m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00403)
Target Name Transcription factor SOX-10 (SOX10)
Gene Name SOX10
Chromosomal Location 22q13.1
Function
Transcription factor that plays a central role in developing and mature glia (By similarity). Specifically activates expression of myelin genes, during oligodendrocyte (OL) maturation, such as DUSP15 and MYRF, thereby playing a central role in oligodendrocyte maturation and CNS myelination (By similarity). Once induced, MYRF cooperates with SOX10 to implement the myelination program (By similarity). Transcriptional activator of MITF, acting synergistically with PAX. Transcriptional activator of MBP, via binding to the gene promoter (By similarity).
    Click to Show/Hide
Gene ID 6663
Uniprot ID
SOX10_HUMAN
HGNC ID
HGNC:11190
KEGG ID
hsa:6663
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SOX10 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line Cerebral cortex Mus musculus
Treatment: METTL3 (f/f, Emx1-cre) cerebral cortex
Control: Wild type cerebral cortex
 GSE154992
Regulation
logFC: -8.13E-01
p-value: 2.61E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation Up regulation
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
 Drug Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation Down regulation
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
 Drug Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Melanoma [ICD-11: 2C30]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease Melanoma [ICD-11: 2C30]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
 Drug Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease Melanoma [ICD-11: 2C30]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
 Drug Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
PMID31239444-anti-PD1 antibody [Investigative]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), CXCR4, and Transcription factor SOX-10 (SOX10), leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00403)
Transcription factor SOX-10 (SOX10)
N6-methyladenosine (m6A)
In total 16 m6A sequence/site(s) in this target gene
mod ID: M6ASITE058127 Click to Show/Hide the Full List
mod site chr22:37972428-37972429:- [2]
Sequence TTCTGCAGCCCCCCAAATCCACATGTAACTCATTACTGTCT
Motif Score 2.053113095
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000651746.1; ENST00000396884.7; ENST00000360880.6; ENST00000446929.5
External Link RMBase: m6A_site_565693
mod ID: M6ASITE058128 Click to Show/Hide the Full List
mod site chr22:37972735-37972736:- [2]
Sequence CTCCAGGAAAGGAATCAGAGACAATTCACAGAGCCTCCCTC
Motif Score 2.897386905
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000651746.1; ENST00000446929.5; ENST00000396884.7; ENST00000360880.6
External Link RMBase: m6A_site_565694
mod ID: M6ASITE058129 Click to Show/Hide the Full List
mod site chr22:37973195-37973196:- [3]
Sequence GAATGACCCTCTATCCCAGGACCTGAGAAGGGCCTGCTCAC
Motif Score 3.622404762
Cell/Tissue List H1A; H1B
Seq Type List m6A-seq
Transcript ID List ENST00000651746.1; ENST00000446929.5; ENST00000396884.7; ENST00000360880.6
External Link RMBase: m6A_site_565695
mod ID: M6ASITE058130 Click to Show/Hide the Full List
mod site chr22:37973280-37973281:- [3]
Sequence GCCCCAGGAGAACAGGCTGGACAGAGGAGAAGGAGGTTGAC
Motif Score 3.643047619
Cell/Tissue List H1B; H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000446929.5; ENST00000396884.7; ENST00000651746.1; ENST00000360880.6
External Link RMBase: m6A_site_565696
mod ID: M6ASITE058131 Click to Show/Hide the Full List
mod site chr22:37973289-37973290:- [3]
Sequence AGCAGCAAAGCCCCAGGAGAACAGGCTGGACAGAGGAGAAG
Motif Score 2.951386905
Cell/Tissue List H1B; H1A; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000446929.5; ENST00000651746.1; ENST00000360880.6; ENST00000396884.7
