTTTTTTAAAAACCCAACTGTTTGACAAAATA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400699
mod ID: M6ASITE037004 Click to Show/Hide the Full List
mod site chr18:47836980-47836981:- [5]
Sequence ATTGGATTGTTGTATTTAAGACAGTCAGAATAATGATAGTG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000356825.8; ENST00000402690.6
External Link RMBase: m6A_site_400700
mod ID: M6ASITE037005 Click to Show/Hide the Full List
mod site chr18:47837061-47837062:- [5]
Sequence AATTATGTTTAAGATTATGAACTTTTCTGACAGTTGCAGCC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400701
mod ID: M6ASITE037006 Click to Show/Hide the Full List
mod site chr18:47838496-47838497:- [5]
Sequence AATACACATTCAGTTAGTAAACATTTATTGATGCCTGTTGT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400702
mod ID: M6ASITE037007 Click to Show/Hide the Full List
mod site chr18:47838799-47838800:- [5]
Sequence TTCCAGTAGGTTCCACAGAGACACCTTGGGGGCTGGCTTAG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400703
mod ID: M6ASITE037008 Click to Show/Hide the Full List
mod site chr18:47838867-47838868:- [5]
Sequence CTAGGAATGATGACCTGAGAACCGAATGGCCATGCTTTCTA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400704
mod ID: M6ASITE037009 Click to Show/Hide the Full List
mod site chr18:47839320-47839321:- [5]
Sequence AACAGTTGTAGGGGCAGAAAACAACTCTGAAAGTGGTAGAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400705
mod ID: M6ASITE037010 Click to Show/Hide the Full List
mod site chr18:47839339-47839340:- [5]
Sequence ACTTGTAATGGTGTTAGGGAACAGTTGTAGGGGCAGAAAAC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400706
mod ID: M6ASITE037011 Click to Show/Hide the Full List
mod site chr18:47839359-47839360:- [5]
Sequence CTTCTTTTTCTTACTTGAGAACTTGTAATGGTGTTAGGGAA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000262160.11; ENST00000356825.8
External Link RMBase: m6A_site_400707
mod ID: M6ASITE037012 Click to Show/Hide the Full List
mod site chr18:47839491-47839492:- [5]
Sequence GCCCTGCTGCTTGCTTCCAGACTTTGTGCTGTCCAGTAATT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400708
mod ID: M6ASITE037013 Click to Show/Hide the Full List
mod site chr18:47839892-47839893:- [5]
Sequence GATGGGATGCTTCAGGTAGGACATCAAGGAAAGCCTCTAAG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000356825.8; ENST00000262160.11
External Link RMBase: m6A_site_400709
mod ID: M6ASITE037014 Click to Show/Hide the Full List
mod site chr18:47839938-47839939:- [5]
Sequence CTTGTCTATGAAGGAGATAAACAGGGTACTGTACTGGAGAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400710
mod ID: M6ASITE037015 Click to Show/Hide the Full List
mod site chr18:47840937-47840938:- [8]
Sequence TGTCTTATGCCCAAATTTCAACAGGAATAATTGGCTTGTAT
Motif Score 2.173910714
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400711
mod ID: M6ASITE037016 Click to Show/Hide the Full List
mod site chr18:47841057-47841058:- [5]
Sequence TTTTTGTCCTCATAATCAAAACAGCATAACATGACATCATC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400712
mod ID: M6ASITE037017 Click to Show/Hide the Full List
mod site chr18:47841396-47841397:- [9]
Sequence AACCTTTATAAAGTTGCAGTACCTAATCTGTTATTCCCACT
Motif Score 2.8355
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000586040.5; ENST00000356825.8; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400713
mod ID: M6ASITE037018 Click to Show/Hide the Full List
mod site chr18:47841415-47841416:- [5]
Sequence CTGCTTCTTGATCTAGGCAAACCTTTATAAAGTTGCAGTAC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000356825.8; ENST00000402690.6; ENST00000586040.5
External Link RMBase: m6A_site_400714
mod ID: M6ASITE037019 Click to Show/Hide the Full List
mod site chr18:47841565-47841566:- [5]
