m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00470)

Target Name	DNA damage-inducible transcript 3 protein (DDIT3/CHOP)
Synonyms	DDIT-3; C/EBP zeta; C/EBP-homologous protein; CHOP; C/EBP-homologous protein 10; CHOP-10; CCAAT/enhancer-binding protein homologous protein; Growth arrest and DNA damage-inducible protein GADD153; CHOP; CHOP10; GADD153 Click to Show/Hide
Gene Name	DDIT3
Chromosomal Location	12q13.3
Family	bZIP family. {ECO:0000305}.
Function	Multifunctional transcription factor in endoplasmic reticulum (ER) stress response. Plays an essential role in the response to a wide variety of cell stresses and induces cell cycle arrest and apoptosis in response to ER stress. Plays a dual role both as an inhibitor of CCAAT/enhancer-binding protein (C/EBP) function and as an activator of other genes (By similarity). Acts as a dominant-negative regulator of C/EBP-induced transcription: dimerizes with members of the C/EBP family, impairs their association with C/EBP binding sites in the promoter regions, and inhibits the expression of C/EBP regulated genes (By similarity). Positively regulates the transcription of TRIB3, IL6, IL8, IL23, TNFRSF10B/DR5, PPP1R15A/GADD34, BBC3/PUMA, BCL2L11/BIM and ERO1L. Negatively regulates; expression of BCL2 and MYOD1, ATF4-dependent transcriptional activation of asparagine synthetase (ASNS), CEBPA-dependent transcriptional activation of hepcidin (HAMP) and CEBPB-mediated expression of peroxisome proliferator-activated receptor gamma (PPARG) . Together with ATF4, mediates ER-mediated cell death by promoting expression of genes involved in cellular amino acid metabolic processes, mRNA translation and the unfolded protein response (UPR) in response to ER stress (By similarity). Inhibits the canonical Wnt signaling pathway by binding to TCF7L2/TCF4, impairing its DNA-binding properties and repressing its transcriptional activity. Plays a regulatory role in the inflammatory response through the induction of caspase-11 (CASP4/CASP11) which induces the activation of caspase-1 (CASP1) and both these caspases increase the activation of pro-IL1B to mature IL1B which is involved in the inflammatory response (By similarity). Acts as a major regulator of postnatal neovascularization through regulation of endothelial nitric oxide synthase (NOS3)-related signaling (By similarity). Click to Show/Hide
Gene ID	9575
Uniprot ID	DDIT3_HUMAN
HGNC ID	HGNC:2726
KEGG ID	hsa:1649

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DDIT3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: shFTO NB4 cells Control: shNS NB4 cells		GSE103494
Regulation		logFC: 7.94E-01 p-value: 7.54E-04
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Responsed Drug	Fluorouracil		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Responsed Drug	Paclitaxel		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: METTL14-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: -2.08E+00 p-value: 8.68E-26
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL14 promotes DNA damage-inducible transcript 3 protein (DDIT3/CHOP) mRNA decay through its 3' UTR N6-methyladenosine (m6A) to inhibit its downstream pro-apoptotic target gene expression, suppress ER proteotoxic liver disease. UPR induces METTL14 expression by competing against the HRD1-ER-associated degradation (ERAD) machinery to block METTL14 ubiquitination and degradation.
Target Regulation	Down regulation
Responsed Disease	Liver disease		ICD-11: DB9Z	Disease Info
Pathway Response	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Cell apoptosis
	Ubiquitination degradation
In-vitro Model	HEK293	Normal	Homo sapiens	CVCL_0045
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Fluorouracil		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Paclitaxel		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

Liver disease [ICD-11: DB9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL14 promotes DNA damage-inducible transcript 3 protein (DDIT3/CHOP) mRNA decay through its 3' UTR N6-methyladenosine (m6A) to inhibit its downstream pro-apoptotic target gene expression, suppress ER proteotoxic liver disease. UPR induces METTL14 expression by competing against the HRD1-ER-associated degradation (ERAD) machinery to block METTL14 ubiquitination and degradation.
Responsed Disease	Liver disease [ICD-11: DB9Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Cell apoptosis
	Ubiquitination degradation
In-vitro Model	HEK293	Normal	Homo sapiens	CVCL_0045
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

