m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00424)
Target Name Transcriptional enhancer factor TEF-4 (TEAD2)
Synonyms
TEA domain family member 2; TEAD-2; TEF4
    Click to Show/Hide
Gene Name TEAD2
Chromosomal Location 19q13.33
Function
Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds to the SPH and GT-IIC 'enhansons' (5'-GTGGAATGT-3'). May be involved in the gene regulation of neural development. Binds to the M-CAT motif.
    Click to Show/Hide
Gene ID 8463
Uniprot ID
TEAD2_HUMAN
HGNC ID
HGNC:11715
KEGG ID
hsa:8463
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TEAD2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line Cerebral cortex Mus musculus
Treatment: METTL3 (f/f, Emx1-cre) cerebral cortex
Control: Wild type cerebral cortex
 GSE154992
Regulation
logFC: 6.75E-01
p-value: 4.59E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary RNA decay assay showed that oncogene Transcriptional enhancer factor TEF-4 (TEAD2) mRNA stability was impaired by FTO. The overexpression of FTO suppressed tumor growth in vivo. In conclusion, our study demonstrated the critical roles of FTO in Intrahepatic cholangiocarcinoma.
Target Regulation Down regulation
Responsed Disease Intrahepatic cholangiocarcinoma ICD-11: 2C12.10
 Disease Info 
Cell Process Cell cycle
Cell proliferation
In-vitro Model HCCC-9810 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_6908
HIBEPIC (Human intrahepatic bile duct epithelial cells)
HuCC-T1 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_0324
RBE Intrahepatic cholangiocarcinoma Homo sapiens CVCL_4896
TFK-1 Cholangiocarcinoma Homo sapiens CVCL_2214
In-vivo Model 1.5 × 106 TFK1 cells with or without FTO overexpression were injected subcutaneously into the left and right flanks of 6-week-old female athymic nude mice.
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary YTHDF3 recruits the PAN2-PAN3 deadenylase complex and conduces to reprogramming by promoting mRNA clearance of somatic genes, including Tead2 and Tgfb1, which parallels the activity of the YTHDF2-CCR4-NOT deadenylase complex. YTHDF2/3 deficiency suppressed the mRNA clearance of MEF-related genes, especially Transcriptional enhancer factor TEF-4 (TEAD2). YTHDF2/3 couples RNA deadenylation and regulation with the clearance of somatic genes and provides insights into iPSC reprogramming at the posttranscriptional level.
Target Regulation Down regulation
Pathway Response Hippo signaling pathway hsa04390
Cell Process Epithelial-mesenchymal transition
Chromatin silencing
In-vitro Model Plat-E Normal Homo sapiens CVCL_B488
OG2 mESCs (Male OG2 mESCs were derived from E3.5 embryos ICM from female 129 mice crossing male OG2 mice)
MEF (Mouse embryonic fibroblasts)
iPSC (Mouse induced pluripotent stem cells (iPSCs))
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model OG2 (Oct4-GFP reporter) transgenic mice (CBA/CaJ × C57BL/6J) were original from Jackson Laboratory (Mouse strain datasheet: 004654).
YTH domain-containing family protein 3 (YTHDF3) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary YTHDF3 recruits the PAN2-PAN3 deadenylase complex and conduces to reprogramming by promoting mRNA clearance of somatic genes, including Tead2 and Tgfb1, which parallels the activity of the YTHDF2-CCR4-NOT deadenylase complex. YTHDF2/3 deficiency suppressed the mRNA clearance of MEF-related genes, especially Transcriptional enhancer factor TEF-4 (TEAD2). YTHDF2/3 couples RNA deadenylation and regulation with the clearance of somatic genes and provides insights into iPSC reprogramming at the posttranscriptional level.
Target Regulation Down regulation
Pathway Response Hippo signaling pathway hsa04390
Cell Process Epithelial-mesenchymal transition
Chromatin silencing
In-vitro Model Plat-E Normal Homo sapiens CVCL_B488
OG2 mESCs (Male OG2 mESCs were derived from E3.5 embryos ICM from female 129 mice crossing male OG2 mice)
MEF (Mouse embryonic fibroblasts)
iPSC (Mouse induced pluripotent stem cells (iPSCs))
HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model OG2 (Oct4-GFP reporter) transgenic mice (CBA/CaJ × C57BL/6J) were original from Jackson Laboratory (Mouse strain datasheet: 004654).
