m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00386)
Target Name Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon)
Synonyms
Rubicon; Beclin-1 associated RUN domain containing protein; Baron; KIAA0226
    Click to Show/Hide
Gene Name RUBCN
Chromosomal Location 3q29
Function
Inhibits PIK3C3 activity; under basal conditions negatively regulates PI3K complex II (PI3KC3-C2) function in autophagy. Negatively regulates endosome maturation and degradative endocytic trafficking and impairs autophagosome maturation process. Can sequester UVRAG from association with a class C Vps complex (possibly the HOPS complex) and negatively regulates Rab7 activation; Involved in regulation of pathogen-specific host defense of activated macrophages. Following bacterial infection promotes NADH oxidase activity by association with CYBA thereby affecting TLR2 signaling and probably other TLR-NOX pathways. Stabilizes the CYBA:CYBB NADPH oxidase heterodimer, increases its association with TLR2 and its phagosome trafficking to induce antimicrobial burst of ROS and production of inflammatory cytokines . Following fungal or viral infection (implicating CLEC7A (dectin-1)-mediated myeloid cell activation or DDX58/RIG-I-dependent sensing of RNA viruses) negatively regulates pro-inflammatory cytokine production by association with CARD9 and sequestering it from signaling complexes.
    Click to Show/Hide
Gene ID 9711
Uniprot ID
RUBIC_HUMAN
HGNC ID
HGNC:28991
KEGG ID
hsa:9711
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
RUBCN can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
 GSE167075
Regulation
logFC: 6.54E-01
p-value: 1.80E-06
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The upregulation of METTL3 and YTHDF1 induced by lipotoxicity contributes to the elevated expression level of Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon) in an m6A-dependent manner, which inhibits the fusion of autophagosomes and lysosomes and further suppresses the clearance of LDs via lysosomes in nonalcoholic fatty liver disease.
Target Regulation Up regulation
Responsed Disease Non-alcoholic fatty liver disease ICD-11: DB92
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model AML12 Normal Mus musculus CVCL_0140
Hepa 1-6 Hepatocellular carcinoma of the mouse Mus musculus CVCL_0327
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model All mice were housed in specific pathogen-free conditions in the animal facility with constant temperature and humidity under a 12-h light/12-h dark cycle, with free access to water and food. After a week of adaptation, they were then divided into two groups randomly and fed with a HFD (60 kcal% fat, D12492, Research Diets) or standard normal chow diet (CD) for 16 weeks, respectively.
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between RUBCN and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.78E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The upregulation of METTL3 and YTHDF1 induced by lipotoxicity contributes to the elevated expression level of Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon) in an m6A-dependent manner, which inhibits the fusion of autophagosomes and lysosomes and further suppresses the clearance of LDs via lysosomes in nonalcoholic fatty liver disease.
Target Regulation Up regulation
Responsed Disease Non-alcoholic fatty liver disease ICD-11: DB92
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model AML12 Normal Mus musculus CVCL_0140
Hepa 1-6 Hepatocellular carcinoma of the mouse Mus musculus CVCL_0327
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model All mice were housed in specific pathogen-free conditions in the animal facility with constant temperature and humidity under a 12-h light/12-h dark cycle, with free access to water and food. After a week of adaptation, they were then divided into two groups randomly and fed with a HFD (60 kcal% fat, D12492, Research Diets) or standard normal chow diet (CD) for 16 weeks, respectively.
Non-alcoholic fatty liver disease [ICD-11: DB92]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The upregulation of METTL3 and YTHDF1 induced by lipotoxicity contributes to the elevated expression level of Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon) in an m6A-dependent manner, which inhibits the fusion of autophagosomes and lysosomes and further suppresses the clearance of LDs via lysosomes in nonalcoholic fatty liver disease.
