m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00526)

Target Name	Fibroblast growth factor receptor 4 (FGFR4)
Synonyms	FGFR-4; CD334 Click to Show/Hide
Gene Name	FGFR4
Chromosomal Location	5q35.2
Family	Protein kinase superfamily, Tyr protein kinase family, Fibroblast growth factor receptor subfamily
Function	Tyrosine-protein kinase that acts as cell-surface receptor for fibroblast growth factors and plays a role in the regulation of cell proliferation, differentiation and migration, and in regulation of lipid metabolism, bile acid biosynthesis, glucose uptake, vitamin D metabolism and phosphate homeostasis. Required for normal down-regulation of the expression of CYP7A1, the rate-limiting enzyme in bile acid synthesis, in response to FGF19. Phosphorylates PLCG1 and FRS2. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. Phosphorylation of FRS2 triggers recruitment of GRB2, GAB1, PIK3R1 and SOS1, and mediates activation of RAS, MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. Promotes SRC-dependent phosphorylation of the matrix protease MMP14 and its lysosomal degradation. FGFR4 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4. Mutations that lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling. Click to Show/Hide
Gene ID	2264
Uniprot ID	FGFR4_HUMAN
HGNC ID	HGNC:3691
KEGG ID	hsa:2264

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FGFR4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: -7.17E-01 p-value: 3.71E-06
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Pertuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Trastuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Tucatinib		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Pertuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Trastuzumab		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Tucatinib		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Pertuzumab [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Trastuzumab [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Tucatinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	m6A-hypomethylation regulated Fibroblast growth factor receptor 4 (FGFR4) phosphorylates GSK-3beta and activates beta-catenin/TCF4-SLC7A11/FPN1 signaling to drive anti-HER2 resistance. Knockdown of METTL14 significantly increased the expression level of FGFR4 in HER2-positive breast cancer cells. FGFR4 reduced the sensitivity of HER2-positive breast cancer to trastuzumab plus pertuzumab or tucatinib. These results pinpoint a mechanism of anti-HER2 resistance and provide a strategy for overcoming resistance via FGFR4 inhibition in recalcitrant HER2-positive breast cancer.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Glutathione synthesis
In-vitro Model	ZR-75-1	Invasive breast carcinoma	Homo sapiens	CVCL_0588
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-453	Breast adenocarcinoma	Homo sapiens	CVCL_0418
	MDA-MB-361	Breast adenocarcinoma	Homo sapiens	CVCL_0620
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
	HEK293T	Normal	Homo sapiens	CVCL_0063
	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	AU565	Breast adenocarcinoma	Homo sapiens	CVCL_1074
In-vivo Model	Luciferase-labeled rSKBR3 and MDA-MB-361 cells (1 × 10⁷ cells) mixed with 1:1 Matrigel (Corning, 356237) were subcutaneously injected into the fat pads of mice. After a tumor was palpable, the mice were randomized into four groups (five mice per group), and they were treated with vehicle, trastuzumab (20 mg/kg, intraperitoneal administration), roblitinib (30 mg/kg, oral administration), or a combination of both drugs.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 9 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02209		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02215		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info