Sequence GATGTCTTATTGGGCATAAAACTGAGTGTCCCAAAGGTTTA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; hNPCs; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000356825.8; ENST00000586040.5; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400715
mod ID: M6ASITE037020 Click to Show/Hide the Full List
mod site chr18:47841592-47841593:- [5]
Sequence AGGAAGAGAAGATTTTAAAGACTTAATGATGTCTTATTGGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; hNPCs; A549; CD8T; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000262160.11; ENST00000586040.5; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400716
mod ID: M6ASITE037021 Click to Show/Hide the Full List
mod site chr18:47841716-47841717:- [5]
Sequence CCAAAAGTTCAAGAGAGAAAACAGCACTTGAGGTCTCATCA
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000402690.6; ENST00000262160.11; ENST00000586040.5; ENST00000356825.8
External Link RMBase: m6A_site_400717
mod ID: M6ASITE037022 Click to Show/Hide the Full List
mod site chr18:47841741-47841742:- [9]
Sequence GTGGTCCCTATGGACTGTTTACTATCCAAAAGTTCAAGAGA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000402690.6; ENST00000586040.5; ENST00000262160.11; ENST00000356825.8
External Link RMBase: m6A_site_400718
mod ID: M6ASITE037023 Click to Show/Hide the Full List
mod site chr18:47841748-47841749:- [5]
Sequence ATTGTGTGTGGTCCCTATGGACTGTTTACTATCCAAAAGTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000356825.8; ENST00000262160.11; ENST00000586040.5; ENST00000402690.6
External Link RMBase: m6A_site_400719
mod ID: M6ASITE037024 Click to Show/Hide the Full List
mod site chr18:47841787-47841788:- [10]
Sequence CCATGAAAAGACTTAATGTAACAACTCTTCTGTCATAGCAT
Motif Score 2.168095238
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000402690.6; ENST00000586040.5; ENST00000262160.11; ENST00000356825.8
External Link RMBase: m6A_site_400720
mod ID: M6ASITE037025 Click to Show/Hide the Full List
mod site chr18:47841797-47841798:- [5]
Sequence CAATCAAGTCCCATGAAAAGACTTAATGTAACAACTCTTCT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000586040.5; ENST00000356825.8; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400721
mod ID: M6ASITE037026 Click to Show/Hide the Full List
mod site chr18:47841870-47841871:- [9]
Sequence AGTGGTTGGACAAAGTATTAACTCAGATGGGATCCCCTTCA
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000262160.11; ENST00000402690.6; ENST00000586040.5; ENST00000356825.8
External Link RMBase: m6A_site_400722
mod ID: M6ASITE037027 Click to Show/Hide the Full List
mod site chr18:47841881-47841882:- [5]
Sequence TGGACCTCTACAGTGGTTGGACAAAGTATTAACTCAGATGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000586040.5; ENST00000262160.11; ENST00000402690.6; ENST00000356825.8
External Link RMBase: m6A_site_400723
mod ID: M6ASITE037028 Click to Show/Hide the Full List
mod site chr18:47841898-47841899:- [5]
Sequence ATTGAACTTCATCTGAATGGACCTCTACAGTGGTTGGACAA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000356825.8; ENST00000586040.5; ENST00000402690.6; ENST00000262160.11
External Link RMBase: m6A_site_400724
mod ID: M6ASITE037029 Click to Show/Hide the Full List
mod site chr18:47841913-47841914:- [5]
Sequence AGTACTCCTTGCTGGATTGAACTTCATCTGAATGGACCTCT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11; ENST00000356825.8; ENST00000402690.6; ENST00000586040.5
External Link RMBase: m6A_site_400725
mod ID: M6ASITE037030 Click to Show/Hide the Full List
mod site chr18:47841936-47841937:- [8]
Sequence TAAACAGAAGGCAGACGGTAACAAGTACTCCTTGCTGGATT
Motif Score 2.168095238
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000586040.5; ENST00000262160.11; ENST00000356825.8; ENST00000402690.6
External Link RMBase: m6A_site_400726
mod ID: M6ASITE037031 Click to Show/Hide the Full List
mod site chr18:47845022-47845023:-
Sequence GCACACGGTGCTCAAGGAAAACTTGATGGCACATGATCTAG
