m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00462)
Target Name Non-homologous end-joining factor 1 (NHEJ1/XLF)
Synonyms
Protein cernunnos; XRCC4-like factor; XLF
    Click to Show/Hide
Gene Name NHEJ1
Chromosomal Location 2q35
Family XRCC4-XLF family. XLF subfamily. {ECO:0000305}.
Function
DNA repair protein involved in DNA non-homologous end joining (NHEJ); required for double-strand break (DSB) repair and V(D)J recombination. Plays a key role in NHEJ by promoting the ligation of various mismatched and non-cohesive ends. Together with PAXX, collaborates with DNA polymerase lambda (POLL) to promote joining of non-cohesive DNA ends. May act in concert with XRCC5-XRCC6 (Ku) to stimulate XRCC4-mediated joining of blunt ends and several types of mismatched ends that are non-complementary or partially complementary. Associates with XRCC4 to form alternating helical filaments that bridge DNA and act like a bandage, holding together the broken DNA until it is repaired. The XRCC4-NHEJ1/XLF subcomplex binds to the DNA fragments of a DSB in a highly diffusive manner and robustly bridges two independent DNA molecules, holding the broken DNA fragments in close proximity to one other. The mobility of the bridges ensures that the ends remain accessible for further processing by other repair factors . Binds DNA in a length-dependent manner.
    Click to Show/Hide
Gene ID 2956
Uniprot ID
NHEJ1_HUMAN
HGNC ID
HGNC:25737
KEGG ID
hsa:79840
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NHEJ1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Protein virilizer homolog (VIRMA) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11.
Target Regulation Up regulation
Responsed Disease Germ cell tumour of testis ICD-11: 2C80.2
 Disease Info 
Responsed Drug Cisplatin Approved
 Drug Info 
In-vitro Model 2102EP Embryonal carcinoma Homo sapiens CVCL_C522
NCC-IT Testicular embryonal carcinoma Homo sapiens CVCL_1451
NT2 Malignant neoplasms Mus musculus CVCL_JA57
TCam-2 Testicular seminoma Homo sapiens CVCL_T012
Testicular cancer [ICD-11: 2C80]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11.
Responsed Disease Germ cell tumour of testis [ICD-11: 2C80.2]
Target Regulator Protein virilizer homolog (VIRMA) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Cisplatin Approved
 Drug Info 
In-vitro Model 2102EP Embryonal carcinoma Homo sapiens CVCL_C522
NCC-IT Testicular embryonal carcinoma Homo sapiens CVCL_1451
NT2 Malignant neoplasms Mus musculus CVCL_JA57
TCam-2 Testicular seminoma Homo sapiens CVCL_T012
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary VIRMA has an oncogenic role in germ cell tumor confirming our previous tissue-based study and is further involved in response to cisplatin by interfering with DNA repair. Enhanced response to cisplatin after VIRMA knockdown was related to significant increase in DNA damage (with higher Gamma-H2AX and GADD45B levels) and downregulation of Non-homologous end-joining factor 1 (NHEJ1/XLF) and MRE11.
Target Regulator Protein virilizer homolog (VIRMA) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Germ cell tumour of testis ICD-11: 2C80.2
 Disease Info 
In-vitro Model 2102EP Embryonal carcinoma Homo sapiens CVCL_C522
NCC-IT Testicular embryonal carcinoma Homo sapiens CVCL_1451
NT2 Malignant neoplasms Mus musculus CVCL_JA57
TCam-2 Testicular seminoma Homo sapiens CVCL_T012
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00462)
Non-homologous end-joining factor 1 (NHEJ1/XLF)
N6-methyladenosine (m6A)
In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE050305 Click to Show/Hide the Full List
mod site chr2:219075329-219075330:- [2]
Sequence ATAAAATAATTATAATAAGAACAACAATAATAAATAGCTAA
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000498327.5; ENST00000356853.9; ENST00000418099.5; ENST00000409720.5
External Link RMBase: m6A_site_511433
mod ID: M6ASITE050306 Click to Show/Hide the Full List
mod site chr2:219075623-219075624:- [3]
Sequence GCATAACTGGGACTAAAGGCACACACCACCACACCTAGCTA
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000356853.9; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5
External Link RMBase: m6A_site_511434
mod ID: M6ASITE050307 Click to Show/Hide the Full List
mod site chr2:219075942-219075943:- [4]
Sequence GGGATTACTTATGCTGTGGAACTCATAACCCAATTCACTTC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000498327.5; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5
External Link RMBase: m6A_site_511435
mod ID: M6ASITE050308 Click to Show/Hide the Full List
mod site chr2:219076014-219076015:- [4]
Sequence GCCCCAGATACTCCTCAGAGACCCACTTCTCTCTTTTGCAT
Motif Score 2.876744048
Cell/Tissue List HeLa; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000318673.6; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5; ENST00000356853.9
External Link RMBase: m6A_site_511436
mod ID: M6ASITE050309 Click to Show/Hide the Full List
mod site chr2:219076084-219076085:- [3]
Sequence CAAGTCAGCAAGAAAGCACCACACACTCAGGAAGCCTTGTC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000356853.9; ENST00000409720.5; ENST00000318673.6; ENST00000418099.5; ENST00000498327.5
External Link RMBase: m6A_site_511437
mod ID: M6ASITE050310 Click to Show/Hide the Full List