Crosstalk ID: M6ACROT02222		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info
Crosstalk ID: M6ACROT02233		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02239		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info
Crosstalk ID: M6ACROT02246		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info
Crosstalk ID: M6ACROT02257		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Pertuzumab	Drug Info
Crosstalk ID: M6ACROT02263		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Tucatinib	Drug Info
Crosstalk ID: M6ACROT02270		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Drug	Trastuzumab	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00526)

Fibroblast growth factor receptor 4 (FGFR4)

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003698		Click to Show/Hide the Full List
mod site	chr5:177089902-177089903:+		[2]
Sequence	GCGAGAGAGGACTGGCCTTGCAGGGCGCAGGGCCCTAAGCT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000509511.5; ENST00000292408.9; ENST00000513166.1; ENST00000503708.5; ENST00000502906.5; ENST00000430285.5; ENST00000507708.1; ENST00000393637.5; ENST00000393648.6; ENST00000426612.5; ENST00000510911.5; ENST00000514472.1
External Link	RMBase: m5C_site_36448
mod ID: M5CSITE003699		Click to Show/Hide the Full List
mod site	chr5:177093250-177093251:+		[3]
Sequence	TGCTGCTGGCCGGGCTGTATCGAGGGCAGGCGCTCCACGGC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000393637.5; ENST00000393648.6; ENST00000511076.1; ENST00000502906.5; ENST00000508139.1; ENST00000292408.9
External Link	RMBase: m5C_site_36449
mod ID: M5CSITE003700		Click to Show/Hide the Full List
mod site	chr5:177097801-177097802:+		[3]
Sequence	CAGAGTTGCTGTGCCGTGTCCAAGGGCCGTGCCCTTGCCCT
Cell/Tissue List	heart; HEK293T; liver; testis; HeLa; T24
Seq Type List	Bisulfite-seq; m5C-RIP-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9
External Link	RMBase: m5C_site_36450

N6-methyladenosine (m6A)

In total 44 m6A sequence/site(s) in this target gene
mod ID: M6ASITE072875		Click to Show/Hide the Full List
mod site	chr5:177086956-177086957:+		[4]
Sequence	AGCGCTCGGGCTGTCTGCGGACCCTGCCGCGTGCAGGGGTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; H1A; H1B; A549; Jurkat; HEK293T; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510911.5; ENST00000507708.1; ENST00000502906.5; ENST00000393648.6; ENST00000292408.9; ENST00000503708.5; ENST00000514472.1
External Link	RMBase: m6A_site_699487
mod ID: M6ASITE072876		Click to Show/Hide the Full List
mod site	chr5:177087042-177087043:+		[4]
Sequence	GGAGGAGCCAGGTGAGCAGGACCCTGTGCTGGGCGCGGAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; H1A; H1B; A549; Jurkat; HEK293T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000514472.1; ENST00000507708.1; ENST00000292408.9; ENST00000510911.5; ENST00000503708.5; ENST00000393648.6; ENST00000502906.5
External Link	RMBase: m6A_site_699488
mod ID: M6ASITE072877		Click to Show/Hide the Full List
mod site	chr5:177087445-177087446:+		[4]
Sequence	GCCGGCGGCAGAGATGAGGGACCTGAGGCCCCGAAAAGTTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; H1A; H1B; A549; HEK293T; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000503708.5; ENST00000513166.1; ENST00000292408.9; ENST00000514472.1; ENST00000393648.6; ENST00000507708.1; ENST00000502906.5; ENST00000510911.5
External Link	RMBase: m6A_site_699489
mod ID: M6ASITE072878		Click to Show/Hide the Full List
mod site	chr5:177087518-177087519:+		[4]
