m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00527)

Target Name	Arrestin domain-containing protein 4 (ARRDC4)
Gene Name	ARRDC4
Chromosomal Location	15q26.2
Family	Arrestin family
Function	Functions as an adapter recruiting ubiquitin-protein ligases to their specific substrates (By similarity). Plays a role in endocytosis of activated G protein-coupled receptors (GPCRs) (Probable). Through an ubiquitination-dependent mechanism plays also a role in the incorporation of SLC11A2 into extracellular vesicles (By similarity). May play a role in glucose uptake. Click to Show/Hide
Gene ID	91947
Uniprot ID	ARRD4_HUMAN
HGNC ID	HGNC:28087
KEGG ID	hsa:91947

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ARRDC4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Human umbilical cord blood CD34+ cells	Homo sapiens
Treatment: YTHDF2 knockdown UCB CD34+ cells Control: Wild type UCB CD34+ cells		GSE107956
Regulation		logFC: -8.12E-01 p-value: 3.74E-05
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ARRDC4 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.87E+00	GSE49339

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL14 significantly enhanced Arrestin domain-containing protein 4 (ARRDC4) mRNA stability relying on the "reader" protein YTHDF2 dependent manner in colorectal cancer.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	NCM460	Normal	Homo sapiens	CVCL_0460
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	Equal amount of HCT116 cells (2 × 10⁶) stably expression of relevant plasmids was injected into the right flank of mice, tumor bulks was monitored once a week after injection and volumes were counted as 0.5 × a2 × b (a and b respectively indicated short and long diameter of tumor).

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: -1.00E+00 p-value: 7.16E-13
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL14 significantly enhanced Arrestin domain-containing protein 4 (ARRDC4) mRNA stability relying on the "reader" protein YHTDF2 dependent manner in colorectal cancer.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	NCM460	Normal	Homo sapiens	CVCL_0460
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	Equal amount of HCT116 cells (2 × 10⁶) stably expression of relevant plasmids was injected into the right flank of mice, tumor bulks was monitored once a week after injection and volumes were counted as 0.5 × a2 × b (a and b respectively indicated short and long diameter of tumor).

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL14 significantly enhanced Arrestin domain-containing protein 4 (ARRDC4) mRNA stability relying on the "reader" protein YHTDF2 dependent manner in colorectal cancer.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	NCM460	Normal	Homo sapiens	CVCL_0460
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	Equal amount of HCT116 cells (2 × 10⁶) stably expression of relevant plasmids was injected into the right flank of mice, tumor bulks was monitored once a week after injection and volumes were counted as 0.5 × a2 × b (a and b respectively indicated short and long diameter of tumor).
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL14 significantly enhanced Arrestin domain-containing protein 4 (ARRDC4) mRNA stability relying on the "reader" protein YTHDF2 dependent manner in colorectal cancer.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	NCM460	Normal	Homo sapiens	CVCL_0460
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
In-vivo Model	Equal amount of HCT116 cells (2 × 10⁶) stably expression of relevant plasmids was injected into the right flank of mice, tumor bulks was monitored once a week after injection and volumes were counted as 0.5 × a2 × b (a and b respectively indicated short and long diameter of tumor).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03283		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5C (KDM5C)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03292		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5C (KDM5C)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03348		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00527)

Arrestin domain-containing protein 4 (ARRDC4)

N6-methyladenosine (m6A)

