m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00472)
| Target Name | Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2) | ||||
|---|---|---|---|---|---|
| Gene Name | ABCG2 | ||||
| Chromosomal Location | 4q22.1 | ||||
| Family | ABC transporter superfamily. ABCG family. Eye pigment precursor importer (TC 3.A.1.204) subfamily. {ECO:0000305}. | ||||
| Function |
Broad substrate specificity ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes a wide variety of physiological compounds, dietary toxins and xenobiotics from cells . Involved in porphyrin homeostasis, mediating the export of protoporphyrin IX (PPIX) from both mitochondria to cytosol and cytosol to extracellular space, it also functions in the cellular export of heme. Also mediates the efflux of sphingosine-1-P from cells. Acts as a urate exporter functioning in both renal and extrarenal urate excretion . In kidney, it also functions as a physiological exporter of the uremic toxin indoxyl sulfate (By similarity). Also involved in the excretion of steroids like estrone 3-sulfate/E1S, 3beta-sulfooxy-androst-5-en-17-one/DHEAS, and other sulfate conjugates. Mediates the secretion of the riboflavin and biotin vitamins into milk (By similarity). Extrudes pheophorbide a, a phototoxic porphyrin catabolite of chlorophyll, reducing its bioavailability (By similarity). Plays an important role in the exclusion of xenobiotics from the brain (Probable). It confers to cells a resistance to multiple drugs and other xenobiotics including mitoxantrone, pheophorbide, camptothecin, methotrexate, azidothymidine, and the anthracyclines daunorubicin and doxorubicin, through the control of their efflux . In placenta, it limits the penetration of drugs from the maternal plasma into the fetus (By similarity). May play a role in early stem cell self-renewal by blocking differentiation (By similarity).
Click to Show/Hide
|
||||
| Uniprot ID | |||||
| HGNC ID | |||||
| KEGG ID | |||||
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ABCG2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LX2 cell line | Homo sapiens |
|
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
|
GSE207909 | |
| Regulation |
![]() ![]() |
logFC: -9.03E-01 p-value: 2.29E-02 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between ABCG2 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 4.88E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Doxil | Approved | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Doxil | Approved | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
Doxil
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. METTL3 knockdown was shown to reduce the expression of miR-221-3p by reducing pri-miR-221-3p m6A mRNA methylation, reducing the expression of MDR1 and Broad substrate specificity ATP-binding cassette transporter ABCG2 (BCRP/ABCG2), and inducing apoptosis. Identified the METTL3/miR-221-3p/HIPK2/Che-1 axis as a novel signaling event that will be responsible for resistance of BC cells to ADR. | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Cell growth and death | |||
| Cell apoptosis | ||||
| In-vitro Model | ADR-resistant MCF-7 (MCF-7/ADR) cells (Human breast cancer doxorubicin-resistant cell line) | |||
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| In-vivo Model | Cell suspensions (2 × 106 cells/mL) made with MCF-7/ADR cells stably expressing METTL3 and/or miR-221-3p inhibitor were subcutaneously implanted into each mouse. One week later, xenografted mice were injected with 0.1 mL ADR (25 mg/kg, intraperitoneal injection) twice a week. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00472)
| In total 5 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE003323 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158982-88158983:- | [3] | |
| Sequence | GGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCTCACC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000503830.2; ENST00000515655.5; ENST00000650821.1; ENST00000505480.6 | ||
| External Link | RMBase: m5C_site_34251 | ||
| mod ID: M5CSITE003324 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158985-88158986:- | [3] | |
| Sequence | GCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCTC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000503830.2; ENST00000505480.6; ENST00000650821.1 | ||
| External Link | RMBase: m5C_site_34252 | ||
| mod ID: M5CSITE003325 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158986-88158987:- | [3] | |
| Sequence | CGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCCT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000503830.2; ENST00000650821.1; ENST00000505480.6; ENST00000515655.5 | ||
| External Link | RMBase: m5C_site_34253 | ||
| mod ID: M5CSITE003326 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158987-88158988:- | [3] | |
| Sequence | TCGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCACGCC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000505480.6; ENST00000650821.1; ENST00000503830.2 | ||
| External Link | RMBase: m5C_site_34254 | ||
| mod ID: M5CSITE003327 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158990-88158991:- | [3] | |
| Sequence | GGGTCGCAGGGCGCTTATCGCGGCCCGGCAGTCGGGGCCAC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000505480.6; ENST00000503830.2; ENST00000650821.1 | ||
| External Link | RMBase: m5C_site_34255 | ||
N6-methyladenosine (m6A)
| In total 23 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE066633 | Click to Show/Hide the Full List | ||
| mod site | chr4:88090313-88090314:- | [4] | |
| Sequence | TATACTTCAAAAGAAACAAAACAGCCACAATTATTAACTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000237612.8; ENST00000650821.1; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644011 | ||
| mod ID: M6ASITE066634 | Click to Show/Hide the Full List | ||
| mod site | chr4:88090318-88090319:- | [4] | |
| Sequence | CAAAATATACTTCAAAAGAAACAAAACAGCCACAATTATTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000650821.1; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644012 | ||
