General Information of the m6A Target Gene (ID: M6ATAR00392)
Target Name E3 ubiquitin-protein ligase SIAH1 (SIAH1)
Synonyms
RING-type E3 ubiquitin transferase SIAH1; Seven in absentia homolog 1; Siah-1; Siah-1a; HUMSIAH
    Click to Show/Hide
Gene Name SIAH1
Chromosomal Location 16q12.1
Family SINA (Seven in absentia) family
Function
E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates . Mediates E3 ubiquitin ligase activity either through direct binding to substrates or by functioning as the essential RING domain subunit of larger E3 complexes. Triggers the ubiquitin-mediated degradation of many substrates, including proteins involved in transcription regulation (ELL2, MYB, POU2AF1, PML and RBBP8), a cell surface receptor (DCC), the cell-surface receptor-type tyrosine kinase FLT3, the cytoplasmic signal transduction molecules (KLF10/TIEG1 and NUMB), an antiapoptotic protein (BAG1), a microtubule motor protein (KIF22), a protein involved in synaptic vesicle function in neurons (SYP), a structural protein (CTNNB1) and SNCAIP. Confers constitutive instability to HIPK2 through proteasomal degradation. It is thereby involved in many cellular processes such as apoptosis, tumor suppression, cell cycle, axon guidance, transcription regulation, spermatogenesis and TNF-alpha signaling. Has some overlapping function with SIAH2. Induces apoptosis in cooperation with PEG3 (By similarity). Upon nitric oxid (NO) generation that follows apoptotic stimulation, interacts with S-nitrosylated GAPDH, mediating the translocation of GAPDH to the nucleus (By similarity). GAPDH acts as a stabilizer of SIAH1, facilitating the degradation of nuclear proteins (By similarity). Mediates ubiquitination and degradation of EGLN2 and EGLN3 in response to the unfolded protein response (UPR), leading to their degradation and subsequent stabilization of ATF4 (By similarity).
    Click to Show/Hide
Gene ID 6477
Uniprot ID
SIAH1_HUMAN
HGNC ID
HGNC:10857
KEGG ID
hsa:6477
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SIAH1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1
Cell Line c2c12 cell line Mus musculus
Treatment: HNRNPA2B1 knockout c2c12 cells
Control: WT c2c12 cells
GSE152467
Regulation
logFC: 1.19E+00
p-value: 5.63E-11
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The RP11/hnRNPA2B1/mRNA complex accelerated the mRNA degradation of two E3 ligases, E3 ubiquitin-protein ligase SIAH1 (SIAH1) and Fbxo45, and subsequently prevented the proteasomal degradation of Zeb1. m6A can regulate the expression of RP11, further, RP11 regulated Siah1-Fbxo45/Zeb1 was involved in the development of Colorectal cancer.
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 15 Colon adenocarcinoma Homo sapiens CVCL_0292
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
RKO Colon carcinoma Homo sapiens CVCL_0504
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
In-vivo Model HCT-15 RP11 stable overexpression or control cells (2 × 106 per mouse) diluted in 100 uL normal medium + 100 uL Matrigel (BD Biosciences) were subcutaneously injected into immunodeficient mice to investigate tumour growth.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The RP11/hnRNPA2B1/mRNA complex accelerated the mRNA degradation of two E3 ligases, E3 ubiquitin-protein ligase SIAH1 (SIAH1) and Fbxo45, and subsequently prevented the proteasomal degradation of Zeb1. m6A can regulate the expression of RP11, further, RP11 regulated Siah1-Fbxo45/Zeb1 was involved in the development of Colorectal cancer.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
Target Regulation Down regulation
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
HCT 15 Colon adenocarcinoma Homo sapiens CVCL_0292
HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
RKO Colon carcinoma Homo sapiens CVCL_0504
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
In-vivo Model HCT-15 RP11 stable overexpression or control cells (2 × 106 per mouse) diluted in 100 uL normal medium + 100 uL Matrigel (BD Biosciences) were subcutaneously injected into immunodeficient mice to investigate tumour growth.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05295
Epigenetic Regulator RP11-138 J23.1 (RP11)