Fluorouracil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

Paclitaxel [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Omeprazole pretreatment could enhance the inhibitory effect of 5-Fu, DDP and TAX on gastric cancer cells. FTO inhibition induced by omeprazole enhanced the activation of mTORC1 signal pathway that inhibited the prosurvival autophagy so as to improve the antitumor efficiency of chemotherapeutic drugs on GC cells. Meanwhile, transcript level of DNA damage-inducible transcript 3 protein (DDIT3), which is an apoptosis-related tumor suppressor gene downstream of mTORC1, was regulated by omeprazole-induced FTO silence through an m6A-dependent mechanism. m6A modification and its eraser FTO plays a role in the improvement of chemosensitivity mediated by proton pump inhibitor omeprazole.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	Apoptosis			hsa04210
Cell Process	Cell apoptosis
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00470)

DNA damage-inducible transcript 3 protein (DDIT3/CHOP)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000068		Click to Show/Hide the Full List
mod site	chr12:57520087-57520088:-
Sequence	GGGGAGGCAGGTCAGCAGGACACACCCCCGCTCTAAGACTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000547303.5; ENST00000642841.1; ENST00000552740.5; ENST00000623876.2; ENST00000346473.7; ENST00000547526.1; ENST00000551116.5
External Link	RMBase: m5C_site_10507

N6-methyladenosine (m6A)

