m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00487)

Target Name	Vascular cell adhesion protein 1 (VCAM1)
Gene Name	VCAM1
Chromosomal Location	1p21.2
Function	Important in cell-cell recognition. Appears to function in leukocyte-endothelial cell adhesion. Interacts with integrin alpha-4/beta-1 (ITGA4/ITGB1) on leukocytes, and mediates both adhesion and signal transduction. The VCAM1/ITGA4/ITGB1 interaction may play a pathophysiologic role both in immune responses and in leukocyte emigration to sites of inflammation. Click to Show/Hide
Gene ID	7412
Uniprot ID	VCAM1_HUMAN
HGNC ID	HGNC:12663
KEGG ID	hsa:7412

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

VCAM1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	Mouse hippocampus	Mus musculus
Treatment: FTO knockout mice hippocampus Control: Wild type hippocampus		GSE94098
Regulation		logFC: 6.17E-01 p-value: 3.60E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of Vascular cell adhesion protein 1 (VCAM1) and ICAM-1, downregulated those of KLF2 and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulation	Up regulation
Responsed Disease	Vascular diseases		ICD-11: BE2Z	Disease Info
Responsed Drug	Atorvastatin		Approved	Drug Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

Insulin-like growth factor-binding protein 3 (IGFBP3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Higher IGFBP-3 levels in osteosarcoma tissue compared with normal healthy tissue. IGFBP-3 treatment of two human osteosarcoma cell lines promoted cell migration and upregulated levels of Vascular cell adhesion protein 1 (VCAM1) expression via PI3K/Akt and AP-1 signaling.
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042

Osteosarcoma [ICD-11: 2B51]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Higher IGFBP-3 levels in osteosarcoma tissue compared with normal healthy tissue. IGFBP-3 treatment of two human osteosarcoma cell lines promoted cell migration and upregulated levels of Vascular cell adhesion protein 1 (VCAM1) expression via PI3K/Akt and AP-1 signaling.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	Insulin-like growth factor-binding protein 3 (IGFBP3)		READER	Regulator Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
In-vitro Model	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042

Diseases of the circulatory system [ICD-11: BE2Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of Vascular cell adhesion protein 1 (VCAM1) and ICAM-1, downregulated those of KLF2 and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Responsed Disease	Vascular diseases [ICD-11: BE2Z]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Atorvastatin		Approved	Drug Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

Atorvastatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of Vascular cell adhesion protein 1 (VCAM1) and ICAM-1, downregulated those of KLF2 and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Vascular diseases		ICD-11: BE2Z	Disease Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00487)

Vascular cell adhesion protein 1 (VCAM1)

N6-methyladenosine (m6A)