External Link RMBase: m6A_site_565697
mod ID: M6ASITE058132 Click to Show/Hide the Full List
mod site chr22:37973817-37973818:- [3]
Sequence AAGCCCAGGTGAAGACAGAGACCGCGGGGCCCCAGGGGCCC
Motif Score 2.876744048
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000396884.7; ENST00000651746.1; ENST00000360880.6; ENST00000446929.5
External Link RMBase: m6A_site_565698
mod ID: M6ASITE058133 Click to Show/Hide the Full List
mod site chr22:37973823-37973824:- [3]
Sequence ATGCCAAAGCCCAGGTGAAGACAGAGACCGCGGGGCCCCAG
Motif Score 2.897386905
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000651746.1; ENST00000396884.7; ENST00000360880.6; ENST00000446929.5
External Link RMBase: m6A_site_565699
mod ID: M6ASITE058134 Click to Show/Hide the Full List
mod site chr22:37973908-37973909:- [3]
Sequence GCCCTGGCCGTGGCCAGTGGACACTCCGCCTGGATCTCCAA
Motif Score 3.643047619
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000396884.7; ENST00000446929.5; ENST00000360880.6; ENST00000651746.1
External Link RMBase: m6A_site_565700
mod ID: M6ASITE058135 Click to Show/Hide the Full List
mod site chr22:37974002-37974003:- [3]
Sequence CTTTGATGTGGCTGAGTTGGACCAGTACCTGCCGCCCAATG
Motif Score 3.622404762
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000446929.5; ENST00000651746.1; ENST00000360880.6; ENST00000396884.7
External Link RMBase: m6A_site_565701
mod ID: M6ASITE058136 Click to Show/Hide the Full List
mod site chr22:37974024-37974025:- [3]
Sequence AGGTAATGTCCAACATGGAGACCTTTGATGTGGCTGAGTTG
Motif Score 2.876744048
Cell/Tissue List H1A; H1B; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000446929.5; ENST00000360880.6; ENST00000396884.7; ENST00000651746.1
External Link RMBase: m6A_site_565702
mod ID: M6ASITE058137 Click to Show/Hide the Full List
mod site chr22:37974065-37974066:- [2]
Sequence CATCGACTTCGGCAACGTGGACATTGGTGAGATCAGCCACG
Motif Score 3.643047619
Cell/Tissue List brain; H1A; H1B; hNPCs
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000446929.5; ENST00000651746.1; ENST00000396884.7; ENST00000360880.6
External Link RMBase: m6A_site_565703
mod ID: M6ASITE058138 Click to Show/Hide the Full List
mod site chr22:37974131-37974132:- [4]
Sequence GCTGCAGTCGGGCAAGGCAGACCCGAAGCGGGACGGGCGCT
Motif Score 2.876744048
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000360880.6; ENST00000446929.5; ENST00000396884.7; ENST00000651746.1
External Link RMBase: m6A_site_565704
mod ID: M6ASITE058139 Click to Show/Hide the Full List
mod site chr22:37974156-37974157:- [4]
Sequence CCCCTCCAACCACCCCGAAGACAGAGCTGCAGTCGGGCAAG
Motif Score 2.897386905
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000446929.5; ENST00000651746.1; ENST00000396884.7; ENST00000360880.6
External Link RMBase: m6A_site_565705
mod ID: M6ASITE058140 Click to Show/Hide the Full List
mod site chr22:37977883-37977884:- [4]
Sequence CTCCCCCATGTCAGATGGGAACCCCGAGCACCCCTCAGGTG
Motif Score 2.930744048
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000396884.7; ENST00000651746.1; ENST00000446929.5; ENST00000360880.6
External Link RMBase: m6A_site_565706
mod ID: M6ASITE058141 Click to Show/Hide the Full List
mod site chr22:37983843-37983844:- [3]
Sequence GCGTTGGACTCTTTGCGAGGACCCCGGCGGCTGGCCCGGGG
Motif Score 3.622404762
Cell/Tissue List H1B
Seq Type List m6A-seq
Transcript ID List ENST00000360880.6; ENST00000470555.1; ENST00000652356.1; ENST00000427770.1; ENST00000396884.7
External Link RMBase: m6A_site_565707
mod ID: M6ASITE058142 Click to Show/Hide the Full List
mod site chr22:37983856-37983857:- [3]
Sequence TCCATCCAGGTGGGCGTTGGACTCTTTGCGAGGACCCCGGC
Motif Score 4.065041667
Cell/Tissue List H1B
Seq Type List m6A-seq
Transcript ID List ENST00000652356.1; ENST00000360880.6; ENST00000396884.7; ENST00000470555.1; ENST00000427770.1
External Link RMBase: m6A_site_565708