In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013594		Click to Show/Hide the Full List
mod site	chr12:57516624-57516625:-		[4]
Sequence	AGATTGTACATTTATTTATTACTGTCCCTATCTATTAAAGT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000346473.7; ENST00000623876.2; ENST00000551116.5; ENST00000547303.5
External Link	RMBase: m6A_site_195163
mod ID: M6ASITE013595		Click to Show/Hide the Full List
mod site	chr12:57516637-57516638:-		[4]
Sequence	AGCTTGTATATAGAGATTGTACATTTATTTATTACTGTCCC
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000547303.5; ENST00000551116.5; ENST00000346473.7; ENST00000623876.2
External Link	RMBase: m6A_site_195164
mod ID: M6ASITE013596		Click to Show/Hide the Full List
mod site	chr12:57516674-57516675:-		[5]
Sequence	AGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCTCAGCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346473.7; ENST00000551116.5; ENST00000547303.5; ENST00000623876.2
External Link	RMBase: m6A_site_195166
mod ID: M6ASITE013597		Click to Show/Hide the Full List
mod site	chr12:57516702-57516703:-		[6]
Sequence	ATGATGTGACCCTCAATCCCACATACGCAGGGGGAAGGCTT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000623876.2; ENST00000346473.7; ENST00000547303.5; ENST00000551116.5
External Link	RMBase: m6A_site_195167
mod ID: M6ASITE013598		Click to Show/Hide the Full List
mod site	chr12:57516775-57516776:-		[6]
Sequence	ATCAGTCCCCCACTTGGGCCACACTACCCACCTTTCCCAGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000547303.5; ENST00000623876.2; ENST00000346473.7; ENST00000551116.5
External Link	RMBase: m6A_site_195168
mod ID: M6ASITE013599		Click to Show/Hide the Full List
mod site	chr12:57516807-57516808:-		[5]
Sequence	TGAATCTGCACCAAGCATGAACAATTGGGAGCATCAGTCCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000551116.5; ENST00000623876.2; ENST00000346473.7; ENST00000547303.5
External Link	RMBase: m6A_site_195169
mod ID: M6ASITE013600		Click to Show/Hide the Full List
mod site	chr12:57516922-57516923:-		[7]
Sequence	GAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGA
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000547303.5; ENST00000623876.2; ENST00000552740.5; ENST00000551116.5; ENST00000346473.7
External Link	RMBase: m6A_site_195170
mod ID: M6ASITE013601		Click to Show/Hide the Full List
mod site	chr12:57516946-57516947:-		[5]
Sequence	CAGCGCATGAAGGAGAAAGAACAGGAGAATGAAAGGAAAGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000623876.2; ENST00000346473.7; ENST00000552740.5; ENST00000547303.5; ENST00000551116.5
External Link	RMBase: m6A_site_195171
mod ID: M6ASITE013602		Click to Show/Hide the Full List
mod site	chr12:57517000-57517001:-		[5]
Sequence	GGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551116.5; ENST00000552740.5; ENST00000346473.7; ENST00000547303.5; ENST00000547526.1; ENST00000623876.2
External Link	RMBase: m6A_site_195172
mod ID: M6ASITE013603		Click to Show/Hide the Full List
mod site	chr12:57517014-57517015:-		[5]
Sequence	AGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000623876.2; ENST00000547526.1; ENST00000547303.5; ENST00000551116.5; ENST00000346473.7; ENST00000552740.5
External Link	RMBase: m6A_site_195173
mod ID: M6ASITE013604		Click to Show/Hide the Full List
mod site	chr12:57517025-57517026:-		[5]
Sequence	TCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346473.7; ENST00000547526.1; ENST00000551116.5; ENST00000547303.5; ENST00000623876.2; ENST00000552740.5
External Link	RMBase: m6A_site_195174
mod ID: M6ASITE013605		Click to Show/Hide the Full List
mod site	chr12:57517111-57517112:-		[5]
Sequence	CTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; MT4; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000547303.5; ENST00000551116.5; ENST00000346473.7; ENST00000547526.1; ENST00000623876.2; ENST00000552740.5
External Link	RMBase: m6A_site_195175
mod ID: M6ASITE013606		Click to Show/Hide the Full List
mod site	chr12:57517128-57517129:-		[4]
Sequence	CTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000551116.5; ENST00000547303.5; ENST00000552740.5; ENST00000346473.7; ENST00000547526.1; ENST00000623876.2
External Link	RMBase: m6A_site_195176
mod ID: M6ASITE013607		Click to Show/Hide the Full List
mod site	chr12:57517335-57517336:-		[8]
Sequence	GCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTT
Motif Score	3.622404762
Cell/Tissue List	CD34; A549; Huh7; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000547526.1; ENST00000346473.7; ENST00000547303.5; ENST00000552740.5; ENST00000551116.5; ENST00000623876.2
External Link	RMBase: m6A_site_195180
mod ID: M6ASITE013608		Click to Show/Hide the Full List
mod site	chr12:57517372-57517373:-		[8]
Sequence	CATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTG
Motif Score	3.643047619
Cell/Tissue List	CD34; A549; hESC-HEK293T; Huh7; peripheral-blood; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000551116.5; ENST00000623876.2; ENST00000552740.5; ENST00000346473.7; ENST00000547303.5; ENST00000547526.1
External Link	RMBase: m6A_site_195182
mod ID: M6ASITE013609		Click to Show/Hide the Full List
mod site	chr12:57517423-57517424:-		[8]
Sequence	CTGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATG
Motif Score	3.319380952
Cell/Tissue List	CD34; A549; Huh7; HEK293T; HEK293A-TOA; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551116.5; ENST00000547526.1; ENST00000623876.2; ENST00000552740.5; ENST00000547303.5; ENST00000346473.7
External Link	RMBase: m6A_site_195183
mod ID: M6ASITE013610		Click to Show/Hide the Full List
mod site	chr12:57517476-57517477:-		[6]
Sequence	TGTGGCATAGACTGTTTGCTACATGGAGCTTGTTCCAGCCA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000547526.1; ENST00000551116.5; ENST00000552740.5; ENST00000547303.5; ENST00000623876.2; ENST00000346473.7
External Link	RMBase: m6A_site_195185
mod ID: M6ASITE013611		Click to Show/Hide the Full List
mod site	chr12:57517486-57517487:-		[9]
Sequence	CTTGCCAACTTGTGGCATAGACTGTTTGCTACATGGAGCTT
Motif Score	3.319380952
Cell/Tissue List	HEK293T; HeLa; A549; Huh7; HEK293A-TOA; iSLK; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000547526.1; ENST00000551116.5; ENST00000623876.2; ENST00000552740.5; ENST00000547303.5; ENST00000346473.7
External Link	RMBase: m6A_site_195187
mod ID: M6ASITE013612		Click to Show/Hide the Full List
mod site	chr12:57517511-57517512:-		[9]
Sequence	CCTACAAAAACAGGCATCAGACCAGCTTGCCAACTTGTGGC
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HeLa; A549; Huh7; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000623876.2; ENST00000547526.1; ENST00000346473.7; ENST00000547303.5; ENST00000551116.5; ENST00000552740.5
External Link	RMBase: m6A_site_195188
mod ID: M6ASITE013613		Click to Show/Hide the Full List
mod site	chr12:57517522-57517523:-		[9]
Sequence	GTACAACTTTACCTACAAAAACAGGCATCAGACCAGCTTGC
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa; A549; Huh7; HEK293A-TOA; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000547526.1; ENST00000552740.5; ENST00000547303.5; ENST00000551116.5; ENST00000623876.2; ENST00000346473.7
External Link	RMBase: m6A_site_195189
mod ID: M6ASITE013614		Click to Show/Hide the Full List
mod site	chr12:57517562-57517563:-		[10]
Sequence	CATAAACAATATGTAAATAAACAGATGTGGCTGTATTCCAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000552740.5; ENST00000547303.5; ENST00000551116.5; ENST00000547526.1; ENST00000346473.7; ENST00000623876.2
External Link	RMBase: m6A_site_195190
mod ID: M6ASITE013615		Click to Show/Hide the Full List
mod site	chr12:57517577-57517578:-		[10]
Sequence	TAGCACCAAAGCAGCCATAAACAATATGTAAATAAACAGAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000547526.1; ENST00000552740.5; ENST00000551116.5; ENST00000547303.5; ENST00000623876.2; ENST00000346473.7
External Link	RMBase: m6A_site_195191
mod ID: M6ASITE013616		Click to Show/Hide the Full List
mod site	chr12:57517662-57517663:-		[11]
Sequence	CAAAAATTTTAAACGGCAGGACAGTAAATATTTTAGATGTT
Motif Score	3.643047619
Cell/Tissue List	HepG2; HEK293T; HeLa; A549; Huh7; HEK293A-TOA; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346473.7; ENST00000552740.5; ENST00000623876.2; ENST00000547526.1; ENST00000547303.5; ENST00000551116.5
External Link	RMBase: m6A_site_195192
mod ID: M6ASITE013617		Click to Show/Hide the Full List
mod site	chr12:57517700-57517701:-		[11]
Sequence	CCACACCTGAAAGCAGGTAAACTTAACCTACCCTTTTCCAA
Motif Score	2.627720238
Cell/Tissue List	HepG2; HeLa; A549; fibroblasts; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346473.7; ENST00000623876.2; ENST00000547303.5; ENST00000552740.5; ENST00000547526.1; ENST00000551116.5
External Link	RMBase: m6A_site_195193
mod ID: M6ASITE013618		Click to Show/Hide the Full List
mod site	chr12:57517726-57517727:-		[6]
Sequence	AGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000642841.1; ENST00000552740.5; ENST00000346473.7; ENST00000547303.5; ENST00000551116.5; ENST00000547526.1; ENST00000623876.2
External Link	RMBase: m6A_site_195194
mod ID: M6ASITE013619		Click to Show/Hide the Full List
mod site	chr12:57520430-57520431:-		[5]
Sequence	GAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGGCGAGTA
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; fibroblasts; MM6; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000547526.1; ENST00000551116.5; ENST00000642841.1; ENST00000623876.2; ENST00000552740.5; ENST00000346473.7; ENST00000547303.5
External Link	RMBase: m6A_site_195195
mod ID: M6ASITE013620		Click to Show/Hide the Full List
mod site	chr12:57520506-57520507:-		[5]
Sequence	AGGCGCTCCCGAGGTCAGAGACTTAAGTCTAAGGCACTGAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; fibroblasts; MM6; Huh7; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000551116.5; ENST00000623876.2; ENST00000547526.1; ENST00000552740.5; ENST00000346473.7
External Link	RMBase: m6A_site_195196
mod ID: M6ASITE013621		Click to Show/Hide the Full List
mod site	chr12:57521672-57521673:-		[5]
Sequence	GGGGGAAAATAGGTGGCCAAACAGAATCGGGTCCACTGGGC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000623876.2
External Link	RMBase: m6A_site_195197

