General Information of the m6A Target Gene (ID: M6ATAR00459)
Target Name Circadian locomoter output cycles protein kaput (CLOCK)
Synonyms
hCLOCK; Class E basic helix-loop-helix protein 8; bHLHe8; BHLHE8; KIAA0334
    Click to Show/Hide
Gene Name CLOCK
Chromosomal Location 4q12
Function
Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. Regulates the circadian expression of ICAM1, VCAM1, CCL2, THPO and MPL and also acts as an enhancer of the transactivation potential of NF-kappaB. Plays an important role in the homeostatic regulation of sleep. The CLOCK-ARNTL/BMAL1 heterodimer regulates the circadian expression of SERPINE1/PAI1, VWF, B3, CCRN4L/NOC, NAMPT, DBP, MYOD1, PPARGC1A, PPARGC1B, SIRT1, GYS2, F7, NGFR, GNRHR, BHLHE40/DEC1, ATF4, MTA1, KLF10 and also genes implicated in glucose and lipid metabolism. Promotes rhythmic chromatin opening, regulating the DNA accessibility of other transcription factors. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1. The preferred binding motif for the CLOCK-ARNTL/BMAL1 heterodimer is 5'-CACGTGA-3', which contains a flanking Ala residue in addition to the canonical 6-nucleotide E-box sequence . CLOCK specifically binds to the half-site 5'-CAC-3', while ARNTL binds to the half-site 5'-GTGA-3'. The CLOCK-ARNTL/BMAL1 heterodimer also recognizes the non-canonical E-box motifs 5'-AACGTGA-3' and 5'-CATGTGA-3'. CLOCK has an intrinsic acetyltransferase activity, which enables circadian chromatin remodeling by acetylating histones and nonhistone proteins, including its own partner ARNTL/BMAL1. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by reducing the association of NR3C1/GR to glucocorticoid response elements (GREs) via the acetylation of multiple lysine residues located in its hinge region. The acetyltransferase activity of CLOCK is as important as its transcription activity in circadian control. Acetylates metabolic enzymes IMPDH2 and NDUFA9 in a circadian manner. Facilitated by BMAL1, rhythmically interacts and acetylates argininosuccinate synthase 1 (ASS1) leading to enzymatic inhibition of ASS1 as well as the circadian oscillation of arginine biosynthesis and subsequent ureagenesis. Drives the circadian rhythm of blood pressure through transcriptional activation of ATP1B1 (By similarity).
    Click to Show/Hide
Gene ID 9575
Uniprot ID
CLOCK_HUMAN
HGNC ID
HGNC:2082
KEGG ID
hsa:9575
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CLOCK can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
GSE167075
Regulation
logFC: 6.28E-01
p-value: 1.95E-19
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Liver-specific Mettl3 knockout mice exhibited global decrease in m6A on polyadenylated RNAs and pathologic features associated with nonalcoholic fatty liver disease. Studies in the M3LKO model indicated that METTL3 exhibits pleotropic function to maintain liver homeostasis by deregulating m6A profile and expression of the liver transcriptome. A significant decrease in total Bmal1 and Circadian locomoter output cycles protein kaput (CLOCK) mRNAs but an increase in their nuclear levels were observed in M3LKO livers, suggesting impaired nuclear export.
Target Regulation Up regulation
Responsed Disease Non-alcoholic fatty liver disease ICD-11: DB92
In-vivo Model M3LKO (Mettl3fl/fl; Alb-Cre) mice were generated by crossing Mettl3fl/fl mice (provided by Dr. Jacob Hanna) with albumin-Cre mice (Jackson Laboratories, Bar Harbor, ME), and genotypes were confirmed by tail-DNA PCR using primers as previously described.
Non-alcoholic fatty liver disease [ICD-11: DB92]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Liver-specific Mettl3 knockout mice exhibited global decrease in m6A on polyadenylated RNAs and pathologic features associated with nonalcoholic fatty liver disease. Studies in the M3LKO model indicated that METTL3 exhibits pleotropic function to maintain liver homeostasis by deregulating m6A profile and expression of the liver transcriptome. A significant decrease in total Bmal1 and Circadian locomoter output cycles protein kaput (CLOCK) mRNAs but an increase in their nuclear levels were observed in M3LKO livers, suggesting impaired nuclear export.
