m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00366)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PHLPP2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
|
Treatment: METTL3 knockdown MDA-MB-231 cells
Control: MDA-MB-231 cells
|
GSE70061 | |
| Regulation |
![]() ![]() |
logFC: 7.59E-01 p-value: 9.18E-03 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between PHLPP2 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 1.40E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | About 70% of endometrial tumours exhibit reductions in m6A methylation that are probably due to either this METTL14 mutation or reduced expression of METTL3. Reductions in m6A methylation lead to decreased expression of the negative AKT regulator PHLPP-like (PHLPP2) and increased expression of the positive AKT regulator mTORC2. these results reveal reduced m6A mRNA methylation as an oncogenic mechanism in endometrial cancer and identify m6A methylation as a regulator of AKT signalling. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Endometrial cancer | ICD-11: 2C76 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell proliferation and tumorigenicity | |||
| In-vitro Model | HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 |
| RL95-2 | Endometrial adenosquamous carcinoma | Homo sapiens | CVCL_0505 | |
| T HESCs | Normal | Homo sapiens | CVCL_C464 | |
| In-vivo Model | 4×106 HEC-1-A endometrial cancer cells (shCtrl, shMETTL3, wild-type, METTL14+/-, or METTL14+/- rescued with wild-type or mutant METTL14) were injected intraperitoneally into 5 week old female athymic nude mice (Foxn1nu, Harlan; n=10 per group). | |||
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
|
Treatment: siMETTL14 MDA-MB-231 cells
Control: MDA-MB-231 cells
|
GSE81164 | |
| Regulation |
![]() ![]() |
logFC: 9.41E-01 p-value: 4.99E-14 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | About 70% of endometrial tumours exhibit reductions in m6A methylation that are probably due to either this METTL14 mutation or reduced expression of METTL3. Reductions in m6A methylation lead to decreased expression of the negative AKT regulator PHLPP-like (PHLPP2) and increased expression of the positive AKT regulator mTORC2. these results reveal reduced m6A mRNA methylation as an oncogenic mechanism in endometrial cancer and identify m6A methylation as a regulator of AKT signalling. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Endometrial cancer | ICD-11: 2C76 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell proliferation and tumorigenicity | |||
| In-vitro Model | HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 |
| RL95-2 | Endometrial adenosquamous carcinoma | Homo sapiens | CVCL_0505 | |
| T HESCs | Normal | Homo sapiens | CVCL_C464 | |
| In-vivo Model | 4×106 HEC-1-A endometrial cancer cells (shCtrl, shMETTL3, wild-type, METTL14+/-, or METTL14+/- rescued with wild-type or mutant METTL14) were injected intraperitoneally into 5 week old female athymic nude mice (Foxn1nu, Harlan; n=10 per group). | |||
Endometrial cancer [ICD-11: 2C76]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | About 70% of endometrial tumours exhibit reductions in m6A methylation that are probably due to either this METTL14 mutation or reduced expression of METTL3. Reductions in m6A methylation lead to decreased expression of the negative AKT regulator PHLPP-like (PHLPP2) and increased expression of the positive AKT regulator mTORC2. these results reveal reduced m6A mRNA methylation as an oncogenic mechanism in endometrial cancer and identify m6A methylation as a regulator of AKT signalling. | |||
| Responsed Disease | Endometrial cancer [ICD-11: 2C76] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell proliferation and tumorigenicity | |||
| In-vitro Model | HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 |
| RL95-2 | Endometrial adenosquamous carcinoma | Homo sapiens | CVCL_0505 | |
| T HESCs | Normal | Homo sapiens | CVCL_C464 | |
| In-vivo Model | 4×106 HEC-1-A endometrial cancer cells (shCtrl, shMETTL3, wild-type, METTL14+/-, or METTL14+/- rescued with wild-type or mutant METTL14) were injected intraperitoneally into 5 week old female athymic nude mice (Foxn1nu, Harlan; n=10 per group). | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | About 70% of endometrial tumours exhibit reductions in m6A methylation that are probably due to either this METTL14 mutation or reduced expression of METTL3. Reductions in m6A methylation lead to decreased expression of the negative AKT regulator PHLPP-like (PHLPP2) and increased expression of the positive AKT regulator mTORC2. these results reveal reduced m6A mRNA methylation as an oncogenic mechanism in endometrial cancer and identify m6A methylation as a regulator of AKT signalling. | |||