Sequence	GTGCGGGAGGCTGAAGGAGAACCCAGGACTGTCTGATGCCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000502906.5; ENST00000514472.1; ENST00000503708.5; ENST00000510911.5; ENST00000393648.6; ENST00000292408.9; ENST00000513166.1; ENST00000507708.1
External Link	RMBase: m6A_site_699490
mod ID: M6ASITE072879		Click to Show/Hide the Full List
mod site	chr5:177087525-177087526:+		[4]
Sequence	AGGCTGAAGGAGAACCCAGGACTGTCTGATGCCTAAGGCAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000514472.1; ENST00000503708.5; ENST00000507708.1; ENST00000393648.6; ENST00000292408.9; ENST00000513166.1; ENST00000502906.5; ENST00000510911.5
External Link	RMBase: m6A_site_699491
mod ID: M6ASITE072880		Click to Show/Hide the Full List
mod site	chr5:177087611-177087612:+		[5]
Sequence	CATGGGTGACTCGACTAAGGACTCTGATATCAGGGCAGCCT
Motif Score	4.065041667
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000514472.1; ENST00000503708.5; ENST00000502906.5; ENST00000510911.5; ENST00000507708.1; ENST00000513166.1; ENST00000292408.9; ENST00000393648.6
External Link	RMBase: m6A_site_699492
mod ID: M6ASITE072881		Click to Show/Hide the Full List
mod site	chr5:177088478-177088479:+		[6]
Sequence	GGGCAGGGGAAGCCAGATGGACTGGAAGTGGAGTGGCAGTG
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; H1A; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510911.5; ENST00000292408.9; ENST00000507708.1; ENST00000502906.5; ENST00000513166.1; ENST00000514472.1; ENST00000503708.5; ENST00000393648.6
External Link	RMBase: m6A_site_699493
mod ID: M6ASITE072882		Click to Show/Hide the Full List
mod site	chr5:177089892-177089893:+		[4]
Sequence	CACTGTGTCTGCGAGAGAGGACTGGCCTTGCAGGGCGCAGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000510911.5; ENST00000502906.5; ENST00000426612.5; ENST00000503708.5; ENST00000430285.5; ENST00000509511.5; ENST00000513166.1; ENST00000393637.5; ENST00000393648.6; ENST00000514472.1; ENST00000292408.9; ENST00000507708.1
External Link	RMBase: m6A_site_699494
mod ID: M6ASITE072883		Click to Show/Hide the Full List
mod site	chr5:177090646-177090647:+		[7]
Sequence	TGCAGAATCTCACCTTGATTACAGGTGGTAAGAGACTCTAG
Motif Score	2.07285119
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000503708.5; ENST00000430285.5; ENST00000502906.5; ENST00000393637.5; ENST00000509511.5; ENST00000393648.6; ENST00000426612.5; ENST00000292408.9
External Link	RMBase: m6A_site_699495
mod ID: M6ASITE072884		Click to Show/Hide the Full List
mod site	chr5:177090774-177090775:+		[8]
Sequence	CTCCAGCAACGATGATGAGGACCCCAAGTCCCATAGGGACC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000509511.5; ENST00000502906.5; ENST00000292408.9; ENST00000503708.5; ENST00000430285.5; ENST00000393648.6; ENST00000426612.5; ENST00000393637.5
External Link	RMBase: m6A_site_699496
mod ID: M6ASITE072885		Click to Show/Hide the Full List
mod site	chr5:177090792-177090793:+		[8]
Sequence	GGACCCCAAGTCCCATAGGGACCCCTCGAATAGGCACAGTT
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000393648.6; ENST00000503708.5; ENST00000393637.5; ENST00000430285.5; ENST00000292408.9; ENST00000502906.5; ENST00000426612.5; ENST00000509511.5
External Link	RMBase: m6A_site_699497
mod ID: M6ASITE072886		Click to Show/Hide the Full List
mod site	chr5:177090843-177090844:+		[8]
Sequence	AGGTCAGTAGGTCTCCAAGGACTTGTGTCCCCGCTGCTGCT
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000502906.5; ENST00000503708.5; ENST00000292408.9; ENST00000430285.5; ENST00000393648.6; ENST00000426612.5; ENST00000393637.5; ENST00000509511.5
External Link	RMBase: m6A_site_699498
mod ID: M6ASITE072887		Click to Show/Hide the Full List
mod site	chr5:177090997-177090998:+		[9]
Sequence	GCATGCAGTACCTGCGGGGAACACCGTCAAGTTCCGCTGTC