In total 61 m6A sequence/site(s) in this target gene
mod ID: M6ASITE024766		Click to Show/Hide the Full List
mod site	chr15:97960969-97960970:+		[2]
Sequence	GCTGCTATTCCAGCGGCGAGACAGTGGCCGGGCACGTGCTG
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296506
mod ID: M6ASITE024767		Click to Show/Hide the Full List
mod site	chr15:97965630-97965631:+		[3]
Sequence	ATTTTATTACAGCCTGGAAAACATGAATTTCCATTTCGCTT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296507
mod ID: M6ASITE024768		Click to Show/Hide the Full List
mod site	chr15:97966025-97966026:+		[3]
Sequence	TGTTAGTCATGTCGATGTCAACACACCAGCATTATTAGTAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296508
mod ID: M6ASITE024769		Click to Show/Hide the Full List
mod site	chr15:97969205-97969206:+		[3]
Sequence	CTGCTATTTTCCAAACGCAGACATATTTGGCTAGTGGAAAA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296509
mod ID: M6ASITE024770		Click to Show/Hide the Full List
mod site	chr15:97969240-97969241:+		[4]
Sequence	GGAAAAACAAAGACCATTCGACACATGGTCGCCAATGTGCG
Motif Score	2.865571429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296510
mod ID: M6ASITE024771		Click to Show/Hide the Full List
mod site	chr15:97969886-97969887:+		[5]
Sequence	TTTTTTGGCTTATTAGGTATACATTCACATTCCTGGTGCTA
Motif Score	2.110482143
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296511
mod ID: M6ASITE024772		Click to Show/Hide the Full List
mod site	chr15:97969892-97969893:+		[3]
Sequence	GGCTTATTAGGTATACATTCACATTCCTGGTGCTAAAAAAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296512
mod ID: M6ASITE024773		Click to Show/Hide the Full List
mod site	chr15:97969942-97969943:+		[3]
Sequence	AACTGCCATTAGTGATCGGTACAATTCCATATAATGGTTTT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296513
mod ID: M6ASITE024774		Click to Show/Hide the Full List
mod site	chr15:97970017-97970018:+		[3]
Sequence	GTATGGATATGAGCTGGTTGACACTGACCCTGCCAGAGCAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296514
mod ID: M6ASITE024775		Click to Show/Hide the Full List
mod site	chr15:97970634-97970635:+		[3]
Sequence	TCAGAGGAAGAATTCTCTAGACACATTCCTCCTTACCCTCA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296515
mod ID: M6ASITE024776		Click to Show/Hide the Full List
mod site	chr15:97970703-97970704:+		[3]
Sequence	TGTCCTGTGTTTGCCTGTATACAAGAATTCCGGTTTCAACC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296516
mod ID: M6ASITE024777		Click to Show/Hide the Full List
mod site	chr15:97971138-97971139:+		[3]
Sequence	CTTTTTTTGCAGGTTGACCCACATCCTAGCGACGTAGAAGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296517
mod ID: M6ASITE024778		Click to Show/Hide the Full List
mod site	chr15:97971263-97971264:+		[6]
Sequence	TCTGCCTTTTTGGGAAAGAGACAGGAAAGATTCACTTGAAA
Motif Score	2.897386905
Cell/Tissue List	CD34; HEK293T; U2OS; hNPCs; hESCs; HEK293A-TOA; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296518
mod ID: M6ASITE024779		Click to Show/Hide the Full List
mod site	chr15:97971284-97971285:+		[6]
Sequence	CAGGAAAGATTCACTTGAAAACATAAATGAACGTCAAGACT
Motif Score	2.20572619
Cell/Tissue List	CD34; HEK293T; hESC-HEK293T; U2OS; hNPCs; hESCs; CD8T; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296519
mod ID: M6ASITE024780		Click to Show/Hide the Full List
mod site	chr15:97971302-97971303:+		[6]
Sequence	AAACATAAATGAACGTCAAGACTGAAGGCAATAGAAATTAA
Motif Score	3.319380952
Cell/Tissue List	CD34; HEK293T; U2OS; hNPCs; hESCs; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296520
mod ID: M6ASITE024781		Click to Show/Hide the Full List
mod site	chr15:97971363-97971364:+		[3]
Sequence	TGGGCCGGCAGGATTGCCGCACAAGTTTATATGATGGTCGT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296521