Responsed Disease Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model AML12 Normal Mus musculus CVCL_0140
Hepa 1-6 Hepatocellular carcinoma of the mouse Mus musculus CVCL_0327
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model All mice were housed in specific pathogen-free conditions in the animal facility with constant temperature and humidity under a 12-h light/12-h dark cycle, with free access to water and food. After a week of adaptation, they were then divided into two groups randomly and fed with a HFD (60 kcal% fat, D12492, Research Diets) or standard normal chow diet (CD) for 16 weeks, respectively.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary The upregulation of METTL3 and YTHDF1 induced by lipotoxicity contributes to the elevated expression level of Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon) in an m6A-dependent manner, which inhibits the fusion of autophagosomes and lysosomes and further suppresses the clearance of LDs via lysosomes in nonalcoholic fatty liver disease.
Responsed Disease Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model AML12 Normal Mus musculus CVCL_0140
Hepa 1-6 Hepatocellular carcinoma of the mouse Mus musculus CVCL_0327
Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model All mice were housed in specific pathogen-free conditions in the animal facility with constant temperature and humidity under a 12-h light/12-h dark cycle, with free access to water and food. After a week of adaptation, they were then divided into two groups randomly and fed with a HFD (60 kcal% fat, D12492, Research Diets) or standard normal chow diet (CD) for 16 weeks, respectively.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00386)
Beclin-1 associated RUN domain containing protein (RUBCN/Rubicon)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000080 Click to Show/Hide the Full List
mod site chr3:197701784-197701785:-
Sequence GCCCAGTTCCACATACACCCCTCCAAACAGCTATGCTCAGC
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000467303.5; ENST00000296343.10; ENST00000273582.9; ENST00000449205.1; ENST00000413360.5
External Link RMBase: ac4C_site_1435
Adenosine-to-Inosine editing (A-to-I)
In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000247 Click to Show/Hide the Full List
mod site chr3:197689055-197689056:- [2]
Sequence TTCATCCTGGGTGACAGAGCAAGACCCTGTCTCAAAAAAAA
Transcript ID List ENST00000471364.1; ENST00000413360.5; ENST00000273582.9; ENST00000415452.5; ENST00000296343.10; rmsk_1216476
External Link RMBase: RNA-editing_site_102366
mod ID: A2ISITE000248 Click to Show/Hide the Full List
mod site chr3:197723384-197723385:- [2]
Sequence GAGACTGGCCTGGCCAACATAGTGAAACCCCGTCTCTACTA
Transcript ID List ENST00000449205.1; ENST00000474214.2; ENST00000296343.10; ENST00000467303.5; rmsk_1216552; ENST00000273582.9
External Link RMBase: RNA-editing_site_102367
mod ID: A2ISITE000249 Click to Show/Hide the Full List
mod site chr3:197725621-197725622:- [2]
Sequence GTCTGTAATCCTAGCACTTTAGGAGGCCGAGGCAGATGGTT
Transcript ID List ENST00000273582.9; rmsk_1216556; ENST00000474214.2; ENST00000467303.5; ENST00000296343.10; ENST00000449205.1
External Link RMBase: RNA-editing_site_102368
mod ID: A2ISITE000250 Click to Show/Hide the Full List
mod site chr3:197738387-197738388:- [3]
Sequence TGAAAATACCTAAAAGCCATATATTATTTTAATATAGAGTC
Transcript ID List ENST00000467303.5; ENST00000273582.9
External Link RMBase: RNA-editing_site_102369
mod ID: A2ISITE000251 Click to Show/Hide the Full List
mod site chr3:197745914-197745915:- [3]
Sequence CCTCCCCTATAGCTGAGATTACAGGTGCATGGCACCACGCC
Transcript ID List ENST00000273582.9; ENST00000467303.5
External Link RMBase: RNA-editing_site_102370