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000019		Click to Show/Hide the Full List
mod site	chr12:57516762-57516763:-		[12]
Sequence	TTGGGCCACACTACCCACCTTTCCCAGAAGTGGCTACTGAC
Transcript ID List	ENST00000551116.5; ENST00000623876.2; ENST00000547303.5; ENST00000346473.7
External Link	RMBase: Pseudo_site_1159

Ref 1	Omeprazole improves chemosensitivity of gastric cancer cells by m6A demethylase FTO-mediated activation of mTORC1 and DDIT3 up-regulation. Biosci Rep. 2021 Jan 29;41(1):BSR20200842. doi: 10.1042/BSR20200842.
Ref 2	HRD1-mediated METTL14 degradation regulates m(6)A mRNA modification to suppress ER proteotoxic liver disease. Mol Cell. 2021 Dec 16;81(24):5052-5065.e6. doi: 10.1016/j.molcel.2021.10.028. Epub 2021 Nov 29.
Ref 3	The breast cancer resistance protein (BCRP/ABCG2) affects pharmacokinetics, hepatobiliary excretion, and milk secretion of the antibiotic nitrofurantoin. Mol Pharmacol. 2005 May;67(5):1758-64. doi: 10.1124/mol.104.010439. Epub 2005 Feb 11.
Ref 4	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 9	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 12	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map