m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00408)

Target Name	Transcription factor PU.1 (SPI1)
Synonyms	31 kDa-transforming protein Click to Show/Hide
Gene Name	SPI1
Chromosomal Location	11p11.2
Family	ETS family
Function	Binds to the PU-box, a purine-rich DNA sequence (5'-GAGGAA-3') that can act as a lymphoid-specific enhancer. This protein is a transcriptional activator that may be specifically involved in the differentiation or activation of macrophages or B-cells. Also binds RNA and may modulate pre-mRNA splicing (By similarity). Click to Show/Hide
Gene ID	6688
Uniprot ID	SPI1_HUMAN
HGNC ID	HGNC:11241
KEGG ID	hsa:6688

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SPI1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	TPC_1 cell line	Homo sapiens
Treatment: FTO overexpression TPC_1 cells Control: TPC_1 cells		GSE199206
Regulation		logFC: -7.40E+00 p-value: 4.06E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO inhibited growth, migration and invasion of GBM cells in vitro and in vivo.decreased FTO expression could induce the downregulation of MTMR3 expression by modulating the processing of pri-miR-10a in an m6A/HNRNPA2B1-dependent manner in GBM cells. Furthermore, the transcriptional activity of FTO was inhibited by the transcription factor Transcription factor PU.1 (SPI1).
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
	U251 (Fibroblasts or fibroblast like cells)
	U-118MG	Astrocytoma	Homo sapiens	CVCL_0633
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	A-172	Glioblastoma	Homo sapiens	CVCL_0131
In-vivo Model	BALB/c male nude mice were 4 weeks old. GBM cells with stable overexpression or knockdown of FTO and ovNC or shNC were transduced with lentivirus expressing luciferase. The cells were intracranially injected at a density of 5 × 10⁵/10 uL into every mouse to form an orthotopic xenograft model. Coordinates of injection were 1 mm anterior and 2.5 mm right to the bregma, at a depth of 3.5 mm (the right frontal lobes of the mouse). Every 6 days, bioluminescence imaging (IVIS Lumina Series III; PerkinElmer, Waltham, MA) was used to image the mouse. At 8 days, we randomly chose 5 mice from each group to euthanize them, and their brain tissues were fixed with paraformaldehyde for further study. Another 5 mice were used for survival time analysis. For DB2313 (563801; MedKoo) anti-tumor research, male nude mice were subcutaneously injected with 5 × 10⁶ U87MG cells suspended in 0.1 mL PBS. After 7 days, mice were intraperitoneally injected with DB2313 at density of 10 mg/kg/day dissolved in PBS solvent containing 10% DMSO for 7 days. The other group treated with vehicle only was set as the control group.

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO inhibited growth, migration and invasion of GBM cells in vitro and in vivo.decreased FTO expression could induce the downregulation of MTMR3 expression by modulating the processing of pri-miR-10a in an m6A/HNRNPA2B1-dependent manner in GBM cells. Furthermore, the transcriptional activity of FTO was inhibited by the transcription factor Transcription factor PU.1 (SPI1).
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
	U251 (Fibroblasts or fibroblast like cells)
	U-118MG	Astrocytoma	Homo sapiens	CVCL_0633
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	A-172	Glioblastoma	Homo sapiens	CVCL_0131
In-vivo Model	BALB/c male nude mice were 4 weeks old. GBM cells with stable overexpression or knockdown of FTO and ovNC or shNC were transduced with lentivirus expressing luciferase. The cells were intracranially injected at a density of 5 × 10⁵/10 uL into every mouse to form an orthotopic xenograft model. Coordinates of injection were 1 mm anterior and 2.5 mm right to the bregma, at a depth of 3.5 mm (the right frontal lobes of the mouse). Every 6 days, bioluminescence imaging (IVIS Lumina Series III; PerkinElmer, Waltham, MA) was used to image the mouse. At 8 days, we randomly chose 5 mice from each group to euthanize them, and their brain tissues were fixed with paraformaldehyde for further study. Another 5 mice were used for survival time analysis. For DB2313 (563801; MedKoo) anti-tumor research, male nude mice were subcutaneously injected with 5 × 10⁶ U87MG cells suspended in 0.1 mL PBS. After 7 days, mice were intraperitoneally injected with DB2313 at density of 10 mg/kg/day dissolved in PBS solvent containing 10% DMSO for 7 days. The other group treated with vehicle only was set as the control group.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00408)

Transcription factor PU.1 (SPI1)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004717		Click to Show/Hide the Full List
mod site	chr11:47360224-47360225:-		[3]
Sequence	TGACCTTGGGCATGCTATGTAGCCGCTCGAAGCCTCAGTGT
Transcript ID List	ENST00000533030.1; ENST00000378538.7; ENST00000533968.1; rmsk_3543370; ENST00000227163.8
External Link	RMBase: RNA-editing_site_21540