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003229 Click to Show/Hide the Full List
mod site chr3:197676742-197676743:-
Sequence AGAGGAACTGGAAAGGGCTGCTGTTCCTTAGCCTGGAGAGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000415452.5; ENST00000413360.5; ENST00000296343.10; ENST00000273582.9
External Link RMBase: m5C_site_33571
N6-methyladenosine (m6A)
In total 78 m6A sequence/site(s) in this target gene
mod ID: M6ASITE064550 Click to Show/Hide the Full List
mod site chr3:197669267-197669268:- [4]
Sequence GAAAGGATATTAGTGAAAAAACTGGCAAAATCTGAATACAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List rmsk_1216457; ENST00000296343.10
External Link RMBase: m6A_site_625265
mod ID: M6ASITE064551 Click to Show/Hide the Full List
mod site chr3:197669346-197669347:- [4]
Sequence GCCGTCACGGACGAGAGGAGACTAAGCAGATACGATGACTG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; rmsk_1216457
External Link RMBase: m6A_site_625266
mod ID: M6ASITE064552 Click to Show/Hide the Full List
mod site chr3:197671561-197671562:- [5]
Sequence TAAATTCCGTATTTCCAAAAACCTAACCATTAGTCACCCAG
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625267
mod ID: M6ASITE064553 Click to Show/Hide the Full List
mod site chr3:197671588-197671589:- [5]
Sequence CTCCAACCAGTGTGTCTAAAACCAGCATAAATTCCGTATTT
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000296343.10; rmsk_1216461; ENST00000273582.9
External Link RMBase: m6A_site_625268
mod ID: M6ASITE064554 Click to Show/Hide the Full List
mod site chr3:197672073-197672074:- [4]
Sequence GTGTGCCGCCCGTGCTCTGAACTGCGTTTCCACCTGCTGTG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625269
mod ID: M6ASITE064556 Click to Show/Hide the Full List
mod site chr3:197672203-197672204:- [4]
Sequence ACATAGCAGAAGAGTGGAAGACAAATATTTTCCACTTAAAT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625270
mod ID: M6ASITE064557 Click to Show/Hide the Full List
mod site chr3:197672259-197672260:- [6]
Sequence AGTAAAGGGAAAGAAAAAAAACATAGTTTGCTTACCAGGTG
Motif Score 2.20572619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625271
mod ID: M6ASITE064558 Click to Show/Hide the Full List
mod site chr3:197672330-197672331:- [7]
Sequence CGGGGAGAAGCTTTGAATGCACTGAAGAGAATTCCTTCTAA
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625272
mod ID: M6ASITE064559 Click to Show/Hide the Full List
mod site chr3:197672474-197672475:- [7]
Sequence CGTCTGTTTTAGTGACTCTGACACGATGCCGTCCTCACCTT
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625273
mod ID: M6ASITE064560 Click to Show/Hide the Full List
mod site chr3:197672551-197672552:- [7]
Sequence AACAGTCTCATAGGCTCCTCACTTGTCACTTATTTTTCCCT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625274
mod ID: M6ASITE064561 Click to Show/Hide the Full List
mod site chr3:197672570-197672571:- [7]
Sequence AGCTTCTGAAGCCGAACTCAACAGTCTCATAGGCTCCTCAC
Motif Score 2.173910714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625275
mod ID: M6ASITE064562 Click to Show/Hide the Full List
mod site chr3:197672575-197672576:- [7]
Sequence CTGACAGCTTCTGAAGCCGAACTCAACAGTCTCATAGGCTC
Motif Score 3.373380952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625276
mod ID: M6ASITE064563 Click to Show/Hide the Full List
mod site chr3:197672996-197672997:- [7]
Sequence CCAGTTTTGGTTTAAATTACACATCCAGGCCAGGCACAGTG
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625277
mod ID: M6ASITE064564 Click to Show/Hide the Full List
mod site chr3:197672998-197672999:- [7]
Sequence TTCCAGTTTTGGTTTAAATTACACATCCAGGCCAGGCACAG
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625278
mod ID: M6ASITE064565 Click to Show/Hide the Full List
mod site chr3:197673020-197673021:- [7]
Sequence AGTTTATAAAAATGAGCTCTACTTCCAGTTTTGGTTTAAAT
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625279