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000509511.5; ENST00000503708.5; ENST00000393648.6; ENST00000430285.5; ENST00000292408.9; ENST00000426612.5; ENST00000502906.5; ENST00000393637.5
External Link	RMBase: m6A_site_699499
mod ID: M6ASITE072888		Click to Show/Hide the Full List
mod site	chr5:177091741-177091742:+		[9]
Sequence	TGGTGCCCTCGGACCGCGGCACATACACCTGCCTGGTAGAG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000292408.9; ENST00000502906.5; ENST00000393648.6; ENST00000393637.5; ENST00000509511.5
External Link	RMBase: m6A_site_699500
mod ID: M6ASITE072889		Click to Show/Hide the Full List
mod site	chr5:177091745-177091746:+		[9]
Sequence	GCCCTCGGACCGCGGCACATACACCTGCCTGGTAGAGAACG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000509511.5; ENST00000393648.6; ENST00000502906.5; ENST00000292408.9; ENST00000393637.5
External Link	RMBase: m6A_site_699501
mod ID: M6ASITE072890		Click to Show/Hide the Full List
mod site	chr5:177092365-177092366:+		[9]
Sequence	GCAGGCCGGGCTCCCGGCCAACACCACAGCCGTGGTGGGCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000508139.1; ENST00000393648.6; ENST00000502906.5; ENST00000509511.5; ENST00000393637.5; ENST00000292408.9
External Link	RMBase: m6A_site_699502
mod ID: M6ASITE072891		Click to Show/Hide the Full List
mod site	chr5:177092449-177092450:+		[7]
Sequence	CCACATCCAGTGGCTGAAGCACATCGTCATCAACGGCAGCA
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000509511.5; ENST00000502906.5; ENST00000393637.5; ENST00000292408.9; ENST00000508139.1; ENST00000393648.6
External Link	RMBase: m6A_site_699503
mod ID: M6ASITE072892		Click to Show/Hide the Full List
mod site	chr5:177092652-177092653:+		[6]
Sequence	TCCCCCACCCCAGACTGCAGACATCAATAGCTCAGAGGTGG
Motif Score	2.897386905
Cell/Tissue List	HepG2; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000508139.1; ENST00000509511.5; ENST00000502906.5; ENST00000292408.9; ENST00000393637.5; ENST00000393648.6
External Link	RMBase: m6A_site_699504
mod ID: M6ASITE072893		Click to Show/Hide the Full List
mod site	chr5:177092718-177092719:+		[7]
Sequence	AGCCGAGGACGCAGGCGAGTACACCTGCCTCGCAGGCAATT
Motif Score	2.856142857
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000509511.5; ENST00000508139.1; ENST00000292408.9; ENST00000393637.5; ENST00000393648.6; ENST00000502906.5
External Link	RMBase: m6A_site_699505
mod ID: M6ASITE072894		Click to Show/Hide the Full List
mod site	chr5:177093148-177093149:+		[9]
Sequence	CGAGGGCAGAGGAGGACCCCACATGGACCGCAGCAGCGCCC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000292408.9; ENST00000502906.5; ENST00000508139.1; ENST00000393648.6; ENST00000393637.5
External Link	RMBase: m6A_site_699506
mod ID: M6ASITE072895		Click to Show/Hide the Full List
mod site	chr5:177093384-177093385:+		[5]
Sequence	GCCTGACTCCAGCAGGCAGAACCAAGTCTCCCACTTTGCAG
Motif Score	2.930744048
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000508139.1; ENST00000393648.6; ENST00000292408.9; ENST00000502906.5; ENST00000511076.1; ENST00000393637.5
External Link	RMBase: m6A_site_699507
mod ID: M6ASITE072896		Click to Show/Hide the Full List
mod site	chr5:177093547-177093548:+		[4]
Sequence	ACTATGGGAGTTCCCCCGGGACAGGTGCGCTGAGCTGTGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; kidney
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000502906.5; ENST00000393648.6; ENST00000292408.9; ENST00000393637.5; ENST00000511076.1
External Link	RMBase: m6A_site_699508
mod ID: M6ASITE072897		Click to Show/Hide the Full List
mod site	chr5:177093724-177093725:+		[4]
Sequence	TGCAGAGGCCTTTGGCATGGACCCTGCCCGGCCTGACCAAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000502906.5; ENST00000393648.6; ENST00000393637.5; ENST00000511076.1; ENST00000292408.9
