General Information of the m6A Target Gene (ID: M6ATAR00472)
Target Name Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2)
Gene Name ABCG2
Chromosomal Location 4q22.1
Family ABC transporter superfamily. ABCG family. Eye pigment precursor importer (TC 3.A.1.204) subfamily. {ECO:0000305}.
Function
Broad substrate specificity ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes a wide variety of physiological compounds, dietary toxins and xenobiotics from cells . Involved in porphyrin homeostasis, mediating the export of protoporphyrin IX (PPIX) from both mitochondria to cytosol and cytosol to extracellular space, it also functions in the cellular export of heme. Also mediates the efflux of sphingosine-1-P from cells. Acts as a urate exporter functioning in both renal and extrarenal urate excretion . In kidney, it also functions as a physiological exporter of the uremic toxin indoxyl sulfate (By similarity). Also involved in the excretion of steroids like estrone 3-sulfate/E1S, 3beta-sulfooxy-androst-5-en-17-one/DHEAS, and other sulfate conjugates. Mediates the secretion of the riboflavin and biotin vitamins into milk (By similarity). Extrudes pheophorbide a, a phototoxic porphyrin catabolite of chlorophyll, reducing its bioavailability (By similarity). Plays an important role in the exclusion of xenobiotics from the brain (Probable). It confers to cells a resistance to multiple drugs and other xenobiotics including mitoxantrone, pheophorbide, camptothecin, methotrexate, azidothymidine, and the anthracyclines daunorubicin and doxorubicin, through the control of their efflux . In placenta, it limits the penetration of drugs from the maternal plasma into the fetus (By similarity). May play a role in early stem cell self-renewal by blocking differentiation (By similarity).
    Click to Show/Hide
Uniprot ID
ABCG2_HUMAN
HGNC ID
HGNC:74
KEGG ID
hsa:9429
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ABCG2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LX2 cell line Homo sapiens
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
GSE207909
Regulation
logFC: -9.03E-01
p-value: 2.29E-02
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between ABCG2 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 4.88E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
Responsed Drug Doxil Approved
Cell Process Cell growth and death
Cell apoptosis
In-vitro Model ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MCF-10A Normal Homo sapiens CVCL_0598
In-vivo Model Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.
Breast cancer [ICD-11: 2C60]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Drug Doxil Approved
Cell Process Cell growth and death
Cell apoptosis
In-vitro Model ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MCF-10A Normal Homo sapiens CVCL_0598
In-vivo Model Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.
Doxil [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
Cell Process Cell growth and death
Cell apoptosis
In-vitro Model ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line)
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MCF-10A Normal Homo sapiens CVCL_0598
In-vivo Model Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00472)
Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2)
5-methylcytidine (m5C)
In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003323 Click to Show/Hide the Full List
mod site chr4:88158982-88158983:- [3]
Sequence GGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCTCACC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000503830.2; ENST00000515655.5; ENST00000650821.1; ENST00000505480.6
External Link RMBase: m5C_site_34251
mod ID: M5CSITE003324 Click to Show/Hide the Full List
mod site chr4:88158985-88158986:- [3]
Sequence GCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCTC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000515655.5; ENST00000503830.2; ENST00000505480.6; ENST00000650821.1