mod ID: M6ASITE064567 Click to Show/Hide the Full List
mod site chr3:197673271-197673272:- [4]
Sequence GTGAGAGGGAACATGTGGGAACTGGCCCCTGCCCTTGATTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625280
mod ID: M6ASITE064568 Click to Show/Hide the Full List
mod site chr3:197673281-197673282:- [4]
Sequence CTCCACCAGCGTGAGAGGGAACATGTGGGAACTGGCCCCTG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625281
mod ID: M6ASITE064569 Click to Show/Hide the Full List
mod site chr3:197673523-197673524:- [4]
Sequence AAGAGCTGGCAGCTCTGTGAACTAAAGCCTGCATCATTTTT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625282
mod ID: M6ASITE064570 Click to Show/Hide the Full List
mod site chr3:197673564-197673565:- [7]
Sequence CTTCTAACCTCTGTGAAAACACTGGTCAGAGTGGCTTCTCC
Motif Score 2.506922619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625283
mod ID: M6ASITE064571 Click to Show/Hide the Full List
mod site chr3:197673566-197673567:- [4]
Sequence AGCTTCTAACCTCTGTGAAAACACTGGTCAGAGTGGCTTCT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625284
mod ID: M6ASITE064572 Click to Show/Hide the Full List
mod site chr3:197673644-197673645:- [7]
Sequence CCCCGTTAATGTGTGTGTTGACAGTGAAGTCCTTGGGTGGG
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625285
mod ID: M6ASITE064573 Click to Show/Hide the Full List
mod site chr3:197673834-197673835:- [8]
Sequence GTCCCTGTGTTCTTGGGATAACAAGAGCCTTTATGCCAATT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625286
mod ID: M6ASITE064574 Click to Show/Hide the Full List
mod site chr3:197673879-197673880:- [7]
Sequence TAGTGCTGTTACAGAACTTGACGGTTTGTGGATGTGAGTGT
Motif Score 2.833690476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625287
mod ID: M6ASITE064575 Click to Show/Hide the Full List
mod site chr3:197673884-197673885:- [4]
Sequence GCTATTAGTGCTGTTACAGAACTTGACGGTTTGTGGATGTG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625288
mod ID: M6ASITE064576 Click to Show/Hide the Full List
mod site chr3:197674092-197674093:- [4]
Sequence ATCCTAAGGTGAGGACAGGAACCTCACCCACCATCTTCTTA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000413360.5; ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625289
mod ID: M6ASITE064578 Click to Show/Hide the Full List
mod site chr3:197674098-197674099:- [4]
Sequence GATGCCATCCTAAGGTGAGGACAGGAACCTCACCCACCATC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000413360.5; ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625290
mod ID: M6ASITE064579 Click to Show/Hide the Full List
mod site chr3:197674215-197674216:- [7]
Sequence CTGTCGCTGAAGGAGCGCTTACTCAGAGGAGCGGTCGGCCC
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9
External Link RMBase: m6A_site_625291
mod ID: M6ASITE064580 Click to Show/Hide the Full List
mod site chr3:197674264-197674265:- [7]
Sequence CCAGGCTCACCTGTAGCCTTACGCCGCAAGCATACGTGAGG
Motif Score 2.046785714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9
External Link RMBase: m6A_site_625292
mod ID: M6ASITE064581 Click to Show/Hide the Full List
mod site chr3:197674276-197674277:- [7]
Sequence CTGATGCTCAGGCCAGGCTCACCTGTAGCCTTACGCCGCAA
Motif Score 2.026654762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625293
mod ID: M6ASITE064582 Click to Show/Hide the Full List
mod site chr3:197674297-197674298:- [4]
Sequence ATCTTGAAGCAAAGAACAGAACTGATGCTCAGGCCAGGCTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9
External Link RMBase: m6A_site_625294
mod ID: M6ASITE064583 Click to Show/Hide the Full List
mod site chr3:197674302-197674303:- [4]
Sequence TGGTGATCTTGAAGCAAAGAACAGAACTGATGCTCAGGCCA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625295
mod ID: M6ASITE064584 Click to Show/Hide the Full List
mod site chr3:197674422-197674423:- [4]