In total 11 m6A sequence/site(s) in this target gene
mod ID: M6ASITE040149		Click to Show/Hide the Full List
mod site	chr1:100723303-100723304:+		[3]
Sequence	ATGAAATGGATTCTGTGCCCACAGTAAGGCAGGCTGTAAAA
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000650339.1; ENST00000347652.6; ENST00000370119.8; ENST00000370115.1; ENST00000294728.7
External Link	RMBase: m6A_site_42465
mod ID: M6ASITE040159		Click to Show/Hide the Full List
mod site	chr1:100738090-100738091:+		[4]
Sequence	ATGCTATCTTTTTGTACTAGACATTAATTGCATCCATTTTG
Motif Score	2.897386905
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000294728.7; ENST00000347652.6; ENST00000370115.1; ENST00000370119.8; ENST00000603679.1; ENST00000650339.1
External Link	RMBase: m6A_site_42466
mod ID: M6ASITE040162		Click to Show/Hide the Full List
mod site	chr1:100738131-100738132:+		[5]
Sequence	TTATTTTCCAGGAAGAGAAAACAACAAAGACTATTTTTCTC
Motif Score	2.20572619
Cell/Tissue List	GM12878; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370115.1; ENST00000370119.8; ENST00000650339.1; ENST00000347652.6; ENST00000603679.1; ENST00000294728.7
External Link	RMBase: m6A_site_42467
mod ID: M6ASITE040169		Click to Show/Hide the Full List
mod site	chr1:100738140-100738141:+		[5]
Sequence	AGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTC
Motif Score	3.319380952
Cell/Tissue List	GM12878; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000650339.1; ENST00000294728.7; ENST00000370115.1; ENST00000370119.8; ENST00000347652.6; ENST00000603679.1
External Link	RMBase: m6A_site_42468
mod ID: M6ASITE040177		Click to Show/Hide the Full List
mod site	chr1:100738309-100738310:+		[3]
Sequence	CTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAAT
Motif Score	2.897386905
Cell/Tissue List	kidney; fibroblasts; GM12878; iSLK
Seq Type List	m6A-REF-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000603679.1; ENST00000347652.6; ENST00000294728.7; ENST00000650339.1; ENST00000370115.1; ENST00000370119.8
External Link	RMBase: m6A_site_42469
mod ID: M6ASITE040179		Click to Show/Hide the Full List
mod site	chr1:100738361-100738362:+		[6]
Sequence	CTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGAC
Motif Score	2.20572619
Cell/Tissue List	fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370115.1; ENST00000347652.6; ENST00000650339.1; ENST00000603679.1; ENST00000370119.8; ENST00000294728.7
External Link	RMBase: m6A_site_42470
mod ID: M6ASITE040180		Click to Show/Hide the Full List
mod site	chr1:100738380-100738381:+		[6]
Sequence	AACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAAC
Motif Score	3.319380952
Cell/Tissue List	fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000603679.1; ENST00000294728.7; ENST00000370119.8; ENST00000347652.6; ENST00000650339.1; ENST00000370115.1
External Link	RMBase: m6A_site_42471
mod ID: M6ASITE040181		Click to Show/Hide the Full List
mod site	chr1:100738399-100738400:+		[6]
Sequence	GACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATC
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294728.7; ENST00000370115.1; ENST00000370119.8; ENST00000603679.1; ENST00000650339.1; ENST00000347652.6
External Link	RMBase: m6A_site_42472
mod ID: M6ASITE040182		Click to Show/Hide the Full List
mod site	chr1:100738455-100738456:+		[6]
Sequence	GAGCAAGAAGTCAAAGTAAAACTTGCTGCCTGAAGAACAGT
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000347652.6; ENST00000603679.1; ENST00000370115.1; ENST00000294728.7; ENST00000650339.1; ENST00000370119.8
External Link	RMBase: m6A_site_42473
mod ID: M6ASITE040183		Click to Show/Hide the Full List
mod site	chr1:100738471-100738472:+		[3]
Sequence	TAAAACTTGCTGCCTGAAGAACAGTAACTGCCATCAAGATG
Motif Score	2.951386905
Cell/Tissue List	kidney; fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-REF-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000603679.1; ENST00000294728.7; ENST00000370119.8; ENST00000370115.1; ENST00000347652.6; ENST00000650339.1
External Link	RMBase: m6A_site_42474
mod ID: M6ASITE040184		Click to Show/Hide the Full List
mod site	chr1:100738497-100738498:+		[6]
Sequence	ACTGCCATCAAGATGAGAGAACTGGAGGAGTTCCTTGATCT
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; GM12878; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294728.7; ENST00000347652.6; ENST00000370119.8; ENST00000370115.1; ENST00000603679.1; ENST00000650339.1
External Link	RMBase: m6A_site_42475

Ref 1	N6-Methyladenosine Demethylase FTO (Fat Mass and Obesity-Associated Protein) as a Novel Mediator of Statin Effects in Human Endothelial Cells. Arterioscler Thromb Vasc Biol. 2022 May;42(5):644-658. doi: 10.1161/ATVBAHA.121.317295. Epub 2022 Mar 17.
Ref 2	IGFBP-3 stimulates human osteosarcoma cell migration by upregulating VCAM-1 expression. Life Sci. 2021 Jan 15;265:118758. doi: 10.1016/j.lfs.2020.118758. Epub 2020 Nov 12.
Ref 3	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 4	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 5	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 6	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map