External Link RMBase: m5C_site_34252
mod ID: M5CSITE003325 Click to Show/Hide the Full List
mod site chr4:88158986-88158987:- [3]
Sequence CGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000503830.2; ENST00000650821.1; ENST00000505480.6; ENST00000515655.5
External Link RMBase: m5C_site_34253
mod ID: M5CSITE003326 Click to Show/Hide the Full List
mod site chr4:88158987-88158988:- [3]
Sequence TCGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000515655.5; ENST00000505480.6; ENST00000650821.1; ENST00000503830.2
External Link RMBase: m5C_site_34254
mod ID: M5CSITE003327 Click to Show/Hide the Full List
mod site chr4:88158990-88158991:- [3]
Sequence GGGTCGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCAC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000515655.5; ENST00000505480.6; ENST00000503830.2; ENST00000650821.1
External Link RMBase: m5C_site_34255
N6-methyladenosine (m6A)
In total 23 m6A sequence/site(s) in this target gene
mod ID: M6ASITE066633 Click to Show/Hide the Full List
mod site chr4:88090313-88090314:- [4]
Sequence TATACTTCAAAAGAAACAAAACAGCCACAATTATTAACTTT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000237612.8; ENST00000650821.1; ENST00000515655.5
External Link RMBase: m6A_site_644011
mod ID: M6ASITE066634 Click to Show/Hide the Full List
mod site chr4:88090318-88090319:- [4]
Sequence CAAAATATACTTCAAAAGAAACAAAACAGCCACAATTATTA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000515655.5; ENST00000650821.1; ENST00000237612.8
External Link RMBase: m6A_site_644012
mod ID: M6ASITE066635 Click to Show/Hide the Full List
mod site chr4:88090522-88090523:- [5]
Sequence AACTTTTTTCTTTTTGGATGACATTTGATTAATGCGTCATC
Motif Score 2.859755952
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000237612.8; ENST00000650821.1; ENST00000515655.5
External Link RMBase: m6A_site_644013
mod ID: M6ASITE066636 Click to Show/Hide the Full List
mod site chr4:88090736-88090737:- [4]
Sequence TCTAGGATTCAATTCAGGAGACCACATTTCATCTAGCCCTC
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000515655.5; ENST00000237612.8; ENST00000650821.1
External Link RMBase: m6A_site_644014
mod ID: M6ASITE066637 Click to Show/Hide the Full List
mod site chr4:88091690-88091691:- [4]
Sequence AGCACATTAAAGTTAATAGAACTTACTGATATTCCTGTCTA
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000237612.8; ENST00000650821.1; ENST00000515655.5
External Link RMBase: m6A_site_644015
mod ID: M6ASITE066638 Click to Show/Hide the Full List
mod site chr4:88092130-88092131:- [6]
Sequence TTTTCTGTTCCCTTGCCATCACACTGTTGCACAGCAGCAAT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5; ENST00000237612.8
External Link RMBase: m6A_site_644016
mod ID: M6ASITE066639 Click to Show/Hide the Full List
mod site chr4:88092201-88092202:- [6]
Sequence ATTCAGTATGATTTATCCTCACATAAAAAAGAAGCACTTTG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5; ENST00000237612.8
External Link RMBase: m6A_site_644017
mod ID: M6ASITE066640 Click to Show/Hide the Full List
mod site chr4:88092277-88092278:- [6]
Sequence GTATGATTGTTATTTTCCTCACAATTGCCTACCTGAAATTG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5; ENST00000237612.8
External Link RMBase: m6A_site_644018
mod ID: M6ASITE066641 Click to Show/Hide the Full List
mod site chr4:88094604-88094605:- [5]
Sequence TCTGCCCAGGACTCAATGCAACAGGAAACAATCCTTGTAAC
Motif Score 2.173910714
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5; ENST00000237612.8
External Link RMBase: m6A_site_644019
mod ID: M6ASITE066642 Click to Show/Hide the Full List
mod site chr4:88094627-88094628:- [7]
Sequence TAATGAATTTTTGGGACAAAACTTCTGCCCAGGACTCAATG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000515655.5; ENST00000650821.1; ENST00000237612.8
External Link RMBase: m6A_site_644020
mod ID: M6ASITE066643 Click to Show/Hide the Full List