Sequence CTATCCTAGACTCCTCAGAGACCTCAGAGGCAGCTGTGAAT
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9
External Link RMBase: m6A_site_625296
mod ID: M6ASITE064585 Click to Show/Hide the Full List
mod site chr3:197674433-197674434:- [4]
Sequence AACAATCCTGACTATCCTAGACTCCTCAGAGACCTCAGAGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000413360.5; ENST00000273582.9; ENST00000296343.10
External Link RMBase: m6A_site_625297
mod ID: M6ASITE064586 Click to Show/Hide the Full List
mod site chr3:197674443-197674444:- [9]
Sequence GGGGCCACAGAACAATCCTGACTATCCTAGACTCCTCAGAG
Motif Score 3.28175
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625298
mod ID: M6ASITE064587 Click to Show/Hide the Full List
mod site chr3:197674452-197674453:- [4]
Sequence GGTATTTTGGGGGCCACAGAACAATCCTGACTATCCTAGAC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000296343.10; ENST00000273582.9; ENST00000413360.5
External Link RMBase: m6A_site_625299
mod ID: M6ASITE064589 Click to Show/Hide the Full List
mod site chr3:197674504-197674505:- [4]
Sequence GAGAAGCAGCAGAGAATAGGACTACGTCATGGGCATTTCGT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000401223.1; MIMAT0004972; ENST00000273582.9; ENST00000296343.10; ENST00000413360.5
External Link RMBase: m6A_site_625300
mod ID: M6ASITE064590 Click to Show/Hide the Full List
mod site chr3:197674537-197674538:- [4]
Sequence CTGTCCTGGACTGGGGTCAGACTGTGCCCCGAGGAGAAGCA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9; ENST00000401223.1
External Link RMBase: m6A_site_625301
mod ID: M6ASITE064591 Click to Show/Hide the Full List
mod site chr3:197674548-197674549:- [4]
Sequence TTTCCCTCTCCCTGTCCTGGACTGGGGTCAGACTGTGCCCC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000273582.9; ENST00000401223.1
External Link RMBase: m6A_site_625302
mod ID: M6ASITE064592 Click to Show/Hide the Full List
mod site chr3:197674716-197674717:- [4]
Sequence TCAGTGGAAGAGACAGCAAGACCAAGTTCTTCCAGCGTCTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; HepG2; A549; GM12878; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625303
mod ID: M6ASITE064593 Click to Show/Hide the Full List
mod site chr3:197674724-197674725:- [4]
Sequence TGCCTCTGTCAGTGGAAGAGACAGCAAGACCAAGTTCTTCC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; HepG2; A549; GM12878; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9; ENST00000413360.5
External Link RMBase: m6A_site_625304
mod ID: M6ASITE064594 Click to Show/Hide the Full List
mod site chr3:197674777-197674778:- [4]
Sequence CACCAGGTGTTTCCATCAGAACTGACATGCGGGTCCTTCAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; A549; GM12878; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9; ENST00000413360.5
External Link RMBase: m6A_site_625305
mod ID: M6ASITE064595 Click to Show/Hide the Full List
mod site chr3:197674798-197674799:- [4]
Sequence TGGTGACAGATAATTTGTAAACACCAGGTGTTTCCATCAGA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; A549; GM12878
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625306
mod ID: M6ASITE064596 Click to Show/Hide the Full List
mod site chr3:197674813-197674814:- [7]
Sequence TGGGTCCAGAGTCTGTGGTGACAGATAATTTGTAAACACCA
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10; ENST00000413360.5
External Link RMBase: m6A_site_625307
mod ID: M6ASITE064597 Click to Show/Hide the Full List
mod site chr3:197674947-197674948:- [4]
Sequence ACTGAGCCACTCTTTGAAGGACTCGCCCCACCTGGGGCTTC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; GM12878; LCLs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10; ENST00000413360.5
External Link RMBase: m6A_site_625308
mod ID: M6ASITE064598 Click to Show/Hide the Full List
mod site chr3:197674967-197674968:- [4]