| Responsed Disease | Endometrial cancer [ICD-11: 2C76] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell proliferation and tumorigenicity | |||
| In-vitro Model | HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 |
| RL95-2 | Endometrial adenosquamous carcinoma | Homo sapiens | CVCL_0505 | |
| T HESCs | Normal | Homo sapiens | CVCL_C464 | |
| In-vivo Model | 4×106 HEC-1-A endometrial cancer cells (shCtrl, shMETTL3, wild-type, METTL14+/-, or METTL14+/- rescued with wild-type or mutant METTL14) were injected intraperitoneally into 5 week old female athymic nude mice (Foxn1nu, Harlan; n=10 per group). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00366)
| In total 18 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE007465 | Click to Show/Hide the Full List | ||
| mod site | chr16:71645265-71645266:- | [2] | |
| Sequence | AGAAAAAGCAGCTACAGTCAATCCTGCTCTGTTTGCCTCAT | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000564884.5; ENST00000568954.5 | ||
| External Link | RMBase: RNA-editing_site_52399 | ||
| mod ID: A2ISITE007466 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676819-71676820:- | [3] | |
| Sequence | GGAGGCAGAGGTTGCAGTGAACCGAGATCACGCCATTGCAC | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000538126.5; ENST00000568004.5; rmsk_4573048; ENST00000567016.1 | ||
| External Link | RMBase: RNA-editing_site_52400 | ||
| mod ID: A2ISITE007467 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676820-71676821:- | [3] | |
| Sequence | GGGAGGCAGAGGTTGCAGTGAACCGAGATCACGCCATTGCA | ||
| Transcript ID List | ENST00000568004.5; ENST00000567016.1; ENST00000538126.5; ENST00000568954.5; ENST00000393524.6; rmsk_4573048 | ||
| External Link | RMBase: RNA-editing_site_52401 | ||
| mod ID: A2ISITE007468 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676880-71676881:- | [3] | |
| Sequence | GTGGGGGTGATTCTAATCCCAGCAACTTGGGAGGCTGAAGC | ||
| Transcript ID List | rmsk_4573048; ENST00000538126.5; ENST00000568954.5; ENST00000393524.6; ENST00000567016.1; ENST00000568004.5 | ||
| External Link | RMBase: RNA-editing_site_52402 | ||
| mod ID: A2ISITE007469 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676885-71676886:- | [3] | |
| Sequence | GCATGGTGGGGGTGATTCTAATCCCAGCAACTTGGGAGGCT | ||
| Transcript ID List | ENST00000568004.5; rmsk_4573048; ENST00000567016.1; ENST00000538126.5; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: RNA-editing_site_52403 | ||
| mod ID: A2ISITE007470 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676911-71676912:- | [3] | |
| Sequence | TACTAAAAATACAAAAAATTAGCCTGGCATGGTGGGGGTGA | ||
| Transcript ID List | ENST00000567016.1; rmsk_4573048; ENST00000538126.5; ENST00000568004.5; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: RNA-editing_site_52404 | ||
| mod ID: A2ISITE007471 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676923-71676924:- | [3] | |
| Sequence | AAACCCCAGCTCTACTAAAAATACAAAAAATTAGCCTGGCA | ||
| Transcript ID List | ENST00000393524.6; rmsk_4573048; ENST00000538126.5; ENST00000568004.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: RNA-editing_site_52405 | ||
| mod ID: A2ISITE007472 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676924-71676925:- | [3] | |
| Sequence | GAAACCCCAGCTCTACTAAAAATACAAAAAATTAGCCTGGC | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000568954.5; ENST00000567016.1; rmsk_4573048; ENST00000538126.5 | ||
| External Link | RMBase: RNA-editing_site_52406 | ||
| mod ID: A2ISITE007473 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676927-71676928:- | [3] | |
| Sequence | GGTGAAACCCCAGCTCTACTAAAAATACAAAAAATTAGCCT | ||
| Transcript ID List | ENST00000567016.1; ENST00000568954.5; ENST00000538126.5; rmsk_4573048; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: RNA-editing_site_52407 | ||
| mod ID: A2ISITE007474 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678071-71678072:- | [3] | |
| Sequence | CCTCCTAAAGTGTTGGGATTACAGGTGTGAGCCAGTGTGCC | ||
| Transcript ID List | ENST00000568004.5; ENST00000538126.5; ENST00000393524.6; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: RNA-editing_site_52408 | ||
| mod ID: A2ISITE007475 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678158-71678159:- | [3] | |
| Sequence | TTTAAAAATTTTTTATAGAGATGGGGTCTTGCTGTGTTGCC | ||
| Transcript ID List | ENST00000567016.1; ENST00000538126.5; ENST00000393524.6; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: RNA-editing_site_52409 | ||
| mod ID: A2ISITE007476 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678402-71678403:- | [3] | |