Responsed Disease Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
In-vivo Model M3LKO (Mettl3fl/fl; Alb-Cre) mice were generated by crossing Mettl3fl/fl mice (provided by Dr. Jacob Hanna) with albumin-Cre mice (Jackson Laboratories, Bar Harbor, ME), and genotypes were confirmed by tail-DNA PCR using primers as previously described.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00459)
Circadian locomoter output cycles protein kaput (CLOCK)
Adenosine-to-Inosine editing (A-to-I)
In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000346 Click to Show/Hide the Full List
mod site chr4:55513321-55513322:- [2]
Sequence GTATAGCCTGCTCTGCACCTAGGCTGTATGGTGTAGCCTAC
Transcript ID List ENST00000509151.5; ENST00000381322.5; ENST00000435527.6; ENST00000513440.6; ENST00000513033.1; ENST00000506923.5
External Link RMBase: RNA-editing_site_104783
mod ID: A2ISITE000347 Click to Show/Hide the Full List
mod site chr4:55535052-55535053:- [2]
Sequence ACTTGTGATCCCACCTACTCAGGAGGCTGAGATGGGAGGAT
Transcript ID List ENST00000513440.6; ENST00000435527.6; ENST00000381322.5; ENST00000513033.1; ENST00000506923.5; rmsk_1316702; ENST00000509151.5
External Link RMBase: RNA-editing_site_104784
mod ID: A2ISITE000348 Click to Show/Hide the Full List
mod site chr4:55539066-55539067:- [2]
Sequence AAATTTTTTGTATTTTTAGTAGAGATAGGATTTTGCCATGT
Transcript ID List ENST00000435527.6; ENST00000513033.1; ENST00000509151.5; ENST00000513440.6; ENST00000506923.5; ENST00000381322.5
External Link RMBase: RNA-editing_site_104785
N6-methyladenosine (m6A)
In total 77 m6A sequence/site(s) in this target gene
mod ID: M6ASITE065798 Click to Show/Hide the Full List
mod site chr4:55428069-55428070:- [3]
Sequence GTAAAAATAATTAGATCCAGACTTTGTTTCCTTCAATTTTA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638004
mod ID: M6ASITE065799 Click to Show/Hide the Full List
mod site chr4:55428130-55428131:- [3]
Sequence GTCATGTATTCAGAACCTAAACTTATAGCAAAAGAGCCAAG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638005
mod ID: M6ASITE065800 Click to Show/Hide the Full List
mod site chr4:55428136-55428137:- [3]
Sequence ACTCTTGTCATGTATTCAGAACCTAAACTTATAGCAAAAGA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638006
mod ID: M6ASITE065801 Click to Show/Hide the Full List
mod site chr4:55428188-55428189:- [3]
Sequence TGATGTGCATAGCTTTTAAAACTGCGTGTACTATTATTCTG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638007
mod ID: M6ASITE065802 Click to Show/Hide the Full List
mod site chr4:55428464-55428465:- [4]
Sequence GCCGAAATTCTGAATTGCATACACACATGAAGGATAATGAA
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638008
mod ID: M6ASITE065803 Click to Show/Hide the Full List
mod site chr4:55428757-55428758:- [4]
Sequence TTGTAAATTTTTCATTGTTAACATCAGTTGGTAGTTGTTAA
Motif Score 2.168095238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638009
mod ID: M6ASITE065804 Click to Show/Hide the Full List
mod site chr4:55428813-55428814:- [3]
Sequence AAATTCAGTGCTGTATTGAAACCAGTCAGTGCAAAAAAAAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638010
mod ID: M6ASITE065805 Click to Show/Hide the Full List
mod site chr4:55428942-55428943:- [3]
Sequence CCAGAACAGTTACCATTCAGACCATACTGGAATGATTTTGA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638011
mod ID: M6ASITE065806 Click to Show/Hide the Full List
mod site chr4:55428957-55428958:- [3]
Sequence AAAAAGATGTGTCAGCCAGAACAGTTACCATTCAGACCATA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638012
mod ID: M6ASITE065807 Click to Show/Hide the Full List
mod site chr4:55429037-55429038:- [3]
Sequence TTGATGTCTTGTATAACCAGACAATCATCTTCAAGCAAAAA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638013