Sequence CGGGTCACACCTGTTGCAGAACTGAGCCACTCTTTGAAGGA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; GM12878; LCLs; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625309
mod ID: M6ASITE064600 Click to Show/Hide the Full List
mod site chr3:197675078-197675079:- [4]
Sequence CCTGGAGTCTTACCTGTCAGACTACGAGGAGGAGCCCGCGG
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; A549; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10; ENST00000413360.5
External Link RMBase: m6A_site_625310
mod ID: M6ASITE064601 Click to Show/Hide the Full List
mod site chr3:197676993-197676994:- [10]
Sequence CCCAGGCCACCTGACAGAGGACCTCCACCTGTACTCACTGA
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000413360.5; ENST00000273582.9; ENST00000296343.10; ENST00000415452.5
External Link RMBase: m6A_site_625311
mod ID: M6ASITE064602 Click to Show/Hide the Full List
mod site chr3:197681222-197681223:- [4]
Sequence CGTCAGCAACTTCTCCAAGGACCTGCTCATTAAGATCTGGA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000413360.5; ENST00000273582.9; ENST00000415452.5; ENST00000296343.10
External Link RMBase: m6A_site_625312
mod ID: M6ASITE064603 Click to Show/Hide the Full List
mod site chr3:197681258-197681259:- [4]
Sequence CCGGGTTCTGCGCAAGTGGGACTTCAGCAAGTACTACGTCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000413360.5; ENST00000415452.5; ENST00000273582.9
External Link RMBase: m6A_site_625313
mod ID: M6ASITE064604 Click to Show/Hide the Full List
mod site chr3:197684198-197684199:- [4]
Sequence AGATGCTGACATCAGAAGGAACACAGCCTCAAGCAGCAAAT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000471364.1; ENST00000413360.5; ENST00000415452.5; ENST00000296343.10
External Link RMBase: m6A_site_625314
mod ID: M6ASITE064605 Click to Show/Hide the Full List
mod site chr3:197691104-197691105:- [4]
Sequence ACTCACATATCAAAGAACGGACTGTCAGTGTCACTGGCCTC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000296343.10; ENST00000415452.5; ENST00000413360.5; ENST00000471364.1
External Link RMBase: m6A_site_625315
mod ID: M6ASITE064606 Click to Show/Hide the Full List
mod site chr3:197695893-197695894:- [4]
Sequence CAGCTACCTCTCTGAGCAAGACTTCGGCAGCTGTGCCGACC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000415452.5; ENST00000447048.1; ENST00000273582.9; ENST00000413360.5; ENST00000296343.10
External Link RMBase: m6A_site_625316
mod ID: M6ASITE064607 Click to Show/Hide the Full List
mod site chr3:197695925-197695926:- [4]
Sequence TTCCGAAGACCATCAGAAGGACAGTCCCTCATCAGCTACCT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000447048.1; ENST00000413360.5; ENST00000273582.9; ENST00000415452.5; ENST00000296343.10
External Link RMBase: m6A_site_625317
mod ID: M6ASITE064608 Click to Show/Hide the Full List
mod site chr3:197695937-197695938:- [4]
Sequence GGGGAAGGCATGTTCCGAAGACCATCAGAAGGACAGTCCCT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000447048.1; ENST00000413360.5; ENST00000273582.9; ENST00000415452.5
External Link RMBase: m6A_site_625318
mod ID: M6ASITE064609 Click to Show/Hide the Full List
mod site chr3:197696964-197696965:- [8]
Sequence CAGCACACCCAGCTCTCTGTACATGGAATATGGTGAGTACT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000296343.10; ENST00000415452.5; ENST00000413360.5; ENST00000447048.1; ENST00000273582.9
External Link RMBase: m6A_site_625319
mod ID: M6ASITE064611 Click to Show/Hide the Full List
mod site chr3:197700693-197700694:- [4]
Sequence CCAGCTTCTCAGAGGGGCAGACACTCACTGTCACCAGTGGG
Motif Score 2.897386905
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000296343.10; ENST00000273582.9; ENST00000413360.5; ENST00000447048.1; ENST00000415452.5; ENST00000449205.1
External Link RMBase: m6A_site_625320
mod ID: M6ASITE064612 Click to Show/Hide the Full List
mod site chr3:197700761-197700762:- [4]
Sequence TGCTGCCTCTTCCTTAGGGGACCAGGAAGGAGGTGGGGAGA