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary RNA decay assay showed that oncogene Transcriptional enhancer factor TEF-4 (TEAD2) mRNA stability was impaired by FTO. The overexpression of FTO suppressed tumor growth in vivo. In conclusion, our study demonstrated the critical roles of FTO in Intrahepatic cholangiocarcinoma.
Responsed Disease Intrahepatic cholangiocarcinoma [ICD-11: 2C12.10]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Cell Process Cell cycle
Cell proliferation
In-vitro Model HCCC-9810 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_6908
HIBEPIC (Human intrahepatic bile duct epithelial cells)
HuCC-T1 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_0324
RBE Intrahepatic cholangiocarcinoma Homo sapiens CVCL_4896
TFK-1 Cholangiocarcinoma Homo sapiens CVCL_2214
In-vivo Model 1.5 × 106 TFK1 cells with or without FTO overexpression were injected subcutaneously into the left and right flanks of 6-week-old female athymic nude mice.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00424)
Transcriptional enhancer factor TEF-4 (TEAD2)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000005 Click to Show/Hide the Full List
mod site chr19:49342574-49342575:- [3]
Sequence TTCAGACGGAACGGGCCCAGCTGGAGGACGGCAGATTTGTG
Cell/Tissue List H1
Seq Type List ac4C-seq
Transcript ID List ENST00000539846.5; ENST00000311227.6; ENST00000377214.8; ENST00000598810.5; ENST00000601519.5; ENST00000593945.5
External Link RMBase: ac4C_site_1033
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009270 Click to Show/Hide the Full List
mod site chr19:49351637-49351638:- [4]
Sequence CATCATCAAGAGCCTGAGATACCGGGCTGAGACTGACCTGG
Transcript ID List ENST00000601519.5; ENST00000539846.5; ENST00000593945.5; ENST00000311227.6; ENST00000598810.5; ENST00000598397.1; ENST00000596757.1; rmsk_5022049; ENST00000598823.5; ENST00000377214.8
External Link RMBase: RNA-editing_site_71846
N6-methyladenosine (m6A)
In total 32 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041995 Click to Show/Hide the Full List
mod site chr19:49340708-49340709:- [5]
Sequence CTGCACAAGCAGTGTGTTGAACTTTCTAATCTCATCCCTCT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000593945.5; ENST00000598810.5; ENST00000311227.6; ENST00000601519.5; ENST00000377214.8
External Link RMBase: m6A_site_448383
mod ID: M6ASITE041996 Click to Show/Hide the Full List
mod site chr19:49341031-49341032:- [6]
Sequence ATTGTGGGGACAGGAGTGAGACAACCCCCCAGGTACAGCAC
Motif Score 2.897386905
Cell/Tissue List A549; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000377214.8; ENST00000601519.5; ENST00000598810.5; ENST00000311227.6; ENST00000593945.5
External Link RMBase: m6A_site_448385
mod ID: M6ASITE041997 Click to Show/Hide the Full List
mod site chr19:49341042-49341043:- [6]
Sequence GAGTATCAGGGATTGTGGGGACAGGAGTGAGACAACCCCCC
Motif Score 3.643047619
Cell/Tissue List A549; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000593945.5; ENST00000377214.8; ENST00000311227.6; ENST00000601519.5; ENST00000598810.5
External Link RMBase: m6A_site_448386
mod ID: M6ASITE041998 Click to Show/Hide the Full List
mod site chr19:49341075-49341076:- [6]
Sequence CACAGTGGGTGTCTGAAAGGACAGATCACTCCGGAGTATCA
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000601519.5; ENST00000593945.5; ENST00000311227.6; ENST00000598810.5; ENST00000377214.8
External Link RMBase: m6A_site_448387
mod ID: M6ASITE041999 Click to Show/Hide the Full List
mod site chr19:49341099-49341100:- [6]
Sequence GGATAAACCCCGATATTGGGACCTCACAGTGGGTGTCTGAA
Motif Score 3.622404762
Cell/Tissue List HeLa; A549; HepG2; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000598810.5; ENST00000601519.5; ENST00000311227.6; ENST00000593945.5; ENST00000539846.5; ENST00000377214.8
External Link RMBase: m6A_site_448388