mod ID: M6ASITE065808 Click to Show/Hide the Full List
mod site chr4:55429365-55429366:- [3]
Sequence ACAGAATCCTCCACTTTAGGACTCAGAGAAGCTATGGAGTC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638014
mod ID: M6ASITE065809 Click to Show/Hide the Full List
mod site chr4:55429385-55429386:- [3]
Sequence TCTTGCTCACAAGCATTGGAACAGAATCCTCCACTTTAGGA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638015
mod ID: M6ASITE065810 Click to Show/Hide the Full List
mod site chr4:55429420-55429421:- [3]
Sequence TTGGAATATTGGAAACCTAGACATTTGAGGATCCTTCTTGC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638016
mod ID: M6ASITE065811 Click to Show/Hide the Full List
mod site chr4:55429426-55429427:- [3]
Sequence GCAGTGTTGGAATATTGGAAACCTAGACATTTGAGGATCCT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638017
mod ID: M6ASITE065812 Click to Show/Hide the Full List
mod site chr4:55429479-55429480:- [4]
Sequence CTTGGTCCTTTGAAAACAAAACAAAACTTCCATACACAGCA
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638018
mod ID: M6ASITE065813 Click to Show/Hide the Full List
mod site chr4:55429544-55429545:- [3]
Sequence ATAATGTATACAGGCTGTAAACTTCTACAAAAAATGTTTGC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638019
mod ID: M6ASITE065814 Click to Show/Hide the Full List
mod site chr4:55429968-55429969:- [3]
Sequence CACCATATTCTTCTTAGGGAACTGGCTCTGATTTGGGGTGC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638020
mod ID: M6ASITE065815 Click to Show/Hide the Full List
mod site chr4:55430178-55430179:- [3]
Sequence CTGCATTAAGTGACAATCAAACTAGTAAGTATTTATGAAAG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638021
mod ID: M6ASITE065816 Click to Show/Hide the Full List
mod site chr4:55430209-55430210:- [3]
Sequence TCCATCACCACCACCAGCAAACACTGAGGTGCTGCATTAAG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638022
mod ID: M6ASITE065817 Click to Show/Hide the Full List
mod site chr4:55430244-55430245:- [3]
Sequence AGGATATAGTTTATGGAGAGACAACTAAGTGAAATTCCATC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638023
mod ID: M6ASITE065818 Click to Show/Hide the Full List
mod site chr4:55430281-55430282:- [3]
Sequence GCCTGGGTTTCCTCAGGGAAACATTATTTAGTGGAATAGGA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638024
mod ID: M6ASITE065819 Click to Show/Hide the Full List
mod site chr4:55430820-55430821:- [3]
Sequence TTGTGTGGACACCAAAAGAGACCAATGAGCCTGTTTATTTT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638025
mod ID: M6ASITE065820 Click to Show/Hide the Full List
mod site chr4:55430832-55430833:- [3]
Sequence CTATCTTGCCTATTGTGTGGACACCAAAAGAGACCAATGAG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638026
mod ID: M6ASITE065821 Click to Show/Hide the Full List
mod site chr4:55430854-55430855:- [3]
Sequence TGATTTAAACACTATTGTAAACCTATCTTGCCTATTGTGTG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638027
mod ID: M6ASITE065822 Click to Show/Hide the Full List
mod site chr4:55430866-55430867:- [3]
Sequence AGATGCCTAGTTTGATTTAAACACTATTGTAAACCTATCTT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638028
mod ID: M6ASITE065823 Click to Show/Hide the Full List
mod site chr4:55430928-55430929:- [3]
Sequence ATTTCAAGATAGCCAAATGAACTTTGATTTTTGTTTTGAAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638029
mod ID: M6ASITE065824 Click to Show/Hide the Full List
mod site chr4:55430971-55430972:- [3]
Sequence GAAATGTTTAGGTCCAGTGAACCGTAGTTGGTTTATGGGAG
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638030
mod ID: M6ASITE065825 Click to Show/Hide the Full List
mod site chr4:55431465-55431466:- [3]
Sequence TAAGTGTTTGGAGAAAGAGAACCTTTTAAGTTTGGATTGGG
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638031