Motif Score 3.622404762
Cell/Tissue List HeLa; Jurkat; CD4T; peripheral-blood; MSC; iSLK; endometrial; HEC-1-A; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000415452.5; ENST00000413360.5; ENST00000296343.10; ENST00000449205.1; ENST00000447048.1
External Link RMBase: m6A_site_625321
mod ID: M6ASITE064613 Click to Show/Hide the Full List
mod site chr3:197700867-197700868:- [4]
Sequence ACTTGGACCCCCGAGGCCGGACTGCCAGCTGTCAGAGTCAC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; H1B; fibroblasts; A549; GM12878; LCLs; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000296343.10; ENST00000415452.5; ENST00000449205.1; ENST00000413360.5; ENST00000273582.9
External Link RMBase: m6A_site_625322
mod ID: M6ASITE064614 Click to Show/Hide the Full List
mod site chr3:197700881-197700882:- [4]
Sequence CCTGGCCATTGGCAACTTGGACCCCCGAGGCCGGACTGCCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; H1B; fibroblasts; A549; GM12878; LCLs; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000415452.5; ENST00000273582.9; ENST00000413360.5; ENST00000296343.10; ENST00000449205.1
External Link RMBase: m6A_site_625323
mod ID: M6ASITE064615 Click to Show/Hide the Full List
mod site chr3:197701059-197701060:- [4]
Sequence TCTCACCAGCAGAGGATCAAACCATCCAAGCCCCCCCAGTT
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000413360.5; ENST00000449205.1; ENST00000273582.9; ENST00000296343.10; ENST00000415452.5
External Link RMBase: m6A_site_625324
mod ID: M6ASITE064616 Click to Show/Hide the Full List
mod site chr3:197701102-197701103:- [4]
Sequence CTCTCTGGCCCTCCCCGGAAACCTCAAGAAAGCAGAGGGCA
Motif Score 2.185083333
Cell/Tissue List HeLa; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000449205.1; ENST00000413360.5; ENST00000415452.5; ENST00000296343.10; ENST00000273582.9
External Link RMBase: m6A_site_625325
mod ID: M6ASITE064617 Click to Show/Hide the Full List
mod site chr3:197701778-197701779:- [4]
Sequence TTCCACATACACCCCTCCAAACAGCTATGCTCAGCATTCCT
Motif Score 2.20572619
Cell/Tissue List HeLa; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000273582.9; ENST00000449205.1; ENST00000413360.5; ENST00000467303.5; ENST00000296343.10
External Link RMBase: m6A_site_625326
mod ID: M6ASITE064618 Click to Show/Hide the Full List
mod site chr3:197703584-197703585:- [4]
Sequence CCTGGAAGCAGTGGAACAGAACAACCCCCGCCTCCTGGCTC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000449205.1; ENST00000467303.5; ENST00000413360.5; ENST00000296343.10; ENST00000273582.9; ENST00000474214.2
External Link RMBase: m6A_site_625327
mod ID: M6ASITE064619 Click to Show/Hide the Full List
mod site chr3:197703589-197703590:- [4]
Sequence CAGTGCCTGGAAGCAGTGGAACAGAACAACCCCCGCCTCCT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000449205.1; ENST00000296343.10; ENST00000273582.9; ENST00000413360.5; ENST00000474214.2; ENST00000467303.5
External Link RMBase: m6A_site_625328
mod ID: M6ASITE064620 Click to Show/Hide the Full List
mod site chr3:197718016-197718017:- [4]
Sequence CTTGGAGCGGCTTTGCAGGGACATGCAGAGCATCCTCTATC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000449205.1; ENST00000413360.5; ENST00000296343.10; ENST00000273582.9; ENST00000474214.2; ENST00000467303.5
External Link RMBase: m6A_site_625329
mod ID: M6ASITE064622 Click to Show/Hide the Full List
mod site chr3:197748234-197748235:- [11]
Sequence GACTGCTAAAAACTAGAGAAACTGGCTCACGCCTGTCATCC
Motif Score 2.627720238
Cell/Tissue List GM12878; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000472149.1; ENST00000467303.5; ENST00000273582.9
External Link RMBase: m6A_site_625331
mod ID: M6ASITE064623 Click to Show/Hide the Full List
mod site chr3:197748243-197748244:- [11]
Sequence ATTTGTCTGGACTGCTAAAAACTAGAGAAACTGGCTCACGC