| mod ID: M6ASITE066635 | Click to Show/Hide the Full List | ||
| mod site | chr4:88090522-88090523:- | [5] | |
| Sequence | AACTTTTTTCTTTTTGGATGACATTTGATTAATGCGTCATC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000237612.8; ENST00000650821.1; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644013 | ||
| mod ID: M6ASITE066636 | Click to Show/Hide the Full List | ||
| mod site | chr4:88090736-88090737:- | [4] | |
| Sequence | TCTAGGATTCAATTCAGGAGACCACATTTCATCTAGCCCTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000237612.8; ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644014 | ||
| mod ID: M6ASITE066637 | Click to Show/Hide the Full List | ||
| mod site | chr4:88091690-88091691:- | [4] | |
| Sequence | AGCACATTAAAGTTAATAGAACTTACTGATATTCCTGTCTA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000237612.8; ENST00000650821.1; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644015 | ||
| mod ID: M6ASITE066638 | Click to Show/Hide the Full List | ||
| mod site | chr4:88092130-88092131:- | [6] | |
| Sequence | TTTTCTGTTCCCTTGCCATCACACTGTTGCACAGCAGCAAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644016 | ||
| mod ID: M6ASITE066639 | Click to Show/Hide the Full List | ||
| mod site | chr4:88092201-88092202:- | [6] | |
| Sequence | ATTCAGTATGATTTATCCTCACATAAAAAAGAAGCACTTTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644017 | ||
| mod ID: M6ASITE066640 | Click to Show/Hide the Full List | ||
| mod site | chr4:88092277-88092278:- | [6] | |
| Sequence | GTATGATTGTTATTTTCCTCACAATTGCCTACCTGAAATTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644018 | ||
| mod ID: M6ASITE066641 | Click to Show/Hide the Full List | ||
| mod site | chr4:88094604-88094605:- | [5] | |
| Sequence | TCTGCCCAGGACTCAATGCAACAGGAAACAATCCTTGTAAC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644019 | ||
| mod ID: M6ASITE066642 | Click to Show/Hide the Full List | ||
| mod site | chr4:88094627-88094628:- | [7] | |
| Sequence | TAATGAATTTTTGGGACAAAACTTCTGCCCAGGACTCAATG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000650821.1; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644020 | ||
| mod ID: M6ASITE066643 | Click to Show/Hide the Full List | ||
| mod site | chr4:88094632-88094633:- | [7] | |
| Sequence | CAGCATAATGAATTTTTGGGACAAAACTTCTGCCCAGGACT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000237612.8; ENST00000515655.5; ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644021 | ||
| mod ID: M6ASITE066644 | Click to Show/Hide the Full List | ||
| mod site | chr4:88095581-88095582:- | [6] | |
| Sequence | CAGGTCTGTTGGTCAATCTCACAACCATTGCATCTTGGCTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000237612.8; ENST00000515655.5; ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644022 | ||
| mod ID: M6ASITE066645 | Click to Show/Hide the Full List | ||
| mod site | chr4:88097487-88097488:- | [6] | |
| Sequence | AGAGTGTGGTTTCTGTAGCAACACTTCTCATGACCATCTGT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000237612.8; ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644023 | ||
| mod ID: M6ASITE066646 | Click to Show/Hide the Full List | ||
| mod site | chr4:88121743-88121744:- | [8] | |
| Sequence | CTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000237612.8; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644024 | ||
| mod ID: M6ASITE066647 | Click to Show/Hide the Full List | ||
| mod site | chr4:88121785-88121786:- | [7] | |
| Sequence | TATTTGTGATTTAGGTTGGAACTCAGTTTATCCGTGGTGTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000650821.1; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644025 | ||
| mod ID: M6ASITE066648 | Click to Show/Hide the Full List | ||
| mod site | chr4:88131067-88131068:- | [7] | |
| Sequence | AGGTCTGGATAAAGTGGCAGACTCCAAGGTAATGTGGAAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644026 | ||
| mod ID: M6ASITE066649 | Click to Show/Hide the Full List | ||
| mod site | chr4:88131805-88131806:- | [6] | |
| Sequence | TGTAATTCAGGTTACGTGGTACAAGTAAGTATTAGTGGGTT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000650821.1; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644027 | ||
| mod ID: M6ASITE066650 | Click to Show/Hide the Full List | ||
| mod site | chr4:88132598-88132599:- | [7] | |
| Sequence | GGTCTCAACGCCATCCTGGGACCCACAGGTGGAGGCAAATC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000505480.6; ENST00000515655.5; ENST00000503830.2; ENST00000237612.8 | ||
| External Link | RMBase: m6A_site_644028 | ||
| mod ID: M6ASITE066651 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158523-88158524:- | [7] | |
| Sequence | GGTGGTCTTGTTAAGTGGAAACTGCTGCTTTAGAGTTTGTT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000503830.2; ENST00000237612.8; ENST00000650821.1; ENST00000515655.5; ENST00000505480.6 | ||
| External Link | RMBase: m6A_site_644029 | ||
| mod ID: M6ASITE066652 | Click to Show/Hide the Full List | ||
| mod site | chr4:88158580-88158581:- | [7] | |
| Sequence | AGGAGGCAGCCTGTGGAGGAACTGGGTAGGATTTAGGAACG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000237612.8; ENST00000503830.2; ENST00000505480.6; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644030 | ||
| mod ID: M6ASITE066653 | Click to Show/Hide the Full List | ||
| mod site | chr4:88231274-88231275:- | [8] | |
| Sequence | AGCTGTTAATTTCACTCGGGACATTTCCTCGAGGCTAGTTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000515655.5; ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644031 | ||
| mod ID: M6ASITE066654 | Click to Show/Hide the Full List | ||
| mod site | chr4:88231311-88231312:- | [8] | |
| Sequence | TAGTAGTGGAGAAAAAAGGAACCCAAGGAGATAGGAGAGCT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650821.1; ENST00000515655.5 | ||
| External Link | RMBase: m6A_site_644032 | ||
| mod ID: M6ASITE066655 | Click to Show/Hide the Full List | ||
| mod site | chr4:88231391-88231392:- | [8] | |
| Sequence | AGGATCCCACGCTGACTGGAACCATTAGGTCTTTTGTTTGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650821.1 | ||
| External Link | RMBase: m6A_site_644033 | ||
References