mod ID: M6ASITE065826 Click to Show/Hide the Full List
mod site chr4:55431509-55431510:- [3]
Sequence TTTTGAATGGTAGAGAAGAAACAGCACAAAGGCACTTGCCA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638032
mod ID: M6ASITE065827 Click to Show/Hide the Full List
mod site chr4:55431545-55431546:- [3]
Sequence AGTGAGTCTTTCTAGCCAGGACAAGCTGATTGGAATTTTTG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638033
mod ID: M6ASITE065828 Click to Show/Hide the Full List
mod site chr4:55432027-55432028:- [4]
Sequence TTGGAATAGTTTGTTATAGAACATTCAGTGCAAAATAGTGA
Motif Score 2.951386905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638034
mod ID: M6ASITE065829 Click to Show/Hide the Full List
mod site chr4:55432249-55432250:- [3]
Sequence TAGAGTGGTGTCAAACCAGAACCGAGACACTTAAAAAGTAC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638035
mod ID: M6ASITE065830 Click to Show/Hide the Full List
mod site chr4:55432255-55432256:- [3]
Sequence GCTCCTTAGAGTGGTGTCAAACCAGAACCGAGACACTTAAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638036
mod ID: M6ASITE065831 Click to Show/Hide the Full List
mod site chr4:55432296-55432297:- [3]
Sequence TTTAACAAATGCAAGTGAGAACTAGAAGGGTTAATAAAGTT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638037
mod ID: M6ASITE065832 Click to Show/Hide the Full List
mod site chr4:55432439-55432440:- [3]
Sequence TTATTCTCACTTTCTTAAAAACACTTATTCTGGGTGGTACT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638038
mod ID: M6ASITE065833 Click to Show/Hide the Full List
mod site chr4:55433024-55433025:- [3]
Sequence GCTAACAAAAGATATGAAGAACTATTATATTGAGGCCTGTC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8; ENST00000511124.1
External Link RMBase: m6A_site_638039
mod ID: M6ASITE065834 Click to Show/Hide the Full List
mod site chr4:55433183-55433184:- [3]
Sequence ACCTGAGCATATGTACACAGACAAGGGGGATGTTGTGGAAT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6; ENST00000511124.1
External Link RMBase: m6A_site_638040
mod ID: M6ASITE065835 Click to Show/Hide the Full List
mod site chr4:55433363-55433364:- [3]
Sequence CATTAATGTTGAAAAAGAAAACAACCAAAGAAAATTGGTAC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000511124.1; ENST00000309964.8
External Link RMBase: m6A_site_638041
mod ID: M6ASITE065836 Click to Show/Hide the Full List
mod site chr4:55434919-55434920:- [3]
Sequence CCTTTTCAGATAATGATGGAACAGTAATTACTTTCAGAATG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513440.6; ENST00000381322.5; ENST00000511124.1; ENST00000309964.8
External Link RMBase: m6A_site_638042
mod ID: M6ASITE065837 Click to Show/Hide the Full List
mod site chr4:55434972-55434973:- [3]
Sequence CCATGAAGACAGTCCAGTAGACTTGGTAGCGACCCCCTCCC
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000381322.5; ENST00000309964.8; ENST00000513440.6; ENST00000511124.1
External Link RMBase: m6A_site_638043
mod ID: M6ASITE065838 Click to Show/Hide the Full List
mod site chr4:55434984-55434985:- [3]
Sequence CTTACAGTGATGCCATGAAGACAGTCCAGTAGACTTGGTAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; Huh7; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513440.6; ENST00000511124.1; ENST00000381322.5; ENST00000309964.8
External Link RMBase: m6A_site_638044
mod ID: M6ASITE065839 Click to Show/Hide the Full List
mod site chr4:55435031-55435032:- [3]
Sequence CTTATCAAGTGTTACAGAGGACATACCACTGCCATGTCAGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; U2OS; A549; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513440.6; ENST00000511124.1; ENST00000381322.5; ENST00000309964.8
External Link RMBase: m6A_site_638045
mod ID: M6ASITE065840 Click to Show/Hide the Full List
mod site chr4:55435455-55435456:- [3]