Motif Score 2.627720238
Cell/Tissue List GM12878; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000472149.1; ENST00000467303.5; ENST00000273582.9
External Link RMBase: m6A_site_625332
mod ID: M6ASITE064624 Click to Show/Hide the Full List
mod site chr3:197748253-197748254:- [11]
Sequence AAGCCCCTTCATTTGTCTGGACTGCTAAAAACTAGAGAAAC
Motif Score 4.065041667
Cell/Tissue List GM12878; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000467303.5; ENST00000472149.1; ENST00000273582.9
External Link RMBase: m6A_site_625333
mod ID: M6ASITE064625 Click to Show/Hide the Full List
mod site chr3:197748351-197748352:- [12]
Sequence TTGGACTCGGAAACTCAAGAACAATATTTGGCATGTCAAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; GM12878
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000273582.9; ENST00000472149.1; ENST00000467303.5
External Link RMBase: m6A_site_625334
mod ID: M6ASITE064626 Click to Show/Hide the Full List
mod site chr3:197748359-197748360:- [12]
Sequence AGGAAAGTTTGGACTCGGAAACTCAAGAACAATATTTGGCA
Motif Score 2.627720238
Cell/Tissue List HeLa; GM12878
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000273582.9; ENST00000472149.1; ENST00000467303.5
External Link RMBase: m6A_site_625335
mod ID: M6ASITE064627 Click to Show/Hide the Full List
mod site chr3:197748367-197748368:- [12]
Sequence AATAGTGGAGGAAAGTTTGGACTCGGAAACTCAAGAACAAT
Motif Score 4.065041667
Cell/Tissue List HeLa; GM12878
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000273582.9; ENST00000467303.5; ENST00000472149.1
External Link RMBase: m6A_site_625336
mod ID: M6ASITE064628 Click to Show/Hide the Full List
mod site chr3:197748392-197748393:- [12]
Sequence CCTATCAAGGGGCACAAGAAACTTTAATAGTGGAGGAAAGT
Motif Score 2.627720238
Cell/Tissue List HeLa; GM12878
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000467303.5; ENST00000472149.1; ENST00000273582.9
External Link RMBase: m6A_site_625337
mod ID: M6ASITE064629 Click to Show/Hide the Full List
mod site chr3:197748420-197748421:- [11]
Sequence TAACAATATAGGAAGAGTGAACCACACACCTATCAAGGGGC
Motif Score 2.930744048
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000467303.5; ENST00000273582.9; ENST00000472149.1
External Link RMBase: m6A_site_625338
mod ID: M6ASITE064630 Click to Show/Hide the Full List
mod site chr3:197749289-197749290:- [11]
Sequence GTGTTCACTACCCTAATAAGACCTCAGCTTCCCTCGGGAGG
Motif Score 2.876744048
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000472149.1; ENST00000467303.5; ENST00000273582.9
External Link RMBase: m6A_site_625339
mod ID: M6ASITE064632 Click to Show/Hide the Full List
mod site chr3:197749321-197749322:- [11]
Sequence TCTCAATCGGCACTCTCAAAACATCTGGCACGGTGTTCACT
Motif Score 2.20572619
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000472149.1; ENST00000467303.5
External Link RMBase: m6A_site_625340
mod ID: M6ASITE064633 Click to Show/Hide the Full List
mod site chr3:197749519-197749520:- [11]
Sequence ACGCAGCCTCGGGAGGCAGGACAGACCCCTGCGAGTGTAGA
Motif Score 3.643047619
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000467303.5
External Link RMBase: m6A_site_625341
mod ID: M6ASITE064634 Click to Show/Hide the Full List
mod site chr3:197749587-197749588:- [11]
Sequence TCGAGTCCCTCCTGCTGCAGACAGGTCCCCTATACTTCGGT
Motif Score 2.897386905
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000467303.5; ENST00000273582.9
External Link RMBase: m6A_site_625342
mod ID: M6ASITE064635 Click to Show/Hide the Full List
mod site chr3:197749660-197749661:- [11]
Sequence CCCAAACTGGGGGATGCTAGACCGCGGGCACCTCTGAATCT
Motif Score 2.876744048
Cell/Tissue List GM12878; Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000273582.9; ENST00000467303.5
External Link RMBase: m6A_site_625343