Regulated Target Heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1)
Crosstalk relationship ncRNA → m6A
Disease Colorectal cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00392)
E3 ubiquitin-protein ligase SIAH1 (SIAH1)
Adenosine-to-Inosine editing (A-to-I)
In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007324 Click to Show/Hide the Full List
mod site chr16:48359148-48359149:- [2]
Sequence GAAACCCTGTCTCTACTAAAAGTACAAAAAAGCCAGGCATG
Transcript ID List rmsk_4524493; ENST00000568007.5; ENST00000565620.5
External Link RMBase: RNA-editing_site_51122
mod ID: A2ISITE007325 Click to Show/Hide the Full List
mod site chr16:48364720-48364721:- [3]
Sequence AGTAAACTGGACCATGCAGTAGGCATACAGCATACAGCCAG
Transcript ID List ENST00000356721.3; ENST00000568007.5; ENST00000394725.3; ENST00000563745.1
External Link RMBase: RNA-editing_site_51123
mod ID: A2ISITE007326 Click to Show/Hide the Full List
mod site chr16:48367126-48367127:- [3]
Sequence CAGGCTGATGGCTTTAGCCCAGGAGTTCGAGACCAGCCTGG
Transcript ID List rmsk_4524501; ENST00000563745.1; ENST00000394725.3; ENST00000568007.5
External Link RMBase: RNA-editing_site_51124
mod ID: A2ISITE007327 Click to Show/Hide the Full List
mod site chr16:48369534-48369535:- [3]
Sequence TATTGCCTAGGCTTGTCTCAAACTCTTGGGCTCAAGTGATC
Transcript ID List ENST00000568007.5; ENST00000394725.3; ENST00000563745.1
External Link RMBase: RNA-editing_site_51125
5-methylcytidine (m5C)
In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000722 Click to Show/Hide the Full List
mod site chr16:48385451-48385452:-
Sequence CGCCTCCTCATGGCCGCCGCCGCAGTGTGTGGTATTTAGCG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000568007.5; ENST00000563745.1
External Link RMBase: m5C_site_16055
mod ID: M5CSITE000723 Click to Show/Hide the Full List
mod site chr16:48385452-48385453:-
Sequence GCGCCTCCTCATGGCCGCCGCCGCAGTGTGTGGTATTTAGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000568007.5; ENST00000563745.1
External Link RMBase: m5C_site_16056
mod ID: M5CSITE000724 Click to Show/Hide the Full List
mod site chr16:48385454-48385455:-
Sequence CCGCGCCTCCTCATGGCCGCCGCCGCAGTGTGTGGTATTTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000568007.5; ENST00000563745.1
External Link RMBase: m5C_site_16057
mod ID: M5CSITE000725 Click to Show/Hide the Full List
mod site chr16:48385458-48385459:-
Sequence GGGGCCGCGCCTCCTCATGGCCGCCGCCGCAGTGTGTGGTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000563745.1; ENST00000568007.5
External Link RMBase: m5C_site_16058
N6-methyladenosine (m6A)
In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE026933 Click to Show/Hide the Full List
mod site chr16:48360704-48360705:- [4]
Sequence TCCTTTTTCAGATATCTTGGACAAATCACATATTTTAAAAT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000568007.5; ENST00000356721.3; ENST00000565620.5; ENST00000380006.2; ENST00000394725.3
External Link RMBase: m6A_site_320215
mod ID: M6ASITE026934 Click to Show/Hide the Full List
mod site chr16:48360745-48360746:- [5]
Sequence ATAAATTGATTTTTATAAATACTGCAAATCAGGCTTTTGTT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000568007.5; ENST00000394725.3; ENST00000565620.5
External Link RMBase: m6A_site_320216
mod ID: M6ASITE026935 Click to Show/Hide the Full List
mod site chr16:48360799-48360800:- [4]
Sequence CTGTCTTCTACAGATGAGTCACACCTTTGAGCTTAATCTTT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565620.5; ENST00000356721.3; ENST00000394725.3; ENST00000380006.2; ENST00000568007.5
External Link RMBase: m6A_site_320217
mod ID: M6ASITE026936 Click to Show/Hide the Full List
mod site chr16:48360872-48360873:- [5]
Sequence AGTTCCAGAAAGTAAAGGTGACATCGGAAAAATAATCAAAA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000394725.3; ENST00000568007.5; ENST00000565620.5
External Link RMBase: m6A_site_320218
mod ID: M6ASITE026937 Click to Show/Hide the Full List
mod site chr16:48360970-48360971:- [5]
Sequence TTTATGGTAAAAAATTTATAACGTGTTCAATATTTTCTTTT
Motif Score 2.142029762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000394725.3; ENST00000380006.2; ENST00000568007.5; ENST00000356721.3; ENST00000565620.5
External Link RMBase: m6A_site_320219
mod ID: M6ASITE026938 Click to Show/Hide the Full List
mod site chr16:48361028-48361029:- [5]