Sequence AGCAACTCAGCCGGCACAGGACTGACAGCTTGCCCGACCCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; MT4; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513440.6; ENST00000511124.1; ENST00000381322.5; ENST00000309964.8
External Link RMBase: m6A_site_638046
mod ID: M6ASITE065841 Click to Show/Hide the Full List
mod site chr4:55438394-55438395:-
Sequence CACAACAGCAACAGTCACAGACATTGTCAGTAACGCAGCAG
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000381322.5; ENST00000309964.8; ENST00000511124.1; ENST00000513440.6
External Link RMBase: m6A_site_638047
mod ID: M6ASITE065842 Click to Show/Hide the Full List
mod site chr4:55442443-55442444:- [3]
Sequence AGTAACTACATTCACTCAGGACAGGCAGATAAGGTAGTTGT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381322.5; ENST00000511124.1; ENST00000309964.8; ENST00000479384.1; ENST00000513440.6
External Link RMBase: m6A_site_638048
mod ID: M6ASITE065843 Click to Show/Hide the Full List
mod site chr4:55442482-55442483:- [3]
Sequence TCCATCTAGTATGCCACAAAACAGCACCCAGAGTGCTGCAG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000381322.5; ENST00000479384.1; ENST00000511124.1; ENST00000309964.8
External Link RMBase: m6A_site_638049
mod ID: M6ASITE065844 Click to Show/Hide the Full List
mod site chr4:55442579-55442580:- [3]
Sequence AAACATCTCTACCCAGTCAGACACAGAGCACTCTTACAGCC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381322.5; ENST00000511124.1; ENST00000513440.6; ENST00000309964.8; ENST00000479384.1
External Link RMBase: m6A_site_638050
mod ID: M6ASITE065845 Click to Show/Hide the Full List
mod site chr4:55442597-55442598:- [3]
Sequence TGAGTGGGCACAGTCAGCAAACATCTCTACCCAGTCAGACA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000479384.1; ENST00000511124.1; ENST00000309964.8; ENST00000381322.5
External Link RMBase: m6A_site_638051
mod ID: M6ASITE065846 Click to Show/Hide the Full List
mod site chr4:55443709-55443710:- [3]
Sequence AGCACATGATACAACAACAGACTTTACAGAGTACATCAACT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000479384.1; ENST00000381322.5; ENST00000511124.1; ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638052
mod ID: M6ASITE065847 Click to Show/Hide the Full List
mod site chr4:55443746-55443747:- [3]
Sequence CAAAGTGGAATGAATACTGGACACATTGGCACAACTCAGCA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000511124.1; ENST00000381322.5; ENST00000513440.6; ENST00000309964.8; ENST00000479384.1
External Link RMBase: m6A_site_638053
mod ID: M6ASITE065848 Click to Show/Hide the Full List
mod site chr4:55444665-55444666:- [3]
Sequence GAACTAAGAAAAATTCAAGAACAACTTCAGATGGTCCATGG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000511124.1; ENST00000381322.5; ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638054
mod ID: M6ASITE065849 Click to Show/Hide the Full List
mod site chr4:55444683-55444684:- [3]
Sequence ATTCATCGGCAACAAGAAGAACTAAGAAAAATTCAAGAACA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000511124.1; ENST00000381322.5; ENST00000513440.6
External Link RMBase: m6A_site_638055
mod ID: M6ASITE065850 Click to Show/Hide the Full List
mod site chr4:55444724-55444725:- [3]
Sequence AAGACCAATTGGAACAACGGACACGCATGATAGAAGCAAAT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8; ENST00000381322.5; ENST00000511124.1
External Link RMBase: m6A_site_638056
mod ID: M6ASITE065851 Click to Show/Hide the Full List
mod site chr4:55444731-55444732:- [3]
Sequence CATCTGAAAGACCAATTGGAACAACGGACACGCATGATAGA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000511124.1; ENST00000309964.8; ENST00000513440.6; ENST00000381322.5
External Link RMBase: m6A_site_638057
mod ID: M6ASITE065852 Click to Show/Hide the Full List
mod site chr4:55444741-55444742:- [3]