mod ID: M6ASITE042000 Click to Show/Hide the Full List
mod site chr19:49341113-49341114:- [6]
Sequence TGGGACTGAGGAAAGGATAAACCCCGATATTGGGACCTCAC
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; HepG2; U2OS; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000377214.8; ENST00000593945.5; ENST00000539846.5; ENST00000601519.5; ENST00000598810.5; ENST00000311227.6
External Link RMBase: m6A_site_448389
mod ID: M6ASITE042001 Click to Show/Hide the Full List
mod site chr19:49341129-49341130:- [6]
Sequence GGAGAGCTGAACAGGCTGGGACTGAGGAAAGGATAAACCCC
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; HepG2; U2OS; endometrial
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000601519.5; ENST00000377214.8; ENST00000593945.5; ENST00000539846.5; ENST00000311227.6; ENST00000598810.5
External Link RMBase: m6A_site_448390
mod ID: M6ASITE042002 Click to Show/Hide the Full List
mod site chr19:49341139-49341140:- [6]
Sequence AAACTTGGTTGGAGAGCTGAACAGGCTGGGACTGAGGAAAG
Motif Score 2.951386905
Cell/Tissue List HeLa; A549; HepG2; U2OS; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000539846.5; ENST00000601519.5; ENST00000377214.8; ENST00000593945.5; ENST00000311227.6; ENST00000598810.5
External Link RMBase: m6A_site_448391
mod ID: M6ASITE042003 Click to Show/Hide the Full List
mod site chr19:49341157-49341158:- [6]
Sequence CCATTAGAGGGGCCCCCAAAACTTGGTTGGAGAGCTGAACA
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; HepG2; U2OS; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000311227.6; ENST00000601519.5; ENST00000593945.5; ENST00000377214.8; ENST00000539846.5; ENST00000598810.5
External Link RMBase: m6A_site_448392
mod ID: M6ASITE042004 Click to Show/Hide the Full List
mod site chr19:49341290-49341291:- [7]
Sequence AAACTGGCTCACCCCCCAGAACACCCTCCTCCCAGGGAGGG
Motif Score 2.951386905
Cell/Tissue List HepG2; HeLa; U2OS; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000593945.5; ENST00000601519.5; ENST00000377214.8; ENST00000539846.5; ENST00000598810.5; ENST00000311227.6
External Link RMBase: m6A_site_448393
mod ID: M6ASITE042005 Click to Show/Hide the Full List
mod site chr19:49341308-49341309:- [7]
Sequence GACTGAAGGGGGACCCCAAAACTGGCTCACCCCCCAGAACA
Motif Score 2.627720238
Cell/Tissue List HepG2; HeLa; U2OS; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000539846.5; ENST00000593945.5; ENST00000377214.8; ENST00000598810.5; ENST00000311227.6; ENST00000601519.5
External Link RMBase: m6A_site_448394
mod ID: M6ASITE042006 Click to Show/Hide the Full List
mod site chr19:49341316-49341317:- [7]
Sequence TGGTCAGGGACTGAAGGGGGACCCCAAAACTGGCTCACCCC
Motif Score 3.622404762
Cell/Tissue List HepG2; HeLa; U2OS; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000593945.5; ENST00000311227.6; ENST00000598810.5; ENST00000377214.8; ENST00000601519.5; ENST00000539846.5
External Link RMBase: m6A_site_448395
mod ID: M6ASITE042007 Click to Show/Hide the Full List
mod site chr19:49341327-49341328:- [7]
Sequence CATTTACCGCCTGGTCAGGGACTGAAGGGGGACCCCAAAAC
Motif Score 4.065041667
Cell/Tissue List HepG2; HeLa; U2OS; A549
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000598810.5; ENST00000593945.5; ENST00000311227.6; ENST00000601519.5; ENST00000377214.8; ENST00000539846.5
External Link RMBase: m6A_site_448396
mod ID: M6ASITE042008 Click to Show/Hide the Full List
mod site chr19:49341410-49341411:- [8]
Sequence ACAAACAGAGACACCCAGGAACTGCTGCTCTGCACCGCCTA
Motif Score 3.373380952
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000601519.5; ENST00000311227.6; ENST00000593945.5; ENST00000377214.8; ENST00000598810.5; ENST00000539846.5
External Link RMBase: m6A_site_448397
mod ID: M6ASITE042009 Click to Show/Hide the Full List
mod site chr19:49341420-49341421:- [8]
Sequence GCAGGTGGTGACAAACAGAGACACCCAGGAACTGCTGCTCT