mod ID: M6ASITE024782		Click to Show/Hide the Full List
mod site	chr15:97971403-97971404:+		[6]
Sequence	TATATATATCCCTGTTAAAAACTGGGATGAAGATGTGCAAA
Motif Score	2.627720238
Cell/Tissue List	CD34; HEK293T; U2OS; hNPCs; hESCs; MM6; HEK293A-TOA; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296522
mod ID: M6ASITE024783		Click to Show/Hide the Full List
mod site	chr15:97971484-97971485:+		[4]
Sequence	GTGAAAGGGTGCCTGCGCTGACGTGAGAGAAAGGAATCTGT
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296523
mod ID: M6ASITE024784		Click to Show/Hide the Full List
mod site	chr15:97971507-97971508:+		[7]
Sequence	TGAGAGAAAGGAATCTGTAAACAGTGGAAACACTGTGGGAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; kidney; A549; HepG2; U2OS; H1B; H1A; hNPCs; hESCs; MM6; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296524
mod ID: M6ASITE024785		Click to Show/Hide the Full List
mod site	chr15:97971516-97971517:+		[7]
Sequence	GGAATCTGTAAACAGTGGAAACACTGTGGGAGTTTCCCATG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESC-HEK293T; HepG2; U2OS; H1B; H1A; hNPCs; hESCs; MM6; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296525
mod ID: M6ASITE024786		Click to Show/Hide the Full List
mod site	chr15:97971564-97971565:+		[7]
Sequence	GTGGAACGAAGGCGATATGAACTGAAGGGGTGAAGACTTGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1B; H1A; hNPCs; hESCs; MM6; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296526
mod ID: M6ASITE024787		Click to Show/Hide the Full List
mod site	chr15:97971579-97971580:+		[7]
Sequence	TATGAACTGAAGGGGTGAAGACTTGATTTTGGAGAGGGCAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296527
mod ID: M6ASITE024788		Click to Show/Hide the Full List
mod site	chr15:97971599-97971600:+		[3]
Sequence	ACTTGATTTTGGAGAGGGCAACAAAACAAGGGTGTGTGTGC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296528
mod ID: M6ASITE024789		Click to Show/Hide the Full List
mod site	chr15:97971604-97971605:+		[7]
Sequence	ATTTTGGAGAGGGCAACAAAACAAGGGTGTGTGTGCATAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; HepG2; U2OS; H1A; H1B; hNPCs; hESCs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296529
mod ID: M6ASITE024790		Click to Show/Hide the Full List
mod site	chr15:97971705-97971706:+		[7]
Sequence	TACCATATTCAGGCCTAAAGACATTGAAAAAGCATCTTTTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; brain; A549; hESC-HEK293T; U2OS; H1B; H1A; hNPCs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296530
mod ID: M6ASITE024791		Click to Show/Hide the Full List
mod site	chr15:97971760-97971761:+		[4]
Sequence	ATATGAGGTCCTAATGAAGTACTACAGTTTTCATTCTTTCA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296531
mod ID: M6ASITE024792		Click to Show/Hide the Full List
mod site	chr15:97971763-97971764:+		[5]
Sequence	TGAGGTCCTAATGAAGTACTACAGTTTTCATTCTTTCAAGG
Motif Score	2.078666667
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296532
mod ID: M6ASITE024793		Click to Show/Hide the Full List
mod site	chr15:97971788-97971789:+		[8]
Sequence	TTTCATTCTTTCAAGGGTAGACTAAAATATAGTTTATAAAT
Motif Score	3.319380952
Cell/Tissue List	HEK293T; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296533
mod ID: M6ASITE024794		Click to Show/Hide the Full List
mod site	chr15:97971893-97971894:+		[4]
Sequence	AGATGAATTTCAATGTGAAAACACGTTTTGTTGAGGGCTGT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296534
mod ID: M6ASITE024795		Click to Show/Hide the Full List
mod site	chr15:97972041-97972042:+		[3]
Sequence	TGCAGGATGCCTTGATAACTACACAGTCCCAAATAAAAGGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296535
mod ID: M6ASITE024796		Click to Show/Hide the Full List