mod site chr4:88094632-88094633:- [7]
Sequence CAGCATAATGAATTTTTGGGACAAAACTTCTGCCCAGGACT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000237612.8; ENST00000515655.5; ENST00000650821.1
External Link RMBase: m6A_site_644021
mod ID: M6ASITE066644 Click to Show/Hide the Full List
mod site chr4:88095581-88095582:- [6]
Sequence CAGGTCTGTTGGTCAATCTCACAACCATTGCATCTTGGCTG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000237612.8; ENST00000515655.5; ENST00000650821.1
External Link RMBase: m6A_site_644022
mod ID: M6ASITE066645 Click to Show/Hide the Full List
mod site chr4:88097487-88097488:- [6]
Sequence AGAGTGTGGTTTCTGTAGCAACACTTCTCATGACCATCTGT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000515655.5; ENST00000237612.8; ENST00000650821.1
External Link RMBase: m6A_site_644023
mod ID: M6ASITE066646 Click to Show/Hide the Full List
mod site chr4:88121743-88121744:- [8]
Sequence CTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTT
Motif Score 4.065041667
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000650821.1; ENST00000237612.8; ENST00000515655.5
External Link RMBase: m6A_site_644024
mod ID: M6ASITE066647 Click to Show/Hide the Full List
mod site chr4:88121785-88121786:- [7]
Sequence TATTTGTGATTTAGGTTGGAACTCAGTTTATCCGTGGTGTG
Motif Score 3.373380952
Cell/Tissue List HeLa; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000515655.5; ENST00000650821.1; ENST00000237612.8
External Link RMBase: m6A_site_644025
mod ID: M6ASITE066648 Click to Show/Hide the Full List
mod site chr4:88131067-88131068:- [7]
Sequence AGGTCTGGATAAAGTGGCAGACTCCAAGGTAATGTGGAAAA
Motif Score 3.319380952
Cell/Tissue List HeLa; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5; ENST00000237612.8
External Link RMBase: m6A_site_644026
mod ID: M6ASITE066649 Click to Show/Hide the Full List
mod site chr4:88131805-88131806:- [6]
Sequence TGTAATTCAGGTTACGTGGTACAAGTAAGTATTAGTGGGTT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000515655.5; ENST00000650821.1; ENST00000237612.8
External Link RMBase: m6A_site_644027
mod ID: M6ASITE066650 Click to Show/Hide the Full List
mod site chr4:88132598-88132599:- [7]
Sequence GGTCTCAACGCCATCCTGGGACCCACAGGTGGAGGCAAATC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650821.1; ENST00000505480.6; ENST00000515655.5; ENST00000503830.2; ENST00000237612.8
External Link RMBase: m6A_site_644028
mod ID: M6ASITE066651 Click to Show/Hide the Full List
mod site chr4:88158523-88158524:- [7]
Sequence GGTGGTCTTGTTAAGTGGAAACTGCTGCTTTAGAGTTTGTT
Motif Score 2.627720238
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000503830.2; ENST00000237612.8; ENST00000650821.1; ENST00000515655.5; ENST00000505480.6
External Link RMBase: m6A_site_644029
mod ID: M6ASITE066652 Click to Show/Hide the Full List
mod site chr4:88158580-88158581:- [7]
Sequence AGGAGGCAGCCTGTGGAGGAACTGGGTAGGATTTAGGAACG
Motif Score 3.373380952
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650821.1; ENST00000237612.8; ENST00000503830.2; ENST00000505480.6; ENST00000515655.5
External Link RMBase: m6A_site_644030
mod ID: M6ASITE066653 Click to Show/Hide the Full List
mod site chr4:88231274-88231275:- [8]
Sequence AGCTGTTAATTTCACTCGGGACATTTCCTCGAGGCTAGTTT
Motif Score 3.643047619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000515655.5; ENST00000650821.1
External Link RMBase: m6A_site_644031
mod ID: M6ASITE066654 Click to Show/Hide the Full List
mod site chr4:88231311-88231312:- [8]
Sequence TAGTAGTGGAGAAAAAAGGAACCCAAGGAGATAGGAGAGCT
Motif Score 2.930744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000650821.1; ENST00000515655.5
External Link RMBase: m6A_site_644032
mod ID: M6ASITE066655 Click to Show/Hide the Full List
mod site chr4:88231391-88231392:- [8]
Sequence AGGATCCCACGCTGACTGGAACCATTAGGTCTTTTGTTTGA
Motif Score 2.930744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000650821.1
External Link RMBase: m6A_site_644033