Sequence CAGGTTTTTCCTTTTTTTGTACCATTTTAAAGTTAGTATCT
Motif Score 2.8355
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000394725.3; ENST00000565620.5; ENST00000380006.2; ENST00000568007.5; ENST00000356721.3
External Link RMBase: m6A_site_320220
mod ID: M6ASITE026939 Click to Show/Hide the Full List
mod site chr16:48361062-48361063:- [5]
Sequence TTTTTCATTAAATAAATTTGACTTTTCTGTAATTCAGGTTT
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380006.2; ENST00000568007.5; ENST00000356721.3; ENST00000394725.3; ENST00000565620.5
External Link RMBase: m6A_site_320221
mod ID: M6ASITE026940 Click to Show/Hide the Full List
mod site chr16:48361139-48361140:- [5]
Sequence TTTTCCCTTTGTGAGTCAATACATAGTGCTGCTGTGTGCTT
Motif Score 2.110482143
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000565620.5; ENST00000568007.5; ENST00000394725.3
External Link RMBase: m6A_site_320222
mod ID: M6ASITE026941 Click to Show/Hide the Full List
mod site chr16:48361191-48361192:- [5]
Sequence GGGTTTTTTTCCTTTAACTGACAAGCCATCTTGAGTGGTCA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000565620.5; ENST00000356721.3; ENST00000380006.2; ENST00000394725.3; ENST00000568007.5
External Link RMBase: m6A_site_320223
mod ID: M6ASITE026942 Click to Show/Hide the Full List
mod site chr16:48361355-48361356:- [4]
Sequence CTGAAAAAATATATGTATATACACCCAAGATGGGCATCTTT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565620.5; ENST00000380006.2; ENST00000356721.3; ENST00000568007.5; ENST00000394725.3
External Link RMBase: m6A_site_320224
mod ID: M6ASITE026943 Click to Show/Hide the Full List
mod site chr16:48361376-48361377:- [5]
Sequence AAATAAGTCAACAGTAAACCACTGAAAAAATATATGTATAT
Motif Score 2.475107143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000565620.5; ENST00000568007.5; ENST00000356721.3; ENST00000394725.3; ENST00000380006.2
External Link RMBase: m6A_site_320225
mod ID: M6ASITE026944 Click to Show/Hide the Full List
mod site chr16:48361379-48361380:- [6]
Sequence TAAAAATAAGTCAACAGTAAACCACTGAAAAAATATATGTA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hNPCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000568007.5; ENST00000565620.5; ENST00000394725.3; ENST00000356721.3; ENST00000380006.2
External Link RMBase: m6A_site_320226
mod ID: M6ASITE026945 Click to Show/Hide the Full List
mod site chr16:48361428-48361429:- [6]
Sequence AAGGCTGTTAAATACAGGAAACAGTTGCATGTAGTAACACT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565620.5; ENST00000568007.5; ENST00000356721.3; ENST00000394725.3; ENST00000380006.2
External Link RMBase: m6A_site_320227
mod ID: M6ASITE026946 Click to Show/Hide the Full List
mod site chr16:48361435-48361436:- [7]
Sequence AAAAAGAAAGGCTGTTAAATACAGGAAACAGTTGCATGTAG
Motif Score 2.110482143
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000568007.5; ENST00000394725.3; ENST00000356721.3; ENST00000380006.2; ENST00000565620.5
External Link RMBase: m6A_site_320228
mod ID: M6ASITE026947 Click to Show/Hide the Full List
mod site chr16:48361471-48361472:- [6]
Sequence TTTCGGTAGGTGGAAGCTAGACACATGAAGGTAAATAAAAA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000356721.3; ENST00000380006.2; ENST00000568007.5; ENST00000394725.3; ENST00000565620.5
External Link RMBase: m6A_site_320229
mod ID: M6ASITE026948 Click to Show/Hide the Full List
mod site chr16:48361495-48361496:- [6]
Sequence CATCTGTCTGCCAACCTAAAACTCTTTCGGTAGGTGGAAGC
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000394725.3; ENST00000356721.3; ENST00000568007.5; ENST00000380006.2; ENST00000565620.5
External Link RMBase: m6A_site_320230
mod ID: M6ASITE026949 Click to Show/Hide the Full List
mod site chr16:48361543-48361544:- [6]
Sequence TTTTCTGGCCAGTGTTTAAAACTTCAGTTTCACAGAAAATA
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565620.5; ENST00000380006.2; ENST00000394725.3; ENST00000356721.3; ENST00000568007.5
External Link RMBase: m6A_site_320233
mod ID: M6ASITE026950 Click to Show/Hide the Full List
mod site chr16:48361566-48361567:- [6]
Sequence TGTGTTGAAATGGCAATCAAACATTTTCTGGCCAGTGTTTA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000394725.3; ENST00000380006.2; ENST00000568007.5; ENST00000356721.3; ENST00000565620.5
