General Information of the m6A Target Gene (ID: M6ATAR00426)
Target Name Transcription factor EB (TFEB)
Synonyms
Class E basic helix-loop-helix protein 35; bHLHe35; BHLHE35
    Click to Show/Hide
Gene Name TFEB
Chromosomal Location 6p21.1
Family MiT/TFE family
Function
Transcription factor that acts as a master regulator of lysosomal biogenesis, autophagy, lysosomal exocytosis, lipid catabolism, energy metabolism and immune response. Specifically recognizes and binds E-box sequences (5'-CANNTG-3'); efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, TFEB phosphorylation by MTOR promotes its cytosolic retention and subsequent inactivation. Upon starvation or lysosomal stress, inhibition of MTOR induces TFEB dephosphorylation, resulting in nuclear localization and transcription factor activity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression, thereby playing a central role in expression of lysosomal genes. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity (By similarity). Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta (By similarity). Involved in the immune response to infection by the bacteria S.aureus or S.enterica, acting downstream of protein kinase D (PKD), probably by regulating cytokine and chemokine expression (By similarity).
    Click to Show/Hide
Gene ID 7942
Uniprot ID
TFEB_HUMAN
HGNC ID
HGNC:11753
KEGG ID
hsa:7942
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TFEB can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LNCaP cell line Homo sapiens
Treatment: shMETTL3 LNCaP cells
Control: shControl LNCaP cells
GSE147884
Regulation
logFC: -6.54E-01
p-value: 8.08E-07
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TFEB and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 8.22E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 methylates Transcription factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy genes, at two m6A residues in the 3'-UTR, which promotes the association of the RNA-binding protein HNRNPD with TFEB pre-mRNA and subsequently decreases the expression levels of TFEB. METTL3-ALKBH5 and autophagy, providing insight into the functional importance of the reversible mRNA m6A methylation and its modulators in ischemic heart disease.
Target Regulation Down regulation
Responsed Disease Ischemic heart disease ICD-11: BA40-BA6Z
Pathway Response Apoptosis hsa04210)
Cell Process Cell proliferation
In-vitro Model H9c2(2-1) Normal Rattus norvegicus CVCL_0286
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model To cause I/R injury, mice were subjected to 30 min of LAD ischemia followed by 60 min of reperfusion.
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line THP1 cell line Homo sapiens
Treatment: ALKBH5 knockdown THP1 cells
Control: Wild type THP1 cells
GSE128574
Regulation
logFC: -1.28E+00
p-value: 2.60E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 methylates Transcription factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy genes, at two m6A residues in the 3'-UTR, which promotes the association of the RNA-binding protein HNRNPD with TFEB pre-mRNA and subsequently decreases the expression levels of TFEB. METTL3-ALKBH5 and autophagy, providing insight into the functional importance of the reversible mRNA m6A methylation and its modulators in ischemic heart disease.
Target Regulation Up regulation
Responsed Disease Ischemic heart disease ICD-11: BA40-BA6Z
Pathway Response Apoptosis hsa04210)
Cell Process Cell proliferation
In-vitro Model H9c2(2-1) Normal Rattus norvegicus CVCL_0286
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model To cause I/R injury, mice were subjected to 30 min of LAD ischemia followed by 60 min of reperfusion.
Ischemic heart disease [ICD-11: BA40-BA6Z]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 methylates Transcription factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy genes, at two m6A residues in the 3'-UTR, which promotes the association of the RNA-binding protein HNRNPD with TFEB pre-mRNA and subsequently decreases the expression levels of TFEB. METTL3-ALKBH5 and autophagy, providing insight into the functional importance of the reversible mRNA m6A methylation and its modulators in ischemic heart disease.
Responsed Disease Ischemic heart disease [ICD-11: BA40-BA6Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response Apoptosis hsa04210)
Cell Process Cell proliferation
In-vitro Model H9c2(2-1) Normal Rattus norvegicus CVCL_0286
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model To cause I/R injury, mice were subjected to 30 min of LAD ischemia followed by 60 min of reperfusion.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 methylates Transcription factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy genes, at two m6A residues in the 3'-UTR, which promotes the association of the RNA-binding protein HNRNPD with TFEB pre-mRNA and subsequently decreases the expression levels of TFEB. METTL3-ALKBH5 and autophagy, providing insight into the functional importance of the reversible mRNA m6A methylation and its modulators in ischemic heart disease.