| Sequence | TCGAGCAGTCCACCCACCTCAGCCTCCCAAAGTGCTGGGAT | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000568004.5; ENST00000538126.5; ENST00000393524.6 | ||
| External Link | RMBase: RNA-editing_site_52410 | ||
| mod ID: A2ISITE007477 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678471-71678472:- | [3] | |
| Sequence | AATTTTTTTCTACTTTTAGTAGAGATGAGGTTTCACCATGT | ||
| Transcript ID List | ENST00000567016.1; ENST00000568954.5; ENST00000393524.6; ENST00000538126.5; ENST00000568004.5 | ||
| External Link | RMBase: RNA-editing_site_52411 | ||
| mod ID: A2ISITE007478 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678474-71678475:- | [3] | |
| Sequence | GCTAATTTTTTTCTACTTTTAGTAGAGATGAGGTTTCACCA | ||
| Transcript ID List | ENST00000393524.6; ENST00000567016.1; ENST00000538126.5; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: RNA-editing_site_52412 | ||
| mod ID: A2ISITE007479 | Click to Show/Hide the Full List | ||
| mod site | chr16:71678595-71678596:- | [3] | |
| Sequence | CCAAGCTGGCATACAGTGGCACGATCTCGGCCCACTGCAGT | ||
| Transcript ID List | ENST00000567016.1; ENST00000568954.5; ENST00000568004.5; ENST00000538126.5; ENST00000393524.6 | ||
| External Link | RMBase: RNA-editing_site_52413 | ||
| mod ID: A2ISITE007480 | Click to Show/Hide the Full List | ||
| mod site | chr16:71686234-71686235:- | [2] | |
| Sequence | GGCTGCATTGAGCCATGATCACGCCATTGTACTCCAGCCTG | ||
| Transcript ID List | ENST00000393524.6; rmsk_4573065; ENST00000568954.5; ENST00000567016.1; ENST00000538126.5 | ||
| External Link | RMBase: RNA-editing_site_52414 | ||
| mod ID: A2ISITE007481 | Click to Show/Hide the Full List | ||
| mod site | chr16:71718697-71718698:- | [4] | |
| Sequence | TTTTATTTTAATTTTTTTTGAGACGCGGTTTCACTATGTTG | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000538126.5 | ||
| External Link | RMBase: RNA-editing_site_52415 | ||
| mod ID: A2ISITE007482 | Click to Show/Hide the Full List | ||
| mod site | chr16:71719271-71719272:- | [2] | |
| Sequence | AAAGTGCTGGGATTACAGGCATGAGCCACTGCGCCCGGCTA | ||
| Transcript ID List | ENST00000538126.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: RNA-editing_site_52416 | ||
N6-methyladenosine (m6A)
| In total 107 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE028322 | Click to Show/Hide the Full List | ||
| mod site | chr16:71637991-71637992:- | [5] | |
| Sequence | TCAGTCCTTCTAAGCCTCAGACAATATGACAAATGAAGCTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5; rmsk_4572961 | ||
| External Link | RMBase: m6A_site_329968 | ||
| mod ID: M6ASITE028323 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638065-71638066:- | [5] | |
| Sequence | ACAAATGAACCGAGAGCAGGACCACCAGGTTCAAGTCCCCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; hESCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5; rmsk_4572961 | ||
| External Link | RMBase: m6A_site_329972 | ||
| mod ID: M6ASITE028324 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638077-71638078:- | [5] | |
| Sequence | ATGAAGAGAAATACAAATGAACCGAGAGCAGGACCACCAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; hESCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; rmsk_4572961; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_329973 | ||
| mod ID: M6ASITE028325 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638217-71638218:- | [5] | |
| Sequence | GGAAGCCAACAGGCCAACAGACTGAAGATCTTCTTGTCCGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_329978 | ||
| mod ID: M6ASITE028326 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638260-71638261:- | [5] | |
| Sequence | AGATATTTGGACTGAAAGGAACCCACAAATGGCACGAGGCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329979 | ||
| mod ID: M6ASITE028327 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638270-71638271:- | [5] | |
| Sequence | CCTTACTGATAGATATTTGGACTGAAAGGAACCCACAAATG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_329980 | ||
| mod ID: M6ASITE028328 | Click to Show/Hide the Full List | ||
| mod site | chr16:71638291-71638292:- | [5] | |
| Sequence | GATTTGTCTATTCAACCAGGACCTTACTGATAGATATTTGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329981 | ||
| mod ID: M6ASITE028329 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640548-71640549:- | [6] | |
| Sequence | ACTGCTGGTCCAGCTGCCGAACCTGCTCTAGCTCAGTGCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | H1A; H1B; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_329988 | ||
| mod ID: M6ASITE028330 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640611-71640612:- | [6] | |
| Sequence | GGACCCCCAGACCCAGAGAAACAGCCACGCCACCGTATATC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | H1A; H1B; hESCs; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329990 | ||
