m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00530)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MMP-3
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | HUVEC cell line | Homo sapiens |
|
Treatment: shMETTL3 HUVEC cells
Control: shScramble HUVEC cells
|
GSE157544 | |
| Regulation |
  |
logFC: -1.52E+00 p-value: 7.27E-05 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 knockdown suppressed interleukin (IL)-6, matrix metalloproteinase Stromelysin-1 (MMP-3), and MMP-9 levels in human RA-FLSs and rat AIA-FLSs. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Rheumatoid arthritis | ICD-11: FA20 | ||
| Cell Process | Inflammatory response | |||
| In-vitro Model | FLS (Rat fibroblast synovial cell line) | |||
| In-vivo Model | To establish the adjuvant-induced arthritis (AIA) model, the rats were given complete Freund's adjuvant (CFA; Chondrex, Inc.) on the left paw of 0.1 ml per 100 g of body weight. Additionally, the rats were injected with normal saline to create the negative control (NC) group. | |||
Rheumatoid arthritis [ICD-11: FA20]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 knockdown suppressed interleukin (IL)-6, matrix metalloproteinase Stromelysin-1 (MMP-3), and MMP-9 levels in human RA-FLSs and rat AIA-FLSs. | |||
| Responsed Disease | Rheumatoid arthritis [ICD-11: FA20] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Inflammatory response | |||
| In-vitro Model | FLS (Rat fibroblast synovial cell line) | |||
| In-vivo Model | To establish the adjuvant-induced arthritis (AIA) model, the rats were given complete Freund's adjuvant (CFA; Chondrex, Inc.) on the left paw of 0.1 ml per 100 g of body weight. Additionally, the rats were injected with normal saline to create the negative control (NC) group. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00530)
| In total 8 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE008323 | Click to Show/Hide the Full List | ||
| mod site | chr11:102842782-102842783:- | [4] | |
| Sequence | GGAGGTGACGGGGAAGCTGGACTCCGACACTCTGGAGGTGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161280 | ||
| mod ID: M6ASITE008324 | Click to Show/Hide the Full List | ||
| mod site | chr11:102842854-102842855:- | [4] | |
| Sequence | ACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTTGTTAAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000524478.1; ENST00000299855.10 | ||
| External Link | RMBase: m6A_site_161281 | ||
| mod ID: M6ASITE008325 | Click to Show/Hide the Full List | ||
| mod site | chr11:102842874-102842875:- | [4] | |
| Sequence | GACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161282 | ||
| mod ID: M6ASITE008326 | Click to Show/Hide the Full List | ||
| mod site | chr11:102842902-102842903:- | [5] | |
| Sequence | CTGTTAGAAATATCTAGAAAACTACTACGACCTCAAAAAAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MSC; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161283 | ||
| mod ID: M6ASITE008327 | Click to Show/Hide the Full List | ||
| mod site | chr11:102843451-102843452:- | [5] | |
| Sequence | GGGTGAGGACACCAGCATGAACCTTGTTCAGGTAATTAACA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | MSC; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161284 | ||
| mod ID: M6ASITE008328 | Click to Show/Hide the Full List | ||
| mod site | chr11:102843463-102843464:- | [5] | |
| Sequence | TGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MSC; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161285 | ||
| mod ID: M6ASITE008329 | Click to Show/Hide the Full List | ||
| mod site | chr11:102843575-102843576:- | [5] | |
| Sequence | CAAGACAGCAAGGCATAGAGACAACATAGAGCTAAGTAAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MSC; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161286 | ||
| mod ID: M6ASITE008330 | Click to Show/Hide the Full List | ||
| mod site | chr11:102843591-102843592:- | [5] | |
| Sequence | CCTACAAGGAGGCAGGCAAGACAGCAAGGCATAGAGACAAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000299855.10; ENST00000524478.1 | ||
| External Link | RMBase: m6A_site_161287 | ||
References