Responsed Disease Ischemic heart disease [ICD-11: BA40-BA6Z]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210)
Cell Process Cell proliferation
In-vitro Model H9c2(2-1) Normal Rattus norvegicus CVCL_0286
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model To cause I/R injury, mice were subjected to 30 min of LAD ischemia followed by 60 min of reperfusion.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00426)
Transcription factor EB (TFEB)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001448 Click to Show/Hide the Full List
mod site chr6:41707456-41707457:- [2]
Sequence GGCCACAGGCAGGCACGCCAAGTCACAGCCCCTCTGACTTC
Transcript ID List ENST00000416140.5; ENST00000394283.5; ENST00000420312.5; ENST00000358871.6; ENST00000373033.6; ENST00000445700.5; ENST00000425401.1; ENST00000230323.8; ENST00000403298.8; ENST00000419396.5; ENST00000424495.1; ENST00000433032.1
External Link RMBase: RNA-editing_site_116025
mod ID: A2ISITE001449 Click to Show/Hide the Full List
mod site chr6:41715258-41715259:- [2]
Sequence AGGGCCAGGGCTGTGGTCCTAGCTCTCCCTAAGCTGTGTGG
Transcript ID List ENST00000358871.6; ENST00000424495.1; ENST00000394283.5; rmsk_1929789; ENST00000433032.1; ENST00000419396.5; ENST00000420312.5; ENST00000416140.5; ENST00000373033.6; ENST00000403298.8; ENST00000445700.5; ENST00000425401.1; ENST00000230323.8
External Link RMBase: RNA-editing_site_116026
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003945 Click to Show/Hide the Full List
mod site chr6:41684952-41684953:-
Sequence GAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000420312.5; ENST00000358871.6; ENST00000403298.8; ENST00000373033.6; ENST00000406563.6; ENST00000343317.10; ENST00000230323.8
External Link RMBase: m5C_site_37965
mod ID: M5CSITE003946 Click to Show/Hide the Full List
mod site chr6:41684964-41684965:-
Sequence GAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000230323.8; ENST00000343317.10; ENST00000358871.6; ENST00000420312.5; ENST00000403298.8; ENST00000406563.6; ENST00000373033.6
External Link RMBase: m5C_site_37966
N6-methyladenosine (m6A)
In total 24 m6A sequence/site(s) in this target gene
mod ID: M6ASITE075051 Click to Show/Hide the Full List
mod site chr6:41683991-41683992:- [3]
Sequence TCACTTTGTGCCTTTAGTAAACACTGTGCTTTGTACTTGCT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; GM12878; peripheral-blood; MSC; TIME; TREX; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403298.8; ENST00000420312.5; ENST00000230323.8; ENST00000373033.6; ENST00000343317.10; ENST00000358871.6; ENST00000406563.6
External Link RMBase: m6A_site_716537
mod ID: M6ASITE075052 Click to Show/Hide the Full List
mod site chr6:41684173-41684174:- [3]
Sequence CTCAGGCCTGCCTTTTTGGGACTCAGATGGCAGGAGGTCCA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; GM12878; LCLs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000358871.6; ENST00000343317.10; ENST00000420312.5; ENST00000406563.6; ENST00000373033.6; ENST00000230323.8; ENST00000403298.8
External Link RMBase: m6A_site_716538
mod ID: M6ASITE075053 Click to Show/Hide the Full List
mod site chr6:41684248-41684249:- [3]
Sequence CCCCTCATTACCAGTGAAGGACATGCTTGAGGGGTTCGGGA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; fibroblasts; GM12878; LCLs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403298.8; ENST00000343317.10; ENST00000230323.8; ENST00000373033.6; ENST00000406563.6; ENST00000420312.5; ENST00000358871.6
External Link RMBase: m6A_site_716539
mod ID: M6ASITE075054 Click to Show/Hide the Full List
mod site chr6:41684454-41684455:- [3]
Sequence CCCCGTTGGCCCCTGTTTGGACTTAGTGCCTGTCTGGCAGC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; GM12878; LCLs; MM6; CD4T; peripheral-blood; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403298.8; ENST00000420312.5; ENST00000230323.8; ENST00000406563.6; ENST00000358871.6; ENST00000343317.10; ENST00000373033.6
External Link RMBase: m6A_site_716540
mod ID: M6ASITE075055 Click to Show/Hide the Full List
mod site chr6:41684573-41684574:- [3]