| mod ID: M6ASITE028331 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640621-71640622:- | [6] | |
| Sequence | CCCATGGTGAGGACCCCCAGACCCAGAGAAACAGCCACGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | H1A; H1B; hESCs; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329991 | ||
| mod ID: M6ASITE028332 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640629-71640630:- | [6] | |
| Sequence | GTAAAACACCCATGGTGAGGACCCCCAGACCCAGAGAAACA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | H1A; H1B; hESCs; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329992 | ||
| mod ID: M6ASITE028333 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640644-71640645:- | [6] | |
| Sequence | TCTTGGCTCCTTGGAGTAAAACACCCATGGTGAGGACCCCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | H1A; H1B; hESCs; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329993 | ||
| mod ID: M6ASITE028334 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640752-71640753:- | [6] | |
| Sequence | GCAGAGCCACGTGGAGGTAAACACCAATGCCTGTGCAGTAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | H1A; H1B; hESCs; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329995 | ||
| mod ID: M6ASITE028335 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640828-71640829:- | [7] | |
| Sequence | TGGCAGTCCATCCAGGTGAGACCCTTGCGGGCATAGAGCCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; H1A; H1B; hESCs; fibroblasts; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_329997 | ||
| mod ID: M6ASITE028336 | Click to Show/Hide the Full List | ||
| mod site | chr16:71640888-71640889:- | [7] | |
| Sequence | CCGTACATGATCACGAGAAGACAAGCAAAGGTGGCTGCTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2; H1A; H1B; hESCs; fibroblasts; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_329999 | ||
| mod ID: M6ASITE028337 | Click to Show/Hide the Full List | ||
| mod site | chr16:71641012-71641013:- | [7] | |
| Sequence | AAGATCTCAAAGAGTTCCAGACCACAGATATTCCGGTGCAT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; H1A; H1B; hESCs; fibroblasts; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330002 | ||
| mod ID: M6ASITE028338 | Click to Show/Hide the Full List | ||
| mod site | chr16:71644785-71644786:- | [6] | |
| Sequence | AGTGAGAACAAACACATGAAACCACATTCCCTGACACTGCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | H1B; H1A; hESCs; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330010 | ||
| mod ID: M6ASITE028339 | Click to Show/Hide the Full List | ||
| mod site | chr16:71644798-71644799:- | [6] | |
| Sequence | CCTGGGGAAGATAAGTGAGAACAAACACATGAAACCACATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | H1B; H1A; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330011 | ||
| mod ID: M6ASITE028340 | Click to Show/Hide the Full List | ||
| mod site | chr16:71645194-71645195:- | [8] | |
| Sequence | TTGTATTCTAAATTTCATGCACTTCTCCCAGATGCTATAGG | ||
| Motif Score | 3.252583333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000564884.5; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330012 | ||
| mod ID: M6ASITE028341 | Click to Show/Hide the Full List | ||
| mod site | chr16:71645724-71645725:- | [8] | |
| Sequence | GTGAGTTCATTTACTGGTGTACGGAAGAGCCAGCAGGAGCA | ||
| Motif Score | 2.830077381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568954.5; ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330013 | ||
| mod ID: M6ASITE028342 | Click to Show/Hide the Full List | ||
| mod site | chr16:71646190-71646191:- | [8] | |
| Sequence | ACCTATGAGGTAACTTACAGACATTGTGTTTTCTAAACAGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000393524.6; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330014 | ||
| mod ID: M6ASITE028343 | Click to Show/Hide the Full List | ||
| mod site | chr16:71646455-71646456:- | [8] | |
| Sequence | CCCAGTTCTGAAATGACCTTACCAAAAGTAAATGTATTTAT | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330015 | ||
| mod ID: M6ASITE028344 | Click to Show/Hide the Full List | ||
| mod site | chr16:71646497-71646498:- | [8] | |
| Sequence | TGCTATTCGTTTCCCAACCTACTTATTGGAACCACCTCAAA | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330016 | ||
| mod ID: M6ASITE028345 | Click to Show/Hide the Full List | ||
| mod site | chr16:71646576-71646577:- | [9] | |
| Sequence | ATTAAAGTTATTTTGGGAATACACCACTTTAATAGTATAGT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330017 | ||
| mod ID: M6ASITE028346 | Click to Show/Hide the Full List | ||
| mod site | chr16:71646779-71646780:- | [8] | |
| Sequence | TAGGGAACATAGTGGCTCACACAGAGTTTAGGTGCTGTTAG | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000564884.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330018 | ||
