m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00462)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NHEJ1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Protein virilizer homolog (VIRMA) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Germ cell tumour of testis | ICD-11: 2C80.2 | ||
| Responsed Drug | Cisplatin | Approved | ||
| In-vitro Model | 2102EP | Embryonal carcinoma | Homo sapiens | CVCL_C522 |
| NCC-IT | Testicular embryonal carcinoma | Homo sapiens | CVCL_1451 | |
| NT2 | Malignant neoplasms | Mus musculus | CVCL_JA57 | |
| TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 | |
Testicular cancer [ICD-11: 2C80]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11. | |||
| Responsed Disease | Germ cell tumour of testis [ICD-11: 2C80.2] | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Cisplatin | Approved | ||
| In-vitro Model | 2102EP | Embryonal carcinoma | Homo sapiens | CVCL_C522 |
| NCC-IT | Testicular embryonal carcinoma | Homo sapiens | CVCL_1451 | |
| NT2 | Malignant neoplasms | Mus musculus | CVCL_JA57 | |
| TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 | |
Cisplatin
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11. | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Germ cell tumour of testis | ICD-11: 2C80.2 | ||
| In-vitro Model | 2102EP | Embryonal carcinoma | Homo sapiens | CVCL_C522 |
| NCC-IT | Testicular embryonal carcinoma | Homo sapiens | CVCL_1451 | |
| NT2 | Malignant neoplasms | Mus musculus | CVCL_JA57 | |
| TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00462)
| In total 19 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE050305 | Click to Show/Hide the Full List | ||
| mod site | chr2:219075329-219075330:- | [2] | |
| Sequence | ATAAAATAATTATAATAAGAACAACAATAATAAATAGCTAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000498327.5; ENST00000356853.9; ENST00000418099.5; ENST00000409720.5 | ||
| External Link | RMBase: m6A_site_511433 | ||
| mod ID: M6ASITE050306 | Click to Show/Hide the Full List | ||
| mod site | chr2:219075623-219075624:- | [3] | |
| Sequence | GCATAACTGGGACTAAAGGCACACACCACCACACCTAGCTA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000356853.9; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5 | ||
| External Link | RMBase: m6A_site_511434 | ||
| mod ID: M6ASITE050307 | Click to Show/Hide the Full List | ||
| mod site | chr2:219075942-219075943:- | [4] | |
| Sequence | GGGATTACTTATGCTGTGGAACTCATAACCCAATTCACTTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498327.5; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5 | ||
| External Link | RMBase: m6A_site_511435 | ||
| mod ID: M6ASITE050308 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076014-219076015:- | [4] | |
| Sequence | GCCCCAGATACTCCTCAGAGACCCACTTCTCTCTTTTGCAT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000318673.6; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5; ENST00000356853.9 | ||
| External Link | RMBase: m6A_site_511436 | ||
| mod ID: M6ASITE050309 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076084-219076085:- | [3] | |
| Sequence | CAAGTCAGCAAGAAAGCACCACACACTCAGGAAGCCTTGTC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000356853.9; ENST00000409720.5; ENST00000318673.6; ENST00000418099.5; ENST00000498327.5 | ||
| External Link | RMBase: m6A_site_511437 | ||
| mod ID: M6ASITE050310 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076121-219076122:- | [2] | |
| Sequence | GGTTCAGGTTTCTACCATGGACTTTAGGTATATAGGGCAAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000356853.9; ENST00000418099.5; ENST00000318673.6; ENST00000498327.5; ENST00000409720.5 | ||
| External Link | RMBase: m6A_site_511438 | ||
| mod ID: M6ASITE050311 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076232-219076233:- | [3] | |
| Sequence | GAGAACTGAAGTTGATGTTGACAGGCCCACAGGGAATTGGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T; A549 | ||
| Seq Type List | MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000409720.5; ENST00000356853.9; ENST00000498327.5; ENST00000318673.6; ENST00000418099.5 | ||
| External Link | RMBase: m6A_site_511439 | ||
| mod ID: M6ASITE050312 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076279-219076280:- | [5] | |
| Sequence | AATATTTCTAAAATAGTGATACAGTCAGAGGCCTCCTGTAA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000498327.5; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5; ENST00000318673.6 | ||
| External Link | RMBase: m6A_site_511440 | ||