Sequence GGCTGCCCCTGTGCCAGGGAACAGGGGCCGGCCTGGGGGCT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; LCLs; MM6; CD4T; peripheral-blood; MSC; TIME; TREX; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000403298.8; ENST00000343317.10; ENST00000230323.8; ENST00000420312.5; ENST00000406563.6; ENST00000373033.6; ENST00000358871.6
External Link RMBase: m6A_site_716541
mod ID: M6ASITE075056 Click to Show/Hide the Full List
mod site chr6:41684728-41684729:- [3]
Sequence CCTGTCCAAGAAGGATCTGGACCTCATGCTCCTGGACGACT
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; H1B; LCLs; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000358871.6; ENST00000343317.10; ENST00000406563.6; ENST00000230323.8; ENST00000420312.5; ENST00000373033.6; ENST00000403298.8
External Link RMBase: m6A_site_716542
mod ID: M6ASITE075057 Click to Show/Hide the Full List
mod site chr6:41684784-41684785:- [3]
Sequence GGTCCCCCGGGCTACCCCGAACCCCTGGCGCCGGGGCATGG
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; LCLs; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000343317.10; ENST00000373033.6; ENST00000406563.6; ENST00000358871.6; ENST00000230323.8; ENST00000403298.8; ENST00000420312.5
External Link RMBase: m6A_site_716543
mod ID: M6ASITE075058 Click to Show/Hide the Full List
mod site chr6:41684845-41684846:- [3]
Sequence ATCCCCATTCCATCACCTGGACTTCAGCCACAGCCTGAGCT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; LCLs; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406563.6; ENST00000343317.10; ENST00000358871.6; ENST00000420312.5; ENST00000403298.8; ENST00000230323.8; ENST00000373033.6
External Link RMBase: m6A_site_716544
mod ID: M6ASITE075059 Click to Show/Hide the Full List
mod site chr6:41685019-41685020:- [3]
Sequence CACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGC
Motif Score 2.951386905
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000403298.8; ENST00000373033.6; ENST00000420312.5; ENST00000230323.8; ENST00000406563.6; ENST00000358871.6; ENST00000343317.10
External Link RMBase: m6A_site_716545
mod ID: M6ASITE075060 Click to Show/Hide the Full List
mod site chr6:41686141-41686142:- [4]
Sequence AAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGA
Motif Score 2.930744048
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000358871.6; ENST00000343317.10; ENST00000373033.6; ENST00000230323.8; ENST00000403298.8; ENST00000420312.5; ENST00000406563.6
External Link RMBase: m6A_site_716546
mod ID: M6ASITE075061 Click to Show/Hide the Full List
mod site chr6:41686168-41686169:- [4]
Sequence CATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGC
Motif Score 3.622404762
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000406563.6; ENST00000230323.8; ENST00000403298.8; ENST00000373033.6; ENST00000343317.10; ENST00000420312.5; ENST00000358871.6
External Link RMBase: m6A_site_716547
mod ID: M6ASITE075062 Click to Show/Hide the Full List
mod site chr6:41686222-41686223:- [5]
Sequence CTGCAGGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGG
Motif Score 2.951386905
Cell/Tissue List brain; kidney; endometrial
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000403298.8; ENST00000230323.8; ENST00000358871.6; ENST00000343317.10; ENST00000406563.6; ENST00000373033.6; ENST00000420312.5
External Link RMBase: m6A_site_716548
mod ID: M6ASITE075063 Click to Show/Hide the Full List
mod site chr6:41686537-41686538:- [6]
Sequence AGCCTGGGCAACAGAACGAGACTCCATCTCAAAAAAAAAAA
Motif Score 3.319380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000373033.6; ENST00000358871.6; ENST00000343317.10; ENST00000403298.8; rmsk_1929735; ENST00000230323.8; ENST00000394283.5; ENST00000406563.6; ENST00000420312.5
External Link RMBase: m6A_site_716549
mod ID: M6ASITE075064 Click to Show/Hide the Full List
mod site chr6:41687766-41687767:- [3]
Sequence CAAGGAGCGGCAGAAGAAAGACAATCACAACTTAAGTGAGT
Motif Score 2.897386905
Cell/Tissue List HeLa; LCLs
Seq Type List m6A-seq
Transcript ID List ENST00000230323.8; ENST00000358871.6; ENST00000343317.10; ENST00000403298.8; ENST00000406563.6; ENST00000416140.5; ENST00000419396.5; ENST00000494822.1; ENST00000373033.6; ENST00000394283.5; ENST00000420312.5
External Link RMBase: m6A_site_716550
mod ID: M6ASITE075065 Click to Show/Hide the Full List
mod site chr6:41688112-41688113:- [3]