| mod ID: M6ASITE028347 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647647-71647648:- | [10] | |
| Sequence | GCATGTGGAGGAATTGGCAGACAGCTTCCTAAGGGCGGGGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000564884.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330019 | ||
| mod ID: M6ASITE028348 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647767-71647768:- | [5] | |
| Sequence | GGGAAGGCGTGAGGACCTAGACTACTTCTCCCTAGATCAGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000568004.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330020 | ||
| mod ID: M6ASITE028349 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647773-71647774:- | [5] | |
| Sequence | AAAATGGGGAAGGCGTGAGGACCTAGACTACTTCTCCCTAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000564884.5; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330021 | ||
| mod ID: M6ASITE028350 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647825-71647826:- | [5] | |
| Sequence | ACTGTGAAAGCTCCTGAGAAACTTGGGGTAATAGGATCTTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000568954.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330022 | ||
| mod ID: M6ASITE028351 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647845-71647846:- | [5] | |
| Sequence | ATTTAACTTTTGGATGTCAGACTGTGAAAGCTCCTGAGAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000568954.5; ENST00000393524.6; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330023 | ||
| mod ID: M6ASITE028352 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647902-71647903:- | [5] | |
| Sequence | GAGAGAACTGGGTGTTGGAGACTTATTCGAGGGTATAGGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; GM12878; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000564884.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330024 | ||
| mod ID: M6ASITE028353 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647916-71647917:- | [5] | |
| Sequence | CATCCATAGGCAGAGAGAGAACTGGGTGTTGGAGACTTATT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; GM12878; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000568954.5; ENST00000393524.6; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330025 | ||
| mod ID: M6ASITE028354 | Click to Show/Hide the Full List | ||
| mod site | chr16:71647994-71647995:- | [5] | |
| Sequence | GCACTTTTCATTGACTGTGAACTTTTTATTTTTGAATCTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; GM12878; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000564884.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330026 | ||
| mod ID: M6ASITE028355 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648045-71648046:- | [5] | |
| Sequence | GGAAATGTAGAACCAATCAAACAGATAATTTATGTATGTAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000568004.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330027 | ||
| mod ID: M6ASITE028356 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648054-71648055:- | [5] | |
| Sequence | ATGTCTGTTGGAAATGTAGAACCAATCAAACAGATAATTTA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000564884.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330028 | ||
| mod ID: M6ASITE028357 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648146-71648147:- | [5] | |
| Sequence | GAGAAATCACCTTATCTCAGACTAATGGGGTGTGATGTGAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000564884.5; ENST00000568004.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330029 | ||
| mod ID: M6ASITE028358 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648237-71648238:- | [5] | |
| Sequence | CCTGCCTGGGCAGGAAAGGGACTATTTCTGTGGAGGAAAAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000567016.1; ENST00000568954.5; ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330030 | ||
| mod ID: M6ASITE028359 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648399-71648400:- | [5] | |
| Sequence | CAGGGGCTGGCTCTGGATAAACTGGTAGCCACTATCAGTGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000564884.5; ENST00000568004.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330031 | ||
| mod ID: M6ASITE028360 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648447-71648448:- | [5] | |
| Sequence | CCATAGCTGTGTGGGGTTGAACTCGGAGCCAAAAAGTGTGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; hESCs; A549; GM12878; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393524.6; ENST00000564884.5; ENST00000567016.1; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330032 | ||
| mod ID: M6ASITE028361 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648468-71648469:- | [5] | |
| Sequence | CCCTGCGTCTACATTTCTAAACCATAGCTGTGTGGGGTTGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; A549; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5; ENST00000568954.5; ENST00000567016.1; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330033 | ||