External Link	RMBase: m6A_site_699509
mod ID: M6ASITE072898		Click to Show/Hide the Full List
mod site	chr5:177095329-177095330:+		[5]
Sequence	CCCGTCTGCTGCCCTTACAGACAACGCCTCTGACAAGGACC
Motif Score	2.897386905
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393648.6; ENST00000483872.2; ENST00000292408.9; ENST00000393637.5; ENST00000502906.5; ENST00000511076.1
External Link	RMBase: m6A_site_699510
mod ID: M6ASITE072899		Click to Show/Hide the Full List
mod site	chr5:177095341-177095342:+		[9]
Sequence	CCTTACAGACAACGCCTCTGACAAGGACCTGGCCGACCTGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000292408.9; ENST00000483872.2; ENST00000393637.5; ENST00000502906.5; ENST00000511076.1; ENST00000393648.6
External Link	RMBase: m6A_site_699511
mod ID: M6ASITE072900		Click to Show/Hide the Full List
mod site	chr5:177095347-177095348:+		[5]
Sequence	AGACAACGCCTCTGACAAGGACCTGGCCGACCTGGTCTCGG
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000502906.5; ENST00000483872.2; ENST00000511076.1; ENST00000393637.5; ENST00000393648.6; ENST00000292408.9
External Link	RMBase: m6A_site_699512
mod ID: M6ASITE072901		Click to Show/Hide the Full List
mod site	chr5:177095396-177095397:+		[9]
Sequence	GTGATGAAGCTGATCGGCCGACACAAGAACATCATCAACCT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393648.6; ENST00000502906.5; ENST00000511076.1; ENST00000292408.9; ENST00000393637.5; ENST00000483872.2
External Link	RMBase: m6A_site_699513
mod ID: M6ASITE072902		Click to Show/Hide the Full List
mod site	chr5:177095404-177095405:+		[6]
Sequence	GCTGATCGGCCGACACAAGAACATCATCAACCTGCTTGGTG
Motif Score	2.951386905
Cell/Tissue List	HepG2; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000393637.5; ENST00000393648.6; ENST00000511076.1; ENST00000292408.9; ENST00000483872.2; ENST00000502906.5
External Link	RMBase: m6A_site_699514
mod ID: M6ASITE072903		Click to Show/Hide the Full List
mod site	chr5:177095571-177095572:+		[5]
Sequence	GGAGTGCGCCGCCAAGGGAAACCTGCGGGAGTTCCTGCGGG
Motif Score	2.185083333
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393648.6; ENST00000483872.2; ENST00000502906.5; ENST00000393637.5; ENST00000511076.1; ENST00000292408.9
External Link	RMBase: m6A_site_699515
mod ID: M6ASITE072904		Click to Show/Hide the Full List
mod site	chr5:177096069-177096070:+		[5]
Sequence	CCTGCAGTGTATCCACCGGGACCTGGCTGCCCGCAATGTGC
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393637.5; ENST00000511076.1; ENST00000393648.6; ENST00000292408.9; ENST00000502906.5
External Link	RMBase: m6A_site_699516
mod ID: M6ASITE072905		Click to Show/Hide the Full List
mod site	chr5:177096102-177096103:+		[6]
Sequence	CAATGTGCTGGTGACTGAGGACAATGTGATGAAGATTGCTG
Motif Score	3.643047619
Cell/Tissue List	HepG2; liver
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000393637.5; ENST00000502906.5; ENST00000393648.6; ENST00000292408.9; ENST00000511076.1
External Link	RMBase: m6A_site_699517
mod ID: M6ASITE072906		Click to Show/Hide the Full List
mod site	chr5:177096702-177096703:+		[4]
Sequence	TTCTCGCTGCTGCGGGAGGGACATCGGATGGACCGACCCCC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000292408.9; ENST00000393648.6; ENST00000393637.5; ENST00000502906.5
External Link	RMBase: m6A_site_699518
mod ID: M6ASITE072907		Click to Show/Hide the Full List
mod site	chr5:177096713-177096714:+		[4]
Sequence	GCGGGAGGGACATCGGATGGACCGACCCCCACACTGCCCCC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9; ENST00000502906.5; ENST00000393637.5
External Link	RMBase: m6A_site_699519
mod ID: M6ASITE072908		Click to Show/Hide the Full List
mod site	chr5:177096723-177096724:+		[9]