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE005448		Click to Show/Hide the Full List
mod site	chr11:47354882-47354883:-		[4]
Sequence	CATTAACCTCCTCCCAAAAAACAAGTAAAGTTATTCTCAAT
Motif Score	2.20572619
Cell/Tissue List	CD34; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7
External Link	RMBase: m6A_site_140015
mod ID: M6ASITE005449		Click to Show/Hide the Full List
mod site	chr11:47355000-47355001:-		[4]
Sequence	GGACGCCAGCTGGGCGTCAGACCCCACCGGGGCAACCTTGC
Motif Score	2.876744048
Cell/Tissue List	CD34; LCLs; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7; ENST00000227163.8
External Link	RMBase: m6A_site_140016
mod ID: M6ASITE005450		Click to Show/Hide the Full List
mod site	chr11:47355037-47355038:-		[4]
Sequence	CCGCTTCGCCTCCCTCCAGGACTCCACCCCGGCTCCCGGAC
Motif Score	4.065041667
Cell/Tissue List	CD34; GM12878; LCLs; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7; ENST00000227163.8
External Link	RMBase: m6A_site_140017
mod ID: M6ASITE005451		Click to Show/Hide the Full List
mod site	chr11:47355120-47355121:-		[5]
Sequence	TCCCGGGGCCCAGAGGCAGGACTGTGGCGGGCCGGGCCTCG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; GM12878; LCLs; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000533030.1; ENST00000227163.8; ENST00000378538.7
External Link	RMBase: m6A_site_140018
mod ID: M6ASITE005452		Click to Show/Hide the Full List
mod site	chr11:47355155-47355156:-		[5]
Sequence	TAAGCCCTCGCCCGGCCCGGACACAGGGAGGACGCTCCCGG
Motif Score	3.643047619
Cell/Tissue List	HEK293T; GM12878; LCLs; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000227163.8; ENST00000378538.7; ENST00000533030.1
External Link	RMBase: m6A_site_140019
mod ID: M6ASITE005453		Click to Show/Hide the Full List
mod site	chr11:47355455-47355456:-		[4]
Sequence	CATCTGGTGGGTGGACAAGGACAAGGGCACCTTCCAGTTCT
Motif Score	3.643047619
Cell/Tissue List	CD34; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7; ENST00000227163.8; ENST00000533030.1
External Link	RMBase: m6A_site_140020
mod ID: M6ASITE005454		Click to Show/Hide the Full List
mod site	chr11:47355461-47355462:-		[4]
Sequence	GGACAGCATCTGGTGGGTGGACAAGGACAAGGGCACCTTCC
Motif Score	3.643047619
Cell/Tissue List	CD34; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000533030.1; ENST00000378538.7; ENST00000227163.8
External Link	RMBase: m6A_site_140021
mod ID: M6ASITE005455		Click to Show/Hide the Full List
mod site	chr11:47355479-47355480:-		[4]
Sequence	CCGCAGCGGCGACATGAAGGACAGCATCTGGTGGGTGGACA
Motif Score	3.643047619
Cell/Tissue List	CD34; MM6; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000533030.1; ENST00000378538.7; ENST00000227163.8
External Link	RMBase: m6A_site_140022
mod ID: M6ASITE005456		Click to Show/Hide the Full List
mod site	chr11:47355506-47355507:-		[4]
Sequence	CCTGTACCAGTTCCTGTTGGACCTGCTCCGCAGCGGCGACA
Motif Score	3.622404762
Cell/Tissue List	CD34; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7; ENST00000533030.1; ENST00000227163.8
External Link	RMBase: m6A_site_140023
mod ID: M6ASITE005457		Click to Show/Hide the Full List
mod site	chr11:47358846-47358847:-		[4]
Sequence	CTGGGCTCCTGCCTGGGGAGACAGGTGGGGCACCTGGCCCT
Motif Score	2.897386905
Cell/Tissue List	CD34; MM6; peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000227163.8; ENST00000533030.1; ENST00000378538.7; ENST00000533968.1
External Link	RMBase: m6A_site_140024
mod ID: M6ASITE005458		Click to Show/Hide the Full List
mod site	chr11:47359979-47359980:-		[4]
Sequence	GTTCGAGAGCTTCGCCGAGAACAACTTCACGGAGCTCCAGA
Motif Score	2.951386905
Cell/Tissue List	CD34; peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000533968.1; ENST00000378538.7; ENST00000227163.8; ENST00000533030.1
External Link	RMBase: m6A_site_140025
mod ID: M6ASITE005459		Click to Show/Hide the Full List
mod site	chr11:47360027-47360028:-		[4]
Sequence	CCCCACAGACCATTACTGGGACTTCCACCCCCACCACGTGC
Motif Score	4.065041667
Cell/Tissue List	CD34; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000227163.8; ENST00000533968.1; ENST00000378538.7; ENST00000533030.1
External Link	RMBase: m6A_site_140026
mod ID: M6ASITE005460		Click to Show/Hide the Full List
mod site	chr11:47375718-47375719:-		[4]
Sequence	CTCTCAGCAGCCATCAGAAGACCTGGTGCCCTATGACACGG
Motif Score	2.876744048
Cell/Tissue List	CD34; MM6; CD4T; peripheral-blood; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7; ENST00000533968.1; ENST00000533030.1; ENST00000227163.8
External Link	RMBase: m6A_site_140027
mod ID: M6ASITE005461		Click to Show/Hide the Full List
mod site	chr11:47378536-47378537:-		[6]
Sequence	GCCCTTCGATAAAATCAGGAACTTGTGCTGGCCCTGCAATG
Motif Score	3.373380952
Cell/Tissue List	MM6; CD4T
Seq Type List	m6A-seq
Transcript ID List	ENST00000378538.7
External Link	RMBase: m6A_site_140028

Ref 1	SPI1-induced?downregulation of FTO promotes GBM progression by regulating pri-miR-10a processing in an m6A-dependent manner. Mol Ther Nucleic Acids. 2022 Jan 1;27:699-717. doi: 10.1016/j.omtn.2021.12.035. eCollection 2022 Mar 8.
Ref 2	In vivo expansion of MDR1-transduced cells accompanied by a post-transplantation chemotherapy regimen with mitomycin C and methotrexate. J Gene Med. 2010 Jul;12(7):596-603. doi: 10.1002/jgm.1474.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 5	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 6	FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell. 2017 Jan 9;31(1):127-141. doi: 10.1016/j.ccell.2016.11.017. Epub 2016 Dec 22.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map