m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00376)

Target Name	Parathyroid hormone 1 receptor (PTH1R)
Synonyms	PTH/PTHrP type I receptor; PTH/PTHr receptor; Parathyroid hormone 1 receptor; PTH1 receptor; PTHR; PTHR1 Click to Show/Hide
Gene Name	PTH1R
Chromosomal Location	3p21.31
Family	G-protein coupled receptor 2 family
Function	Receptor for parathyroid hormone and for parathyroid hormone-related peptide. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Click to Show/Hide
Gene ID	5745
Uniprot ID	PTH1R_HUMAN
HGNC ID	HGNC:9608
KEGG ID	hsa:5745

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PTH1R can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -1.67E+00 p-value: 4.51E-08
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between PTH1R and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 6.67E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	Knockout of Mettl3 reduces the translation efficiency of MSCs lineage allocator Parathyroid hormone 1 receptor (PTH1R), and disrupts the PTH-induced osteogenic and adipogenic responses in vivo.
Target Regulation	Up regulation
Responsed Disease	Osteoporosis	ICD-11: FB83.1	Disease Info
Pathway Response	Parathyroid hormone synthesis, secretion and action		hsa04928
Cell Process	Adipogenesis
In-vivo Model	Mettl3^fl/+ mice with C57BL6/J background were generated using CRISPR-Cas9 systems.

Low bone mass disorder [ICD-11: FB83]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	Knockout of Mettl3 reduces the translation efficiency of MSCs lineage allocator Parathyroid hormone 1 receptor (PTH1R), and disrupts the PTH-induced osteogenic and adipogenic responses in vivo.
Responsed Disease	Osteoporosis [ICD-11: FB83.1]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Parathyroid hormone synthesis, secretion and action		hsa04928
Cell Process	Adipogenesis
In-vivo Model	Mettl3^fl/+ mice with C57BL6/J background were generated using CRISPR-Cas9 systems.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00376)

Parathyroid hormone 1 receptor (PTH1R)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011709		Click to Show/Hide the Full List
mod site	chr3:46884655-46884656:+		[2]
Sequence	AGTGGGGGTATCTGCCTGCTAGAGAGCAGGGCAGTCAGGCA
Transcript ID List	ENST00000428220.1; ENST00000313049.9; ENST00000449590.6; ENST00000418619.5; ENST00000430002.6; ENST00000427125.6
External Link	RMBase: RNA-editing_site_96300