mod site	chr15:97972075-97972076:+		[4]
Sequence	AAAAGGCCTTTTTCTAACCTACCTCTAATGGGGTTATCAGA
Motif Score	2.05802381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296536
mod ID: M6ASITE024797		Click to Show/Hide the Full List
mod site	chr15:97972261-97972262:+		[3]
Sequence	CTAAGAGAATGTCAAAATAAACACCAAACCAAAAGAAGGTA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296537
mod ID: M6ASITE024798		Click to Show/Hide the Full List
mod site	chr15:97972263-97972264:+		[4]
Sequence	AAGAGAATGTCAAAATAAACACCAAACCAAAAGAAGGTAGG
Motif Score	2.064285714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296538
mod ID: M6ASITE024799		Click to Show/Hide the Full List
mod site	chr15:97972303-97972304:+		[3]
Sequence	GAGTGCCATTTTTAGAAAAGACACAACTTTAATTCCTGTCA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296539
mod ID: M6ASITE024800		Click to Show/Hide the Full List
mod site	chr15:97972361-97972362:+		[3]
Sequence	GATGGCAGTCACTGCATTGTACATTATTCCAGTTCTTCAGT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296540
mod ID: M6ASITE024801		Click to Show/Hide the Full List
mod site	chr15:97972521-97972522:+		[5]
Sequence	CCGTCCCCAGCCCCCCTCCCACATGGTCACATGTTCACTTG
Motif Score	2.053113095
Cell/Tissue List	HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296541
mod ID: M6ASITE024802		Click to Show/Hide the Full List
mod site	chr15:97972529-97972530:+		[5]
Sequence	AGCCCCCCTCCCACATGGTCACATGTTCACTTGCTTTTCCT
Motif Score	2.047297619
Cell/Tissue List	HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296542
mod ID: M6ASITE024803		Click to Show/Hide the Full List
mod site	chr15:97972587-97972588:+		[3]
Sequence	TGAGCTGAGAGCATCTCTGGACACATGGAAGGGAGCCAGGG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296543
mod ID: M6ASITE024804		Click to Show/Hide the Full List
mod site	chr15:97972755-97972756:+		[4]
Sequence	TTCTTTCAATCAGCATGTTCACCAAAAATAGAAAAGTTCTT
Motif Score	2.026654762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296544
mod ID: M6ASITE024805		Click to Show/Hide the Full List
mod site	chr15:97972832-97972833:+		[3]
Sequence	ATTTGATCAGGGAATTTTCTACACACATTAGGCAAATGTAT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296545
mod ID: M6ASITE024806		Click to Show/Hide the Full List
mod site	chr15:97972836-97972837:+		[3]
Sequence	GATCAGGGAATTTTCTACACACATTAGGCAAATGTATGCTT
Motif Score	2.084928571
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296546
mod ID: M6ASITE024807		Click to Show/Hide the Full List
mod site	chr15:97972943-97972944:+		[3]
Sequence	AAGCCGCTATTTAAATTCCCACAATGCAAAACTGTTAGACC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296547
mod ID: M6ASITE024808		Click to Show/Hide the Full List
mod site	chr15:97972976-97972977:+		[4]
Sequence	GTTAGACCAGTAATTGTGCTACTGAAATTGTCACAAAACGT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296548
mod ID: M6ASITE024809		Click to Show/Hide the Full List
mod site	chr15:97973181-97973182:+		[3]
Sequence	TTCGACTCCATGATACTAAAACATAATGAAAGAAACAAACT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296549
mod ID: M6ASITE024810		Click to Show/Hide the Full List
mod site	chr15:97973195-97973196:+		[3]
Sequence	ACTAAAACATAATGAAAGAAACAAACTCCAGTATGGAGAAG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296550
mod ID: M6ASITE024811		Click to Show/Hide the Full List
mod site	chr15:97973252-97973253:+		[4]
Sequence	TGGTTCCATCTAGAAAAGCAACAACTTAAAGGAATCCTTCA
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296551
mod ID: M6ASITE024812		Click to Show/Hide the Full List
mod site	chr15:97973255-97973256:+		[4]
Sequence	TTCCATCTAGAAAAGCAACAACTTAAAGGAATCCTTCACTA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296552