| mod ID: M6ASITE028362 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648564-71648565:- | [5] | |
| Sequence | GTTGGCCAGGCTGGTGTTGAACTCTTGACCTCAGGTGATCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000564884.5; ENST00000567016.1; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330034 | ||
| mod ID: M6ASITE028363 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648837-71648838:- | [5] | |
| Sequence | TGTGCAGGGTTGGGGTAGGGACTTGCTAGAGGCATTCTGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; U2OS; H1A; H1B; fibroblasts; H1299; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000567016.1; ENST00000564884.5; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330035 | ||
| mod ID: M6ASITE028364 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648924-71648925:- | [5] | |
| Sequence | AGCCCCATGAAGAGGATCGGACCGAGCCCCCGGAGGAGTTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000568004.5; ENST00000567016.1; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330036 | ||
| mod ID: M6ASITE028365 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648962-71648963:- | [5] | |
| Sequence | ACAAATGAAACAGCACCAGGACAGCCGGCTCGAGCCTGAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5; ENST00000567016.1; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330037 | ||
| mod ID: M6ASITE028366 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648973-71648974:- | [5] | |
| Sequence | GAAGTGAAGGAACAAATGAAACAGCACCAGGACAGCCGGCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000567016.1; ENST00000568954.5; ENST00000393524.6; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330038 | ||
| mod ID: M6ASITE028367 | Click to Show/Hide the Full List | ||
| mod site | chr16:71648982-71648983:- | [5] | |
| Sequence | CTGGAAGAAGAAGTGAAGGAACAAATGAAACAGCACCAGGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000568954.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330039 | ||
| mod ID: M6ASITE028368 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649025-71649026:- | [5] | |
| Sequence | CACTCAGATGGAACCAGAGGACCAGTTTGTTGTGCCTCATG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568954.5; ENST00000564884.5; ENST00000568004.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330040 | ||
| mod ID: M6ASITE028369 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649033-71649034:- | [5] | |
| Sequence | GCTGCCCCCACTCAGATGGAACCAGAGGACCAGTTTGTTGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000564884.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330041 | ||
| mod ID: M6ASITE028370 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649065-71649066:- | [5] | |
| Sequence | CAGAAGTGCCCAAGAGGAAAACTGGCTATTTTGCTGCCCCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568954.5; ENST00000393524.6; ENST00000568004.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330042 | ||
| mod ID: M6ASITE028371 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649103-71649104:- | [5] | |
| Sequence | GCCCCTAGAGGACAGCCTGAACCTCATTGAAGTGGCCACAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MT4; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000567016.1; ENST00000568004.5; ENST00000393524.6; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330043 | ||
| mod ID: M6ASITE028372 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649112-71649113:- | [5] | |
| Sequence | CTCTATTGTGCCCCTAGAGGACAGCCTGAACCTCATTGAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MT4; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393524.6; ENST00000564884.5; ENST00000568004.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330044 | ||
| mod ID: M6ASITE028373 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649144-71649145:- | [5] | |
| Sequence | TCCTGCCTCTATGGGAAGAAACTCTCCAATGGCTCTATTGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000564884.5; ENST00000567016.1; ENST00000568004.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330045 | ||
| mod ID: M6ASITE028374 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649196-71649197:- | [5] | |
| Sequence | GCTCCTGCCAATGAGCAAGGACAGGATGGAGTTACAGAAGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000568004.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330046 | ||
| mod ID: M6ASITE028375 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649235-71649236:- | [5] | |
| Sequence | TTTTGGGATCCGAAGACAGAACAGTGTGAATAGTGGCATGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393524.6; ENST00000564884.5; ENST00000568004.5; ENST00000568954.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330047 | ||