Sequence TCCAGGTGTCCCCAGGAAGGACTGCTCCTGGGATGATAGGC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406563.6; ENST00000343317.10; ENST00000403298.8; ENST00000416140.5; ENST00000494822.1; ENST00000373033.6; ENST00000358871.6; ENST00000230323.8; ENST00000394283.5; ENST00000419396.5; ENST00000419574.5; ENST00000420312.5
External Link RMBase: m6A_site_716551
mod ID: M6ASITE075066 Click to Show/Hide the Full List
mod site chr6:41688182-41688183:- [3]
Sequence AATAGCTCTGGACTCTGCAGACCTTCAGGTTGAATTGCTGG
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000358871.6; ENST00000343317.10; ENST00000373033.6; ENST00000494822.1; ENST00000403298.8; ENST00000406563.6; ENST00000394283.5; ENST00000419396.5; ENST00000230323.8; ENST00000420312.5; ENST00000416140.5; ENST00000419574.5
External Link RMBase: m6A_site_716552
mod ID: M6ASITE075067 Click to Show/Hide the Full List
mod site chr6:41688191-41688192:- [3]
Sequence ACATCTTATAATAGCTCTGGACTCTGCAGACCTTCAGGTTG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000494822.1; ENST00000419396.5; ENST00000420312.5; ENST00000394283.5; ENST00000373033.6; ENST00000343317.10; ENST00000419574.5; ENST00000403298.8; ENST00000406563.6; ENST00000416140.5; ENST00000230323.8; ENST00000358871.6
External Link RMBase: m6A_site_716553
mod ID: M6ASITE075068 Click to Show/Hide the Full List
mod site chr6:41690746-41690747:- [3]
Sequence TCCCCAGGGGTGCGAGCTGGACACGTGCTGTCCTCCTCCGC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000403298.8; ENST00000343317.10; ENST00000419574.5; ENST00000373033.6; ENST00000420312.5; ENST00000230323.8; ENST00000406563.6; ENST00000416140.5; ENST00000419396.5; ENST00000394283.5; ENST00000358871.6
External Link RMBase: m6A_site_716554
mod ID: M6ASITE075069 Click to Show/Hide the Full List
mod site chr6:41691274-41691275:- [3]
Sequence GCCCCTGTGCTTTGAGGAGGACACGTGCCTCATATACCTGC
Motif Score 3.643047619
Cell/Tissue List HeLa; CD4T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000419574.5; ENST00000445214.1; ENST00000420312.5; ENST00000358871.6; ENST00000419396.5; ENST00000230323.8; ENST00000373033.6; ENST00000394283.5; rmsk_1929743; ENST00000424495.1; ENST00000343317.10; ENST00000425401.1; ENST00000416140.5; ENST00000403298.8; ENST00000445700.5; ENST00000433032.1
External Link RMBase: m6A_site_716555
mod ID: M6ASITE075070 Click to Show/Hide the Full List
mod site chr6:41733157-41733158:- [3]
Sequence TGAGAAGTAGGTGGAAGGGGACTCCCACCCCTCAAGTCTGG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000433032.1; ENST00000230323.8; ENST00000358871.6; ENST00000419396.5; ENST00000373033.6; ENST00000425401.1; ENST00000394283.5; ENST00000445700.5; ENST00000403298.8; ENST00000424495.1; ENST00000420312.5
External Link RMBase: m6A_site_716556
mod ID: M6ASITE075071 Click to Show/Hide the Full List
mod site chr6:41733755-41733756:- [3]
Sequence AGCTCACTGTCCGGGGAGGGACAGCCAGCAATAGTTCCTGG
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373033.6; ENST00000394283.5; ENST00000445700.5; ENST00000420312.5; ENST00000358871.6; ENST00000425401.1; ENST00000230323.8; ENST00000433032.1; ENST00000419396.5; ENST00000403298.8
External Link RMBase: m6A_site_716557
mod ID: M6ASITE075072 Click to Show/Hide the Full List
mod site chr6:41733801-41733802:- [3]
Sequence CTTGGTGCCACGACTGGGAGACAGTCCTCAGGCCCTCCCCT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000419396.5; ENST00000230323.8; ENST00000373033.6; ENST00000433032.1; ENST00000425401.1; ENST00000403298.8; ENST00000358871.6; ENST00000420312.5; ENST00000445700.5; ENST00000394283.5
External Link RMBase: m6A_site_716558
mod ID: M6ASITE075073 Click to Show/Hide the Full List
mod site chr6:41735370-41735371:- [3]
Sequence CCGCGGGGCGCGGGCGGCGGACAGATTGACCTTCAGAGCGA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000358871.6; ENST00000373033.6; ENST00000420312.5
External Link RMBase: m6A_site_716559
mod ID: M6ASITE075074 Click to Show/Hide the Full List
mod site chr6:41735411-41735412:- [3]
Sequence CTTGCGGGCCAGGCACCCGAACTTGCGACAAGTTGCCGGAG
Motif Score 3.373380952
Cell/Tissue List HeLa; GSC-11; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000373033.6; ENST00000358871.6; ENST00000420312.5
External Link RMBase: m6A_site_716560