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000591214.5; ENST00000262160.11; ENST00000356825.8; ENST00000586040.5; ENST00000402690.6
External Link RMBase: m6A_site_400727
mod ID: M6ASITE037032 Click to Show/Hide the Full List
mod site chr18:47848560-47848561:- [5]
Sequence CACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000356825.8; ENST00000586040.5; ENST00000591214.5; ENST00000262160.11
External Link RMBase: m6A_site_400728
mod ID: M6ASITE037033 Click to Show/Hide the Full List
mod site chr18:47848606-47848607:- [5]
Sequence TAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000586040.5; ENST00000356825.8; ENST00000262160.11; ENST00000591214.5
External Link RMBase: m6A_site_400729
mod ID: M6ASITE037034 Click to Show/Hide the Full List
mod site chr18:47848661-47848662:- [5]
Sequence CAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGAT
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000591214.5; ENST00000262160.11; ENST00000586040.5; ENST00000356825.8; ENST00000402690.6
External Link RMBase: m6A_site_400730
mod ID: M6ASITE037035 Click to Show/Hide the Full List
mod site chr18:47851313-47851314:- [5]
Sequence GTTTTAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000586040.5; ENST00000591214.5; ENST00000262160.11; ENST00000356825.8
External Link RMBase: m6A_site_400731
mod ID: M6ASITE037036 Click to Show/Hide the Full List
mod site chr18:47853282-47853283:- [6]
Sequence TTCCCGGACGTCTAAACCAAACCACTTTCACTGCTACACGA
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000402690.6; ENST00000591214.5; ENST00000356825.8; ENST00000591258.1; ENST00000586040.5; ENST00000262160.11
External Link RMBase: m6A_site_400732
mod ID: M6ASITE037037 Click to Show/Hide the Full List
mod site chr18:47853287-47853288:- [6]
Sequence TGCAATTCCCGGACGTCTAAACCAAACCACTTTCACTGCTA
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000591214.5; ENST00000262160.11; ENST00000356825.8; ENST00000402690.6; ENST00000586040.5; ENST00000591258.1
External Link RMBase: m6A_site_400733
mod ID: M6ASITE037038 Click to Show/Hide the Full List
mod site chr18:47853312-47853313:- [6]
Sequence TCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000262160.11; ENST00000591258.1; ENST00000402690.6; ENST00000586040.5; ENST00000356825.8; ENST00000591214.5
External Link RMBase: m6A_site_400734
mod ID: M6ASITE037039 Click to Show/Hide the Full List
mod site chr18:47865063-47865064:- [5]
Sequence ACAGTTGAATCAAAGTATGGACACAGGTAAAAAAAATGTCT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000356825.8; ENST00000262160.11; ENST00000586040.5; ENST00000591214.5
External Link RMBase: m6A_site_400735
mod ID: M6ASITE037040 Click to Show/Hide the Full List
mod site chr18:47868294-47868295:- [5]
Sequence TGCCTTCTGAATCTCCTAAAACTTGGATAGATACAAATTTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000587353.5; ENST00000591214.5; ENST00000262160.11; ENST00000586040.5; ENST00000356825.8
External Link RMBase: m6A_site_400736
mod ID: M6ASITE037041 Click to Show/Hide the Full List
mod site chr18:47868369-47868370:- [5]
Sequence TACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAA
Motif Score 2.20572619
Cell/Tissue List HeLa; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000262160.11; ENST00000356825.8; ENST00000591214.5; ENST00000587269.5; ENST00000586514.5; ENST00000402690.6; ENST00000586040.5; ENST00000587353.5
External Link RMBase: m6A_site_400737
mod ID: M6ASITE037042 Click to Show/Hide the Full List
mod site chr18:47868410-47868411:- [5]
Sequence CACACCGAGATCCTAACAGAACTTCCGCCTCTGGATGACTA
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000262160.11; ENST00000591214.5; ENST00000587269.5; ENST00000586040.5; ENST00000587353.5; ENST00000402690.6; ENST00000586514.5; ENST00000356825.8
External Link RMBase: m6A_site_400738