External Link RMBase: m6A_site_320235
mod ID: M6ASITE026951 Click to Show/Hide the Full List
mod site chr16:48361649-48361650:- [7]
Sequence TAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTT
Motif Score 2.859755952
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000565620.5; ENST00000356721.3; ENST00000568007.5; ENST00000394725.3; ENST00000380006.2
External Link RMBase: m6A_site_320236
mod ID: M6ASITE026952 Click to Show/Hide the Full List
mod site chr16:48361683-48361684:- [4]
Sequence CTATTCATGAAGGAATTGCAACAGCCATTATGAATAGCGAC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T; CD8T
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000356721.3; ENST00000380006.2; ENST00000394725.3; ENST00000568007.5; ENST00000565620.5
External Link RMBase: m6A_site_320239
mod ID: M6ASITE026953 Click to Show/Hide the Full List
mod site chr16:48361788-48361789:- [6]
Sequence CAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAAT
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; brain; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000568007.5; ENST00000356721.3; ENST00000380006.2; ENST00000565620.5; ENST00000394725.3
External Link RMBase: m6A_site_320240
mod ID: M6ASITE026954 Click to Show/Hide the Full List
mod site chr16:48361801-48361802:- [7]
Sequence CAGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAA
Motif Score 2.856142857
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000380006.2; ENST00000394725.3; ENST00000356721.3; ENST00000568007.5
External Link RMBase: m6A_site_320241
mod ID: M6ASITE026955 Click to Show/Hide the Full List
mod site chr16:48361843-48361844:- [6]
Sequence TTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; brain; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List ENST00000356721.3; ENST00000394725.3; ENST00000568007.5; ENST00000380006.2
External Link RMBase: m6A_site_320244
mod ID: M6ASITE026956 Click to Show/Hide the Full List
mod site chr16:48361922-48361923:- [6]
Sequence TATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000394725.3; ENST00000568007.5
External Link RMBase: m6A_site_320250
mod ID: M6ASITE026957 Click to Show/Hide the Full List
mod site chr16:48361962-48361963:- [4]
Sequence TGCATCAGCATAAGTCCATTACAACCCTACAGGGAGAGGAT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000568007.5; ENST00000394725.3
External Link RMBase: m6A_site_320252
mod ID: M6ASITE026958 Click to Show/Hide the Full List
mod site chr16:48362081-48362082:- [6]
Sequence GCCACACACAGAAAAAGCAGACCATGAAGAGCTCTGTGAGT
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000568007.5; ENST00000380006.2; ENST00000394725.3; ENST00000356721.3
External Link RMBase: m6A_site_320258
mod ID: M6ASITE026959 Click to Show/Hide the Full List
mod site chr16:48362098-48362099:- [4]
Sequence GGATGTGAAATAACTCTGCCACACACAGAAAAAGCAGACCA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000394725.3; ENST00000380006.2; ENST00000356721.3; ENST00000568007.5
External Link RMBase: m6A_site_320259
mod ID: M6ASITE026960 Click to Show/Hide the Full List
mod site chr16:48362220-48362221:- [7]
Sequence GCAACTGTCGCCCAAAGCTCACATGTTGTCCAACTTGCCGG
Motif Score 2.047297619
Cell/Tissue List HEK293; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000568007.5; ENST00000394725.3; ENST00000563745.1; ENST00000356721.3; ENST00000380006.2
External Link RMBase: m6A_site_320263
mod ID: M6ASITE026961 Click to Show/Hide the Full List
mod site chr16:48362333-48362334:- [4]
Sequence GACTGGCACAACTGCATCCAACAATGACTTGGCGAGTCTTT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000563745.1; ENST00000568007.5; ENST00000356721.3; ENST00000394725.3; ENST00000380006.2
External Link RMBase: m6A_site_320269
mod ID: M6ASITE026962 Click to Show/Hide the Full List
mod site chr16:48362346-48362347:- [4]
Sequence GGGTGCCTGCCCTGACTGGCACAACTGCATCCAACAATGAC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000568007.5; ENST00000380006.2; ENST00000394725.3; ENST00000563745.1; ENST00000356721.3
External Link RMBase: m6A_site_320270
mod ID: M6ASITE026963 Click to Show/Hide the Full List
mod site chr16:48362409-48362410:- [7]
Sequence AAATGAGCCGTCAGACTGCTACAGCATTACCTACCGGTACC
Motif Score 2.078666667