mod ID: M6ASITE024813		Click to Show/Hide the Full List
mod site	chr15:97973272-97973273:+		[4]
Sequence	ACAACTTAAAGGAATCCTTCACTAGGATTGTCTTATCACCT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296553
mod ID: M6ASITE024814		Click to Show/Hide the Full List
mod site	chr15:97973336-97973337:+		[8]
Sequence	CCCTGTGAAATTGAAGTGAAACTATCTCTGTAGGACTTAAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; hNPCs; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296554
mod ID: M6ASITE024815		Click to Show/Hide the Full List
mod site	chr15:97973350-97973351:+		[4]
Sequence	AGTGAAACTATCTCTGTAGGACTTAAGAGAATAGCTAAAAG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; hNPCs; HEK293A-TOA
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296555
mod ID: M6ASITE024816		Click to Show/Hide the Full List
mod site	chr15:97973409-97973410:+		[4]
Sequence	AAATGATACTGGCATATCTGACTGTAAGCAGTAGGTTGAAG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296556
mod ID: M6ASITE024817		Click to Show/Hide the Full List
mod site	chr15:97973458-97973459:+		[3]
Sequence	TTATGAATGTGGAGAATTCTACATTGAAACAGAAAATACCT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296557
mod ID: M6ASITE024818		Click to Show/Hide the Full List
mod site	chr15:97973466-97973467:+		[4]
Sequence	GTGGAGAATTCTACATTGAAACAGAAAATACCTGGGAATGA
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HEK293A-TOA; MSC
Seq Type List	MeRIP-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296558
mod ID: M6ASITE024819		Click to Show/Hide the Full List
mod site	chr15:97973554-97973555:+		[4]
Sequence	CTCTTCTTTAGTTTGAAAAAACAAAAACGTGGCCTTGGAAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296559
mod ID: M6ASITE024820		Click to Show/Hide the Full List
mod site	chr15:97973560-97973561:+		[4]
Sequence	TTTAGTTTGAAAAAACAAAAACGTGGCCTTGGAATTTTCAT
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296560
mod ID: M6ASITE024821		Click to Show/Hide the Full List
mod site	chr15:97973626-97973627:+		[3]
Sequence	AAATGTGCATGTTTTGGTGCACAAAATCCTTCTGTGGGCAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296561
mod ID: M6ASITE024822		Click to Show/Hide the Full List
mod site	chr15:97973676-97973677:+		[3]
Sequence	TTTGTTTTGCACAGTAAGAAACAATAGGCAAGCGTTATGTT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296562
mod ID: M6ASITE024823		Click to Show/Hide the Full List
mod site	chr15:97973747-97973748:+		[3]
Sequence	TTTTTATTATTAAAAATGTAACAATTTAACCCACAGGAAAA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296563
mod ID: M6ASITE024824		Click to Show/Hide the Full List
mod site	chr15:97973759-97973760:+		[4]
Sequence	AAAATGTAACAATTTAACCCACAGGAAAAAAAATTACTTTG
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296564
mod ID: M6ASITE024825		Click to Show/Hide the Full List
mod site	chr15:97973774-97973775:+		[4]
Sequence	AACCCACAGGAAAAAAAATTACTTTGTATGCTTGTTTGAAC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296565
mod ID: M6ASITE024826		Click to Show/Hide the Full List
mod site	chr15:97973826-97973827:+		[3]
Sequence	GTTTTATTAATAAAATTATTACACTAATGCTATGAGGTGCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000268042.7
External Link	RMBase: m6A_site_296566

Ref 1	TCF4 and HuR mediated-METTL14 suppresses dissemination of colorectal cancer via N6-methyladenosine-dependent silencing of ARRDC4. Cell Death Dis. 2021 Dec 17;13(1):3. doi: 10.1038/s41419-021-04459-0.
Ref 2	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 3	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 4	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 5	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 6	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map