Sequence AGCCATGCAACATCTGAAAGACCAATTGGAACAACGGACAC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000511124.1; ENST00000381322.5; ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638058
mod ID: M6ASITE065853 Click to Show/Hide the Full List
mod site chr4:55450098-55450099:- [3]
Sequence ATCTCACACGGCCGTCTCAGACCCTTCCTGTGAGTACCCTT
Motif Score 2.876744048
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8; ENST00000381322.5
External Link RMBase: m6A_site_638059
mod ID: M6ASITE065854 Click to Show/Hide the Full List
mod site chr4:55450200-55450201:- [3]
Sequence TGGGTCAGATAATCGTATAAACACAGTCAGTCTCAAGGAAG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000381322.5; ENST00000513440.6
External Link RMBase: m6A_site_638060
mod ID: M6ASITE065855 Click to Show/Hide the Full List
mod site chr4:55453067-55453068:- [3]
Sequence TTGAAGAGTCTCTTCCTGAGACAGCTGCTGACAAAGTATGT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8; ENST00000381322.5
External Link RMBase: m6A_site_638069
mod ID: M6ASITE065856 Click to Show/Hide the Full List
mod site chr4:55453095-55453096:- [3]
Sequence AGGGCTGAAAGACGACGAGAACTTGGCATTGAAGAGTCTCT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000381322.5; ENST00000309964.8
External Link RMBase: m6A_site_638071
mod ID: M6ASITE065857 Click to Show/Hide the Full List
mod site chr4:55453749-55453750:- [3]
Sequence AACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTAC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000381322.5; ENST00000309964.8
External Link RMBase: m6A_site_638072
mod ID: M6ASITE065858 Click to Show/Hide the Full List
mod site chr4:55455959-55455960:- [3]
Sequence TGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTAT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000506747.5; ENST00000381322.5; ENST00000513440.6
External Link RMBase: m6A_site_638073
mod ID: M6ASITE065859 Click to Show/Hide the Full List
mod site chr4:55456255-55456256:- [3]
Sequence AATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000381322.5; ENST00000506747.5; ENST00000513440.6
External Link RMBase: m6A_site_638074
mod ID: M6ASITE065860 Click to Show/Hide the Full List
mod site chr4:55456279-55456280:- [3]
Sequence GAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381322.5; ENST00000309964.8; ENST00000513440.6; ENST00000506747.5
External Link RMBase: m6A_site_638075
mod ID: M6ASITE065861 Click to Show/Hide the Full List
mod site chr4:55458977-55458978:- [3]
Sequence CACACAATGGTTTTGAAGGAACTATACAACGCACACATAGG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000506747.5; ENST00000381322.5; ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638076
mod ID: M6ASITE065862 Click to Show/Hide the Full List
mod site chr4:55459212-55459213:- [3]
Sequence CATGCTGCGAGGAACAATAGACCCAAAGGAGCCATCTACCT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000381322.5; ENST00000513440.6; ENST00000506747.5
External Link RMBase: m6A_site_638077
mod ID: M6ASITE065863 Click to Show/Hide the Full List
mod site chr4:55459219-55459220:- [3]
Sequence GTTGTCACATGCTGCGAGGAACAATAGACCCAAAGGAGCCA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381322.5; ENST00000506747.5; ENST00000513440.6; ENST00000309964.8
External Link RMBase: m6A_site_638078
mod ID: M6ASITE065864 Click to Show/Hide the Full List
mod site chr4:55463757-55463758:- [3]
Sequence AATTTTATCCCAGAAGGGGAACATTCAGAGGTTTATAAAAT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000309964.8; ENST00000513440.6; ENST00000435527.6; ENST00000381322.5; ENST00000506747.5
External Link RMBase: m6A_site_638079
mod ID: M6ASITE065865 Click to Show/Hide the Full List
mod site chr4:55476007-55476008:- [3]