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE060500		Click to Show/Hide the Full List
mod site	chr3:46895763-46895764:+		[3]
Sequence	TGGAATCAGACAAGGGATGGACATCTGCGTCCACATCAGGG
Motif Score	3.643047619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000427125.6; ENST00000430002.6; ENST00000313049.9; ENST00000449590.6; ENST00000418619.5; ENST00000490109.1; ENST00000428220.1
External Link	RMBase: m6A_site_586830
mod ID: M6ASITE060501		Click to Show/Hide the Full List
mod site	chr3:46898180-46898181:+		[4]
Sequence	TCAAATTTCTCACCAATGAGACTCGTGAACGGGTGCGAGCC
Motif Score	3.319380952
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000313049.9; ENST00000427125.6; ENST00000418619.5; ENST00000428220.1; ENST00000430002.6; ENST00000449590.6; ENST00000490109.1
External Link	RMBase: m6A_site_586831
mod ID: M6ASITE060502		Click to Show/Hide the Full List
mod site	chr3:46903271-46903272:+		[3]
Sequence	CACCCTTACTGCCCCAAGGTACAAGCTGAGATCAAGAAATC
Motif Score	2.856142857
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000422115.2; ENST00000430002.6; ENST00000418619.5; ENST00000427125.6; ENST00000428220.1; ENST00000313049.9; ENST00000449590.6
External Link	RMBase: m6A_site_586832
mod ID: M6ASITE060503		Click to Show/Hide the Full List
mod site	chr3:46903305-46903306:+		[5]
Sequence	AGAAATCTTGGAGCCGCTGGACACTGGCACTGGACTTCAAG
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000428220.1; ENST00000418619.5; ENST00000427125.6; ENST00000422115.2; ENST00000313049.9; ENST00000449590.6; ENST00000430002.6
External Link	RMBase: m6A_site_586833
mod ID: M6ASITE060504		Click to Show/Hide the Full List
mod site	chr3:46903318-46903319:+		[5]
Sequence	CCGCTGGACACTGGCACTGGACTTCAAGCGAAAGGCACGCA
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000418619.5; ENST00000430002.6; ENST00000428220.1; ENST00000427125.6; ENST00000449590.6; ENST00000313049.9; ENST00000422115.2
External Link	RMBase: m6A_site_586834
mod ID: M6ASITE060505		Click to Show/Hide the Full List
mod site	chr3:46903412-46903413:+		[4]
Sequence	AATGTCGGCCCCCGTGTGGGACTCGGCCTGCCCCTCAGCCC
Motif Score	4.065041667
Cell/Tissue List	HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000449590.6; ENST00000313049.9; ENST00000427125.6; ENST00000422115.2; ENST00000418619.5; ENST00000428220.1; ENST00000430002.6
External Link	RMBase: m6A_site_586835
mod ID: M6ASITE060506		Click to Show/Hide the Full List
mod site	chr3:46903497-46903498:+		[6]
Sequence	CTGGCCATGCCAAGCCAGGGACCCCAGCCCTGGAGACCCTC
Motif Score	3.622404762
Cell/Tissue List	HEK293T; H1A; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428220.1; ENST00000418619.5; ENST00000313049.9; ENST00000449590.6; ENST00000430002.6; ENST00000422115.2
External Link	RMBase: m6A_site_586836
mod ID: M6ASITE060507		Click to Show/Hide the Full List
mod site	chr3:46903512-46903513:+		[7]
Sequence	CAGGGACCCCAGCCCTGGAGACCCTCGAGACCACACCACCT
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HeLa; H1A; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000449590.6; ENST00000428220.1; ENST00000430002.6; ENST00000418619.5; ENST00000422115.2; ENST00000313049.9
External Link	RMBase: m6A_site_586837
mod ID: M6ASITE060508		Click to Show/Hide the Full List
mod site	chr3:46903521-46903522:+		[7]
Sequence	CAGCCCTGGAGACCCTCGAGACCACACCACCTGCCATGGCT
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HeLa; H1A; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000428220.1; ENST00000422115.2; ENST00000449590.6; ENST00000430002.6; ENST00000418619.5; ENST00000313049.9
External Link	RMBase: m6A_site_586838
mod ID: M6ASITE060509		Click to Show/Hide the Full List
mod site	chr3:46903644-46903645:+		[8]
Sequence	TGCTACAGGAAGAGTGGGAGACAGTCATGTGACCAGGCGCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; hNPCs; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428220.1; ENST00000313049.9; ENST00000430002.6; ENST00000422115.2; ENST00000418619.5; ENST00000449590.6
External Link	RMBase: m6A_site_586839
mod ID: M6ASITE060510		Click to Show/Hide the Full List
mod site	chr3:46903674-46903675:+		[8]
Sequence	GACCAGGCGCTGGGGGCTGGACCTGCTGACATAGTGGATGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; hNPCs; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000449590.6; ENST00000422115.2; ENST00000430002.6; ENST00000313049.9; ENST00000418619.5; ENST00000428220.1
External Link	RMBase: m6A_site_586840
mod ID: M6ASITE060511		Click to Show/Hide the Full List
mod site	chr3:46903695-46903696:+		[8]
Sequence	CCTGCTGACATAGTGGATGGACAGATGGACCAAAAGATGGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; hNPCs; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000430002.6; ENST00000449590.6; ENST00000428220.1; ENST00000422115.2; ENST00000418619.5; ENST00000313049.9
External Link	RMBase: m6A_site_586841
mod ID: M6ASITE060512		Click to Show/Hide the Full List
mod site	chr3:46903703-46903704:+		[8]
Sequence	CATAGTGGATGGACAGATGGACCAAAAGATGGGTGGTTGAA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; H1A; H1B; hNPCs; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000430002.6; ENST00000449590.6; ENST00000428220.1; ENST00000418619.5; ENST00000422115.2; ENST00000313049.9
External Link	RMBase: m6A_site_586842
mod ID: M6ASITE060513		Click to Show/Hide the Full List
mod site	chr3:46903759-46903760:+		[8]
Sequence	GGCTGGGGCCAAGAGGAAAAACAGGGAAAAAAAGAAAAAAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; HEK293T; H1A; H1B; hNPCs; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000422115.2; ENST00000313049.9; ENST00000418619.5; ENST00000449590.6; ENST00000428220.1
External Link	RMBase: m6A_site_586843

Ref 1	Mettl3-mediated m(6)A RNA methylation regulates the fate of bone marrow mesenchymal stem cells and osteoporosis. Nat Commun. 2018 Nov 14;9(1):4772. doi: 10.1038/s41467-018-06898-4.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 4	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 7	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 8	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map