Motif Score 2.897386905
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000593945.5; ENST00000539846.5; ENST00000598810.5; ENST00000377214.8; ENST00000311227.6; ENST00000601519.5
External Link RMBase: m6A_site_448398
mod ID: M6ASITE042010 Click to Show/Hide the Full List
mod site chr19:49341426-49341427:- [8]
Sequence TTCCTGGCAGGTGGTGACAAACAGAGACACCCAGGAACTGC
Motif Score 2.20572619
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000598810.5; ENST00000377214.8; ENST00000539846.5; ENST00000601519.5; ENST00000311227.6; ENST00000593945.5
External Link RMBase: m6A_site_448399
mod ID: M6ASITE042011 Click to Show/Hide the Full List
mod site chr19:49343296-49343297:- [9]
Sequence AGCCAGTATGAGAGCCTGGAACACATGACCCTCACCTGTTC
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000601519.5; ENST00000377214.8; ENST00000598810.5; ENST00000593945.5; ENST00000539846.5; ENST00000311227.6
External Link RMBase: m6A_site_448400
mod ID: M6ASITE042012 Click to Show/Hide the Full List
mod site chr19:49348723-49348724:- [10]
Sequence GAGTTCTCAGCCTTCGTGGAACCGCCAGATGCAGTTGATTC
Motif Score 2.930744048
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000596757.1; ENST00000598397.1; ENST00000598810.5; ENST00000311227.6; ENST00000598823.5; ENST00000539846.5; ENST00000601519.5; ENST00000377214.8; ENST00000593945.5
External Link RMBase: m6A_site_448401
mod ID: M6ASITE042013 Click to Show/Hide the Full List
mod site chr19:49349052-49349053:- [11]
Sequence TCTTTTTCATTCAGGAAGAAACTCCTTCCCAGAAGCCCCCC
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000311227.6; ENST00000539846.5; ENST00000593945.5; ENST00000596757.1; ENST00000601519.5; ENST00000598810.5; ENST00000598823.5; ENST00000377214.8; ENST00000598397.1
External Link RMBase: m6A_site_448402
mod ID: M6ASITE042014 Click to Show/Hide the Full List
mod site chr19:49351345-49351346:- [11]
Sequence GTGTGAAGCCATTCTCACAGACACCGTTCACCTTGTCACTG
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000377214.8; ENST00000311227.6; ENST00000539846.5; ENST00000598810.5; ENST00000593945.5; ENST00000601519.5; ENST00000596757.1; ENST00000598823.5; ENST00000598397.1
External Link RMBase: m6A_site_448403
mod ID: M6ASITE042015 Click to Show/Hide the Full List
mod site chr19:49355332-49355333:- [9]
Sequence GCGCCTTCTCTGCAGGCCAAACTGGGTCCCACTGGTCCTCA
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000598810.5; ENST00000598397.1; ENST00000539846.5; ENST00000377214.8; ENST00000311227.6; ENST00000593945.5; ENST00000596757.1; ENST00000598823.5; ENST00000601519.5
External Link RMBase: m6A_site_448404
mod ID: M6ASITE042016 Click to Show/Hide the Full List
mod site chr19:49355388-49355389:- [9]
Sequence CCAAGGACAAGGCTTTCCAGACAATGGCAACCATGTCCTCT
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000598823.5; ENST00000593945.5; ENST00000377214.8; ENST00000598397.1; ENST00000539846.5; ENST00000598810.5; ENST00000311227.6; ENST00000596757.1; ENST00000601519.5
External Link RMBase: m6A_site_448405
mod ID: M6ASITE042017 Click to Show/Hide the Full List
mod site chr19:49355402-49355403:- [9]
Sequence CCAGGACCAGGTTTCCAAGGACAAGGCTTTCCAGACAATGG
Motif Score 3.643047619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000596757.1; ENST00000377214.8; ENST00000598810.5; ENST00000539846.5; ENST00000311227.6; ENST00000593945.5; ENST00000598397.1; ENST00000601519.5; ENST00000598823.5
External Link RMBase: m6A_site_448406
mod ID: M6ASITE042018 Click to Show/Hide the Full List
mod site chr19:49359932-49359933:- [5]
Sequence AGAGGGGGTGTGGAGCCCAGACATTGAGCAGAGCTTCCAGG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; H1B; H1A; GSC-11; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000601519.5; ENST00000593945.5; ENST00000311227.6; ENST00000539846.5; ENST00000377214.8; ENST00000598810.5; ENST00000596757.1