Sequence GAAATTCGACAGGACTGGAAACCTACATTCCTTAGTAATGA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000508049.1; ENST00000309964.8; ENST00000381322.5; ENST00000435527.6; ENST00000506747.5; ENST00000513440.6
External Link RMBase: m6A_site_638080
mod ID: M6ASITE065866 Click to Show/Hide the Full List
mod site chr4:55476014-55476015:- [3]
Sequence TGCTAGTGAAATTCGACAGGACTGGAAACCTACATTCCTTA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8; ENST00000508049.1; ENST00000381322.5; ENST00000435527.6; ENST00000506747.5
External Link RMBase: m6A_site_638081
mod ID: M6ASITE065867 Click to Show/Hide the Full List
mod site chr4:55478821-55478822:- [3]
Sequence AGCATTGATTTTTTACGAAAACATAAAGGTAAATTTTTAAC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000381322.5; ENST00000309964.8; ENST00000435527.6; ENST00000506747.5; ENST00000508049.1
External Link RMBase: m6A_site_638082
mod ID: M6ASITE065868 Click to Show/Hide the Full List
mod site chr4:55478951-55478952:- [3]
Sequence TTTCATCAGAGTATCTAGAAACAAATCTGAAAAGAAACGTA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000506747.5; ENST00000506923.5; ENST00000309964.8; ENST00000508049.1; ENST00000513440.6; ENST00000435527.6; ENST00000381322.5
External Link RMBase: m6A_site_638083
mod ID: M6ASITE065869 Click to Show/Hide the Full List
mod site chr4:55479018-55479019:- [3]
Sequence CTAAATTAACATTGTATTAAACTACTTGTGTAATTAAATGG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000508049.1; ENST00000506747.5; ENST00000435527.6; ENST00000309964.8; ENST00000513440.6; ENST00000506923.5; ENST00000381322.5
External Link RMBase: m6A_site_638084
mod ID: M6ASITE065870 Click to Show/Hide the Full List
mod site chr4:55479651-55479652:- [3]
Sequence GGTGGAAGAAGATGACAAGGACAAAGCGAAAAGGTAGTTTG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000506923.5; ENST00000435527.6; ENST00000506747.5; ENST00000381322.5; ENST00000309964.8; ENST00000513440.6
External Link RMBase: m6A_site_638085
mod ID: M6ASITE065871 Click to Show/Hide the Full List
mod site chr4:55545501-55545502:- [3]
Sequence AAGAAAAGCACAAGAAGTAAACTTTTACAGTCGTTGATTTG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381322.5; ENST00000509151.5; ENST00000513033.1; ENST00000513440.6; ENST00000435527.6; ENST00000506923.5
External Link RMBase: m6A_site_638086
mod ID: M6ASITE065872 Click to Show/Hide the Full List
mod site chr4:55545572-55545573:- [3]
Sequence TTAGAATGCCGTGCTATTAGACTTTAAGGCTTTTTAGCCTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000506923.5; ENST00000513440.6; ENST00000509151.5; ENST00000513033.1; ENST00000435527.6; ENST00000381322.5
External Link RMBase: m6A_site_638087
mod ID: M6ASITE065873 Click to Show/Hide the Full List
mod site chr4:55546526-55546527:- [3]
Sequence CCGAGTCACCGCAGCGGGAGACCTGGGTGGGGGAGGGAAGA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; H1B; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000513440.6; ENST00000435527.6; ENST00000506923.5; ENST00000513033.1; ENST00000509151.5
External Link RMBase: m6A_site_638088
mod ID: M6ASITE065874 Click to Show/Hide the Full List
mod site chr4:55546566-55546567:- [3]
Sequence GGAGCCGCGGCGCCTCCTGGACACAGGCGGGGTAGTGGTTC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; H1B; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000506923.5; ENST00000513033.1; ENST00000509151.5; ENST00000513440.6
External Link RMBase: m6A_site_638089
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000332 Click to Show/Hide the Full List
mod site chr4:55430324-55430325:- [5]
Sequence TGCAGGTTTTGTTGTGAGTGTTTATAACAGTATTTTGTAAG
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000513440.6; ENST00000309964.8
External Link RMBase: Nm_site_5166