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000563745.1; ENST00000394725.3; ENST00000568007.5; ENST00000356721.3; ENST00000380006.2
External Link RMBase: m6A_site_320272
mod ID: M6ASITE026964 Click to Show/Hide the Full List
mod site chr16:48362415-48362416:- [6]
Sequence TTTCAGAAATGAGCCGTCAGACTGCTACAGCATTACCTACC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380006.2; ENST00000563745.1; ENST00000356721.3; ENST00000568007.5; ENST00000394725.3
External Link RMBase: m6A_site_320273
mod ID: M6ASITE026965 Click to Show/Hide the Full List
mod site chr16:48362496-48362497:- [6]
Sequence AAAGGACTTATGGCATGTAAACATTATTTATAAAGTAAGTC
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; GM12878; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000394725.3; ENST00000568007.5; ENST00000356721.3; ENST00000380006.2; ENST00000563745.1
External Link RMBase: m6A_site_320274
mod ID: M6ASITE026966 Click to Show/Hide the Full List
mod site chr16:48362511-48362512:- [6]
Sequence TTGTATGAAACTTTAAAAGGACTTATGGCATGTAAACATTA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; GM12878; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000356721.3; ENST00000380006.2; ENST00000568007.5; ENST00000394725.3; ENST00000563745.1
External Link RMBase: m6A_site_320275
mod ID: M6ASITE026967 Click to Show/Hide the Full List
mod site chr16:48362522-48362523:- [6]
Sequence CTCAGTAAATTTTGTATGAAACTTTAAAAGGACTTATGGCA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; GM12878; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000356721.3; ENST00000568007.5; ENST00000394725.3; ENST00000563745.1; ENST00000380006.2
External Link RMBase: m6A_site_320276
mod ID: M6ASITE026968 Click to Show/Hide the Full List
mod site chr16:48362651-48362652:- [8]
Sequence AGTTCCACATGTTTTCCGGAACATTTTGAAAAGAGAGCTTA
Motif Score 2.951386905
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000394725.3; ENST00000380006.2; ENST00000563745.1; ENST00000356721.3; ENST00000568007.5
External Link RMBase: m6A_site_320277
mod ID: M6ASITE026969 Click to Show/Hide the Full List
mod site chr16:48362767-48362768:- [8]
Sequence AGCAAAACGGATTCGATTAAACTTCAGTTCCTTGTATAGTT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000380006.2; ENST00000356721.3; ENST00000394725.3; ENST00000568007.5; ENST00000563745.1
External Link RMBase: m6A_site_320285
mod ID: M6ASITE026970 Click to Show/Hide the Full List
mod site chr16:48362905-48362906:- [9]
Sequence GGTGAAGTCCTCGGATGCAGACCGTGTGGATACAGAGTGCC
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000394725.3; ENST00000380006.2; ENST00000563745.1; ENST00000356721.3; ENST00000568007.5
External Link RMBase: m6A_site_320288
mod ID: M6ASITE026971 Click to Show/Hide the Full List
mod site chr16:48362986-48362987:- [9]
Sequence TATGTAAATAGTTGTTATAGACTGTATTTTAAAAATTTTGT
Motif Score 3.319380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000563745.1; ENST00000394725.3; ENST00000568007.5; ENST00000380006.2; ENST00000356721.3
External Link RMBase: m6A_site_320290
mod ID: M6ASITE026972 Click to Show/Hide the Full List
mod site chr16:48363010-48363011:- [9]
Sequence GATTACTTAATACAATGTAAACAATATGTAAATAGTTGTTA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000380006.2; ENST00000568007.5; ENST00000394725.3; ENST00000356721.3; ENST00000563745.1
External Link RMBase: m6A_site_320291
mod ID: M6ASITE026973 Click to Show/Hide the Full List
mod site chr16:48365401-48365402:- [6]
Sequence CATGTTTACCAGCGGCCAGGACAAGGAAGAGAAAAGGTATT
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000568007.5; ENST00000356721.3; ENST00000573005.1; ENST00000394725.3; ENST00000563745.1
External Link RMBase: m6A_site_320292
mod ID: M6ASITE026974 Click to Show/Hide the Full List
mod site chr16:48365727-48365728:- [10]
Sequence AGCTTAGGGCACATTGGAGGACAGCGCAGCTGTGGCTCCCA
Motif Score 3.643047619
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000563745.1; ENST00000356721.3; ENST00000394725.3; ENST00000568007.5
External Link RMBase: m6A_site_320293
mod ID: M6ASITE026975 Click to Show/Hide the Full List
mod site chr16:48385234-48385235:- [6]
Sequence CGGAGCGCGTTGGTGCCAGGACCGGGGTCCGAGGCGCGCTC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000563745.1; ENST00000568007.5; ENST00000394725.3
External Link RMBase: m6A_site_320294