| mod ID: M6ASITE050313 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076341-219076342:- | [4] | |
| Sequence | GCTGAGGATGGACTTGGAGAACAGCTTCCAAGCTTCACCTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000418099.5; ENST00000491159.5; ENST00000426304.5; ENST00000409720.5; ENST00000318673.6; ENST00000498327.5; ENST00000356853.9; ENST00000494211.5 | ||
| External Link | RMBase: m6A_site_511441 | ||
| mod ID: M6ASITE050314 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076350-219076351:- | [4] | |
| Sequence | GCCTCAGCTGCTGAGGATGGACTTGGAGAACAGCTTCCAAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000498327.5; ENST00000418099.5; ENST00000491159.5; ENST00000318673.6; ENST00000494211.5; ENST00000426304.5; ENST00000356853.9; ENST00000409720.5 | ||
| External Link | RMBase: m6A_site_511442 | ||
| mod ID: M6ASITE050315 | Click to Show/Hide the Full List | ||
| mod site | chr2:219076431-219076432:- | [4] | |
| Sequence | ACTTCAGGCCCTCTGCAGAGACCTCAGCTGTCAAAGGTCAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483627.1; ENST00000491159.5; ENST00000494211.5; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5; ENST00000356853.9; ENST00000318673.6; ENST00000426304.5 | ||
| External Link | RMBase: m6A_site_511443 | ||
| mod ID: M6ASITE050316 | Click to Show/Hide the Full List | ||
| mod site | chr2:219077296-219077297:- | [3] | |
| Sequence | CAATGTGTAAACCAGCCAGAACAACTGGTCTCCTCAGCCCC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000498327.5; ENST00000426304.5; ENST00000418099.5; ENST00000318673.6; ENST00000409720.5; ENST00000356853.9; ENST00000491159.5; ENST00000483627.1; ENST00000494211.5 | ||
| External Link | RMBase: m6A_site_511444 | ||
| mod ID: M6ASITE050317 | Click to Show/Hide the Full List | ||
| mod site | chr2:219078127-219078128:- | [3] | |
| Sequence | ATCTGTATATGGCAGTCACCACACAAGAGGTCCAAGTGGGA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000483627.1; ENST00000498327.5; ENST00000457600.2; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5; ENST00000318673.6; ENST00000494211.5; ENST00000426304.5; ENST00000491159.5 | ||
| External Link | RMBase: m6A_site_511445 | ||
| mod ID: M6ASITE050318 | Click to Show/Hide the Full List | ||
| mod site | chr2:219147703-219147704:- | [5] | |
| Sequence | AACGTTACTTCATATGAAAGACCTAGAGATCCAAGACTACC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426304.5; ENST00000498327.5; ENST00000356853.9; ENST00000318673.6; ENST00000409720.5; ENST00000457600.2; ENST00000450447.1; ENST00000418099.5 | ||
| External Link | RMBase: m6A_site_511446 | ||
| mod ID: M6ASITE050319 | Click to Show/Hide the Full List | ||
| mod site | chr2:219147747-219147748:- | [6] | |
| Sequence | ATGGGCATGAGTCTGGCATTACAGTGCCAAGTGAGGGAGCT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000418099.5; ENST00000318673.6; ENST00000498327.5; ENST00000457600.2; ENST00000450447.1; ENST00000409720.5; ENST00000426304.5; ENST00000356853.9 | ||
| External Link | RMBase: m6A_site_511447 | ||
| mod ID: M6ASITE050320 | Click to Show/Hide the Full List | ||
| mod site | chr2:219158300-219158301:- | [4] | |
| Sequence | GTGGCTACAGCTTGCAGAGAACTCCCTCTTGGCCAAGGTTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000418099.5; ENST00000457600.2; ENST00000356853.9; ENST00000498327.5; ENST00000450447.1; ENST00000409720.5; ENST00000318673.6 | ||
| External Link | RMBase: m6A_site_511448 | ||
| mod ID: M6ASITE050321 | Click to Show/Hide the Full List | ||
| mod site | chr2:219158353-219158354:- | [4] | |
| Sequence | ACTTTTTTGCAGATGGAAGAACTGGAGCAAGGCCTGTTGAT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000450447.1; ENST00000457600.2; ENST00000409720.5; ENST00000356853.9; ENST00000318673.6; ENST00000498327.5; ENST00000418099.5 | ||
| External Link | RMBase: m6A_site_511449 | ||
| mod ID: M6ASITE050322 | Click to Show/Hide the Full List | ||
| mod site | chr2:219158856-219158857:- | [4] | |
| Sequence | AAATCCTGAGAGCTTCCTAAACTTTGTTTTTAGATAATGAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000457600.2; ENST00000418099.5; ENST00000481764.1; ENST00000450447.1; ENST00000356853.9; ENST00000318673.6; ENST00000498327.5 | ||
| External Link | RMBase: m6A_site_511450 | ||
| mod ID: M6ASITE050323 | Click to Show/Hide the Full List | ||
| mod site | chr2:219158899-219158900:- | [4] | |
| Sequence | GCATTGACTCTAGATTAAGAACCTGTTTTAGGGATTTTTAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000457600.2; ENST00000418099.5; ENST00000481764.1; ENST00000356853.9; ENST00000498327.5; ENST00000450447.1; ENST00000318673.6 | ||
| External Link | RMBase: m6A_site_511451 | ||
References