Sequence	CATCGGATGGACCGACCCCCACACTGCCCCCCAGAGCTGTG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393648.6; ENST00000393637.5; ENST00000502906.5; ENST00000292408.9
External Link	RMBase: m6A_site_699520
mod ID: M6ASITE072909		Click to Show/Hide the Full List
mod site	chr5:177097192-177097193:+		[4]
Sequence	ACCCTCCTATCCCTCATCAAACTCCCCACCAAACTCCTCCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000292408.9; ENST00000513423.1; ENST00000393648.6; ENST00000393637.5; ENST00000502906.5
External Link	RMBase: m6A_site_699521
mod ID: M6ASITE072910		Click to Show/Hide the Full List
mod site	chr5:177097204-177097205:+		[4]
Sequence	CTCATCAAACTCCCCACCAAACTCCTCCCCACCCAGAGAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9; ENST00000502906.5; ENST00000393637.5; ENST00000513423.1
External Link	RMBase: m6A_site_699522
mod ID: M6ASITE072911		Click to Show/Hide the Full List
mod site	chr5:177097223-177097224:+		[4]
Sequence	AACTCCTCCCCACCCAGAGAACCCCCGGTCCTCCCCTTCCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393648.6; ENST00000513423.1; ENST00000292408.9; ENST00000393637.5; ENST00000502906.5
External Link	RMBase: m6A_site_699523
mod ID: M6ASITE072912		Click to Show/Hide the Full List
mod site	chr5:177097368-177097369:+		[6]
Sequence	GCAGCTGGTGGAGGCGCTGGACAAGGTCCTGCTGGCCGTCT
Motif Score	3.643047619
Cell/Tissue List	HepG2; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000502906.5; ENST00000513423.1; ENST00000393648.6; ENST00000393637.5; ENST00000292408.9
External Link	RMBase: m6A_site_699524
mod ID: M6ASITE072913		Click to Show/Hide the Full List
mod site	chr5:177097552-177097553:+		[5]
Sequence	GACCTCCGCCTGACCTTCGGACCCTATTCCCCCTCTGGTGG
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000292408.9; ENST00000393648.6; ENST00000502906.5; ENST00000393637.5; ENST00000513423.1
External Link	RMBase: m6A_site_699525
mod ID: M6ASITE072914		Click to Show/Hide the Full List
mod site	chr5:177097670-177097671:+		[6]
Sequence	CCTTCGGGTCTGGGGTGCAGACATGAGCAAGGCTCAAGGCT
Motif Score	2.897386905
Cell/Tissue List	HepG2; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000292408.9; ENST00000513423.1; ENST00000393637.5; ENST00000502906.5; ENST00000393648.6
External Link	RMBase: m6A_site_699526
mod ID: M6ASITE072915		Click to Show/Hide the Full List
mod site	chr5:177097882-177097883:+		[10]
Sequence	GGTTCTGCTCGGCTTCTTGGACCTTGGCGCTTAGTCCCCAT
Motif Score	3.622404762
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9
External Link	RMBase: m6A_site_699527
mod ID: M6ASITE072916		Click to Show/Hide the Full List
mod site	chr5:177097944-177097945:+		[10]
Sequence	CTGGAGAGCTGCTATGCTAAACCTCCTGCCTCCCAATACCA
Motif Score	2.185083333
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9
External Link	RMBase: m6A_site_699528
mod ID: M6ASITE072917		Click to Show/Hide the Full List
mod site	chr5:177097987-177097988:+		[8]
Sequence	AGGAGGTTCTGGGCCTCTGAACCCCCTTTCCCCACACCTCC
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000393648.6; ENST00000292408.9
External Link	RMBase: m6A_site_699529
mod ID: M6ASITE072918		Click to Show/Hide the Full List
mod site	chr5:177098083-177098084:+		[8]
Sequence	AAGCTGGAAGCCTGCCGAAAACAGGAGCAAATGGCGTTTTA
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000292408.9
External Link	RMBase: m6A_site_699530

Ref 1	N6-methyladenosine regulated FGFR4 attenuates ferroptotic cell death in recalcitrant HER2-positive breast cancer. Nat Commun. 2022 May 13;13(1):2672. doi: 10.1038/s41467-022-30217-7.
Ref 2	Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):6784-6789. doi: 10.1073/pnas.1817334116. Epub 2019 Mar 14.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 6	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map