mod site chr2:219076121-219076122:- [2]
Sequence GGTTCAGGTTTCTACCATGGACTTTAGGTATATAGGGCAAG
Motif Score 4.065041667
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000356853.9; ENST00000418099.5; ENST00000318673.6; ENST00000498327.5; ENST00000409720.5
External Link RMBase: m6A_site_511438
mod ID: M6ASITE050311 Click to Show/Hide the Full List
mod site chr2:219076232-219076233:- [3]
Sequence GAGAACTGAAGTTGATGTTGACAGGCCCACAGGGAATTGGC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000409720.5; ENST00000356853.9; ENST00000498327.5; ENST00000318673.6; ENST00000418099.5
External Link RMBase: m6A_site_511439
mod ID: M6ASITE050312 Click to Show/Hide the Full List
mod site chr2:219076279-219076280:- [5]
Sequence AATATTTCTAAAATAGTGATACAGTCAGAGGCCTCCTGTAA
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000498327.5; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5; ENST00000318673.6
External Link RMBase: m6A_site_511440
mod ID: M6ASITE050313 Click to Show/Hide the Full List
mod site chr2:219076341-219076342:- [4]
Sequence GCTGAGGATGGACTTGGAGAACAGCTTCCAAGCTTCACCTT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000418099.5; ENST00000491159.5; ENST00000426304.5; ENST00000409720.5; ENST00000318673.6; ENST00000498327.5; ENST00000356853.9; ENST00000494211.5
External Link RMBase: m6A_site_511441
mod ID: M6ASITE050314 Click to Show/Hide the Full List
mod site chr2:219076350-219076351:- [4]
Sequence GCCTCAGCTGCTGAGGATGGACTTGGAGAACAGCTTCCAAG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000498327.5; ENST00000418099.5; ENST00000491159.5; ENST00000318673.6; ENST00000494211.5; ENST00000426304.5; ENST00000356853.9; ENST00000409720.5
External Link RMBase: m6A_site_511442
mod ID: M6ASITE050315 Click to Show/Hide the Full List
mod site chr2:219076431-219076432:- [4]
Sequence ACTTCAGGCCCTCTGCAGAGACCTCAGCTGTCAAAGGTCAA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483627.1; ENST00000491159.5; ENST00000494211.5; ENST00000409720.5; ENST00000418099.5; ENST00000498327.5; ENST00000356853.9; ENST00000318673.6; ENST00000426304.5
External Link RMBase: m6A_site_511443
mod ID: M6ASITE050316 Click to Show/Hide the Full List
mod site chr2:219077296-219077297:- [3]
Sequence CAATGTGTAAACCAGCCAGAACAACTGGTCTCCTCAGCCCC
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000498327.5; ENST00000426304.5; ENST00000418099.5; ENST00000318673.6; ENST00000409720.5; ENST00000356853.9; ENST00000491159.5; ENST00000483627.1; ENST00000494211.5
External Link RMBase: m6A_site_511444
mod ID: M6ASITE050317 Click to Show/Hide the Full List
mod site chr2:219078127-219078128:- [3]
Sequence ATCTGTATATGGCAGTCACCACACAAGAGGTCCAAGTGGGA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000483627.1; ENST00000498327.5; ENST00000457600.2; ENST00000409720.5; ENST00000356853.9; ENST00000418099.5; ENST00000318673.6; ENST00000494211.5; ENST00000426304.5; ENST00000491159.5
External Link RMBase: m6A_site_511445
mod ID: M6ASITE050318 Click to Show/Hide the Full List
mod site chr2:219147703-219147704:- [5]
Sequence AACGTTACTTCATATGAAAGACCTAGAGATCCAAGACTACC
Motif Score 2.876744048
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000426304.5; ENST00000498327.5; ENST00000356853.9; ENST00000318673.6; ENST00000409720.5; ENST00000457600.2; ENST00000450447.1; ENST00000418099.5
External Link RMBase: m6A_site_511446
mod ID: M6ASITE050319 Click to Show/Hide the Full List
mod site chr2:219147747-219147748:- [6]
Sequence ATGGGCATGAGTCTGGCATTACAGTGCCAAGTGAGGGAGCT
Motif Score 2.07285119
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000418099.5; ENST00000318673.6; ENST00000498327.5; ENST00000457600.2; ENST00000450447.1; ENST00000409720.5; ENST00000426304.5; ENST00000356853.9
External Link RMBase: m6A_site_511447
mod ID: M6ASITE050320 Click to Show/Hide the Full List
mod site chr2:219158300-219158301:- [4]
Sequence GTGGCTACAGCTTGCAGAGAACTCCCTCTTGGCCAAGGTTT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000418099.5; ENST00000457600.2; ENST00000356853.9; ENST00000498327.5; ENST00000450447.1; ENST00000409720.5; ENST00000318673.6
External Link RMBase: m6A_site_511448
mod ID: M6ASITE050321 Click to Show/Hide the Full List
mod site chr2:219158353-219158354:- [4]
Sequence ACTTTTTTGCAGATGGAAGAACTGGAGCAAGGCCTGTTGAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000450447.1; ENST00000457600.2; ENST00000409720.5; ENST00000356853.9; ENST00000318673.6; ENST00000498327.5; ENST00000418099.5
External Link RMBase: m6A_site_511449
mod ID: M6ASITE050322 Click to Show/Hide the Full List
mod site chr2:219158856-219158857:- [4]
Sequence AAATCCTGAGAGCTTCCTAAACTTTGTTTTTAGATAATGAT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000457600.2; ENST00000418099.5; ENST00000481764.1; ENST00000450447.1; ENST00000356853.9; ENST00000318673.6; ENST00000498327.5
External Link RMBase: m6A_site_511450
mod ID: M6ASITE050323 Click to Show/Hide the Full List
mod site chr2:219158899-219158900:- [4]
Sequence GCATTGACTCTAGATTAAGAACCTGTTTTAGGGATTTTTAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000457600.2; ENST00000418099.5; ENST00000481764.1; ENST00000356853.9; ENST00000498327.5; ENST00000450447.1; ENST00000318673.6
External Link RMBase: m6A_site_511451