mod ID: M6ASITE037043 Click to Show/Hide the Full List
mod site chr18:47869248-47869249:- [5]
Sequence ACCACTATCAGAGAGTTGAGACACCAGGTAGGAATATTGCA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000591214.5; ENST00000586514.5; ENST00000587353.5; ENST00000262160.11; ENST00000586040.5; ENST00000402690.6; ENST00000587269.5
External Link RMBase: m6A_site_400739
mod ID: M6ASITE037044 Click to Show/Hide the Full List
mod site chr18:47869274-47869275:- [5]
Sequence AAAGGATGAAGTATGTGTAAACCCTTACCACTATCAGAGAG
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000356825.8; ENST00000586040.5; ENST00000586514.5; ENST00000591214.5; ENST00000587269.5; ENST00000587353.5; ENST00000262160.11
External Link RMBase: m6A_site_400740
mod ID: M6ASITE037045 Click to Show/Hide the Full List
mod site chr18:47869319-47869320:- [5]
Sequence TGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATC
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000586040.5; ENST00000402690.6; ENST00000587269.5; ENST00000356825.8; ENST00000587353.5; ENST00000591214.5; ENST00000262160.11; ENST00000586514.5
External Link RMBase: m6A_site_400741
mod ID: M6ASITE037046 Click to Show/Hide the Full List
mod site chr18:47869336-47869337:- [5]
Sequence GATCTTCACAGTCATCATGAACTCAAGGCAATTGAAAACTG
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000586040.5; ENST00000262160.11; ENST00000587353.5; ENST00000402690.6; ENST00000587269.5; ENST00000586514.5; ENST00000356825.8; ENST00000591214.5
External Link RMBase: m6A_site_400742
mod ID: M6ASITE037047 Click to Show/Hide the Full List
mod site chr18:47870482-47870483:- [5]
Sequence GGCCTTTACAGCTTCTCTGAACAAACCAGGTGAATATTCTG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000587353.5; ENST00000587269.5; ENST00000591214.5; ENST00000587421.5; ENST00000589877.5; ENST00000586514.5; ENST00000402690.6; ENST00000585978.1; ENST00000262160.11; ENST00000586487.2; ENST00000586040.5; ENST00000356825.8
External Link RMBase: m6A_site_400743
mod ID: M6ASITE037048 Click to Show/Hide the Full List
mod site chr18:47870542-47870543:- [5]
Sequence ACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGAT
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000587421.5; ENST00000589877.5; ENST00000402690.6; ENST00000586040.5; ENST00000586487.2; ENST00000585978.1; ENST00000591214.5; ENST00000587269.5; ENST00000587353.5; ENST00000356825.8; ENST00000262160.11; ENST00000586514.5
External Link RMBase: m6A_site_400744
mod ID: M6ASITE037049 Click to Show/Hide the Full List
mod site chr18:47896550-47896551:- [5]
Sequence GAAAGCCATCACCACTCAAAACTGTAATACTAAATGTGTTA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1B; H1A; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000586040.5; ENST00000589877.5; ENST00000587269.5; ENST00000586514.5; ENST00000356825.8; ENST00000591214.5; ENST00000587421.5; ENST00000585978.1; ENST00000262160.11; ENST00000402690.6
External Link RMBase: m6A_site_400745
mod ID: M6ASITE037050 Click to Show/Hide the Full List
mod site chr18:47896588-47896589:- [10]
Sequence AAGAAGCTAAAGAAAACAGGACGATTAGATGAGCTTGAGAA
Motif Score 3.616982143
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000586514.5; ENST00000402690.6; ENST00000591214.5; ENST00000587421.5; ENST00000585978.1; ENST00000262160.11; ENST00000586040.5; ENST00000589877.5; ENST00000356825.8; ENST00000587269.5
External Link RMBase: m6A_site_400746
mod ID: M6ASITE037051 Click to Show/Hide the Full List
mod site chr18:47896593-47896594:- [5]
Sequence TGGTGAAGAAGCTAAAGAAAACAGGACGATTAGATGAGCTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1B; H1A; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000402690.6; ENST00000586040.5; ENST00000587269.5; ENST00000356825.8; ENST00000262160.11; ENST00000587421.5; ENST00000586514.5; ENST00000589877.5; ENST00000591214.5; ENST00000585978.1