External Link RMBase: m6A_site_448407
mod ID: M6ASITE042019 Click to Show/Hide the Full List
mod site chr19:49360066-49360067:- [5]
Sequence CTCCAGGCCCAGATGGGGGAACCCCGGGCTGGGGCCGCCCT
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; H1B; H1A; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000601519.5; ENST00000596757.1; ENST00000593945.5; ENST00000598810.5; ENST00000377214.8; ENST00000539846.5; ENST00000311227.6
External Link RMBase: m6A_site_448408
mod ID: M6ASITE042020 Click to Show/Hide the Full List
mod site chr19:49360170-49360171:- [5]
Sequence CCCAGCCCCTCCTCCCTCAGACCCAGTGGTCCAGAGTCCCA
Motif Score 2.876744048
Cell/Tissue List HeLa; GSC-11; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000539846.5; ENST00000596757.1; rmsk_5022075; ENST00000311227.6; ENST00000593945.5; ENST00000377214.8; ENST00000601519.5; ENST00000598810.5
External Link RMBase: m6A_site_448409
mod ID: M6ASITE042021 Click to Show/Hide the Full List
mod site chr19:49360207-49360208:- [5]
Sequence CCCAGCTCCTCTTCCCTCAGACCCAGGAGTCCAGGTCCCCA
Motif Score 2.876744048
Cell/Tissue List HeLa; GSC-11; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000377214.8; ENST00000593945.5; ENST00000311227.6; ENST00000598810.5; ENST00000596757.1; rmsk_5022075; ENST00000539846.5; ENST00000601519.5
External Link RMBase: m6A_site_448410
mod ID: M6ASITE042022 Click to Show/Hide the Full List
mod site chr19:49360241-49360242:- [5]
Sequence CCCAGATCCTCCTCCCTCAGACCCAGGAATACCCCCCAGCT
Motif Score 2.876744048
Cell/Tissue List HeLa; GSC-11; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000539846.5; ENST00000596757.1; ENST00000377214.8; ENST00000601519.5; rmsk_5022075; ENST00000598810.5; ENST00000311227.6; ENST00000593945.5
External Link RMBase: m6A_site_448411
mod ID: M6ASITE042023 Click to Show/Hide the Full List
mod site chr19:49360277-49360278:- [5]
Sequence CCCAGCCCCTCCTCCCTCAGACTCAGGAGTTCAGGCCCCAG
Motif Score 3.319380952
Cell/Tissue List HeLa; GSC-11; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000601519.5; ENST00000311227.6; ENST00000539846.5; ENST00000598810.5; ENST00000377214.8; ENST00000596757.1; rmsk_5022075; ENST00000593945.5
External Link RMBase: m6A_site_448412
mod ID: M6ASITE042024 Click to Show/Hide the Full List
mod site chr19:49360349-49360350:- [5]
Sequence TCCAGCCCCCGCTCCCTCAGACCCAGGAGTCCAGGCCCCAG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000593945.5; ENST00000596757.1; rmsk_5022075; ENST00000377214.8; ENST00000598810.5; ENST00000311227.6; ENST00000539846.5; ENST00000601519.5
External Link RMBase: m6A_site_448413
mod ID: M6ASITE042025 Click to Show/Hide the Full List
mod site chr19:49360408-49360409:- [5]
Sequence CCTCAGACTCAGGAGTCCAGACCCCAGCCCCTTCTCCCTCA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000593945.5; rmsk_5022075; ENST00000377214.8; ENST00000596757.1; ENST00000601519.5; ENST00000311227.6; ENST00000598810.5; ENST00000539846.5
External Link RMBase: m6A_site_448414
mod ID: M6ASITE042026 Click to Show/Hide the Full List
mod site chr19:49360422-49360423:- [5]
Sequence AGCTCCTTCTCCTCCCTCAGACTCAGGAGTCCAGACCCCAG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000598810.5; ENST00000596757.1; ENST00000377214.8; ENST00000539846.5; ENST00000601519.5; ENST00000593945.5; ENST00000311227.6; rmsk_5022075
External Link RMBase: m6A_site_448415
N7-methylguanosine (m7G)
In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000062 Click to Show/Hide the Full List
mod site chr19:49359957-49359958:- [12]
Sequence CTGGGGGTGACGGGGGCCCGGATGCAGAGGGGGTGTGGAGC
Cell/Tissue List A549; HeLa; HepG2
Seq Type List BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List ENST00000311227.6; ENST00000596757.1; ENST00000601519.5; ENST00000598810.5; ENST00000593945.5; ENST00000377214.8; ENST00000539846.5
External Link RMBase: m7G_site_492