External Link RMBase: m6A_site_400747
mod ID: M6ASITE037052 Click to Show/Hide the Full List
mod site chr18:47896714-47896715:- [5]
Sequence ACGCCGCCAGTTGTGAAGAGACTGCTGGGATGGAAGAAGTC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; A549; H1B; H1A; hNPCs; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000586040.5; ENST00000402690.6; ENST00000591214.5; ENST00000585978.1; ENST00000587269.5; ENST00000587421.5; ENST00000586514.5; ENST00000262160.11; ENST00000356825.8; ENST00000589877.5
External Link RMBase: m6A_site_400748
mod ID: M6ASITE037053 Click to Show/Hide the Full List
mod site chr18:47896757-47896758:- [5]
Sequence GCTTGCTGCCTTTGGTAAGAACATGTCGTCCATCTTGCCAT
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; A549; MM6; Huh7; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000591214.5; ENST00000589877.5; ENST00000587421.5; ENST00000262160.11; ENST00000586514.5; ENST00000586040.5; ENST00000587269.5; ENST00000585978.1; ENST00000356825.8; ENST00000402690.6
External Link RMBase: m6A_site_400749
mod ID: M6ASITE037054 Click to Show/Hide the Full List
mod site chr18:47920073-47920074:- [5]
Sequence TCGGACTTGCAGCCTCCGGAACTGTGAGAAATAAATTTCTG
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; A549; HepG2; peripheral-blood; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000262160.11; ENST00000587269.5; ENST00000402690.6; ENST00000586514.5; ENST00000585978.1; rmsk_4855279; ENST00000356825.8; ENST00000587421.5; ENST00000589877.5; ENST00000591214.5
External Link RMBase: m6A_site_400750
mod ID: M6ASITE037055 Click to Show/Hide the Full List
mod site chr18:47920089-47920090:- [5]
Sequence TGCTGGTACCCTGATCTCGGACTTGCAGCCTCCGGAACTGT
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; A549; HepG2; peripheral-blood; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000586514.5; ENST00000356825.8; ENST00000591214.5; ENST00000587269.5; ENST00000585978.1; ENST00000262160.11; ENST00000402690.6; ENST00000589877.5; ENST00000587421.5; rmsk_4855279
External Link RMBase: m6A_site_400751
mod ID: M6ASITE037056 Click to Show/Hide the Full List
mod site chr18:47920118-47920119:- [5]
Sequence AGAAGAGGGCCTTACTTGGAACCTAACCATGCTGGTACCCT
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; A549; HepG2; peripheral-blood
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000356825.8; rmsk_4855279; ENST00000587269.5; ENST00000589877.5; ENST00000591214.5; ENST00000587421.5; ENST00000586514.5; ENST00000262160.11; ENST00000585978.1; ENST00000402690.6
External Link RMBase: m6A_site_400752
mod ID: M6ASITE037057 Click to Show/Hide the Full List
mod site chr18:47930378-47930379:- [5]
Sequence CCCGGATCTGACGGGGCGGGACCTGGCGCCACCTTGCAGGT
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000402690.6; ENST00000589877.5; ENST00000356825.8; ENST00000262160.11; ENST00000586514.5; ENST00000591214.5; ENST00000587269.5
External Link RMBase: m6A_site_400753
mod ID: M6ASITE037058 Click to Show/Hide the Full List
mod site chr18:47930402-47930403:- [5]
Sequence GAAGGAACAAAAGGTCCCGGACCCCCCGGATCTGACGGGGC
Motif Score 3.622404762
Cell/Tissue List HeLa; Jurkat; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000356825.8; ENST00000262160.11; ENST00000589877.5; ENST00000402690.6; ENST00000587269.5; ENST00000591214.5; ENST00000586514.5
External Link RMBase: m6A_site_400754
mod ID: M6ASITE037059 Click to Show/Hide the Full List
mod site chr18:47930416-47930417:- [5]
Sequence TCCCATCGGAAGAGGAAGGAACAAAAGGTCCCGGACCCCCC
Motif Score 2.951386905
Cell/Tissue List HeLa; Jurkat; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000586514.5; ENST00000587269.5; ENST00000402690.6; ENST00000589877.5; ENST00000356825.8; ENST00000262160.11; ENST00000591214.5
External Link RMBase: m6A_site_400755