| mod ID: M6ASITE028376 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649240-71649241:- | [5] | |
| Sequence | TCGTGTTTTGGGATCCGAAGACAGAACAGTGTGAATAGTGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000393524.6; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330048 | ||
| mod ID: M6ASITE028377 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649273-71649274:- | [5] | |
| Sequence | CCTACCCTGTGTTCTGAGGAACATGCTAGAGGGTCGTGTTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568954.5; ENST00000568004.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330049 | ||
| mod ID: M6ASITE028378 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649319-71649320:- | [5] | |
| Sequence | CAGGGGGAGGGATCTGGAGAACTCACCCCCTCTCATAGAGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330050 | ||
| mod ID: M6ASITE028379 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649352-71649353:- | [5] | |
| Sequence | CAAGGTAGAGGTGGAAGTAGACATCCACTGCTGCAGGGGGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1B; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330051 | ||
| mod ID: M6ASITE028380 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649418-71649419:- | [5] | |
| Sequence | CCAGTCTGACAACGGCCTGGACAGTGATGATGACCAGCCCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; GM12878; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000393524.6; ENST00000568004.5; ENST00000568954.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330052 | ||
| mod ID: M6ASITE028381 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649541-71649542:- | [5] | |
| Sequence | GCATAATGCTGGGGGCCTGGACACTGCCTTGCTTCCGAGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1B; H1A; hESCs; GM12878; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000393524.6; ENST00000567016.1; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330053 | ||
| mod ID: M6ASITE028382 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649790-71649791:- | [5] | |
| Sequence | GCAGAGCTATGGCTGTCAGGACAATGTAGGGGCGATGGTAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000393524.6; ENST00000567016.1; ENST00000568004.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330054 | ||
| mod ID: M6ASITE028383 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649847-71649848:- | [5] | |
| Sequence | TGCTGTACGTCACGTACAAGACCCATTAGCAGCTGCTAAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000393524.6; ENST00000568954.5; ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330055 | ||
| mod ID: M6ASITE028384 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649894-71649895:- | [5] | |
| Sequence | GGAAACAAAGCATTGTGGGAACACTTGTCCTACACAGAAGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330056 | ||
| mod ID: M6ASITE028385 | Click to Show/Hide the Full List | ||
| mod site | chr16:71649910-71649911:- | [5] | |
| Sequence | TGAGTTGCTGATTCTGGGAAACAAAGCATTGTGGGAACACT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568004.5; ENST00000568954.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330057 | ||
| mod ID: M6ASITE028386 | Click to Show/Hide the Full List | ||
| mod site | chr16:71652811-71652812:- | [5] | |
| Sequence | GGAGGCTCAAAGGGTGAAGGACCAAAAAGCCATCATCACAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000564884.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330058 | ||
| mod ID: M6ASITE028387 | Click to Show/Hide the Full List | ||
| mod site | chr16:71652838-71652839:- | [5] | |
| Sequence | AGTCTTCAGCCTGGAGCAGGACCCAGAGGAGGCTCAAAGGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568004.5; ENST00000564884.5; ENST00000393524.6; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330059 | ||
| mod ID: M6ASITE028388 | Click to Show/Hide the Full List | ||
| mod site | chr16:71655359-71655360:- | [5] | |
| Sequence | GTATGGCATGTTTGATGGAGACCGAAATGAGGAGCTCCCGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000568954.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330060 | ||
| mod ID: M6ASITE028389 | Click to Show/Hide the Full List | ||
| mod site | chr16:71656599-71656600:- | [5] | |
| Sequence | TCAACCTTCTGGAGCCATGGACTGGCTGAGATGGCAGGGCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000564884.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330061 | ||
| mod ID: M6ASITE028390 | Click to Show/Hide the Full List | ||
| mod site | chr16:71656650-71656651:- | [5] | |
| Sequence | ACCCTGAAAATTGATCAGAAACCTTTGCCAACCACAGATTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000568954.5; ENST00000564884.5; ENST00000567016.1; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330062 | ||
| mod ID: M6ASITE028391 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658241-71658242:- | [5] | |
| Sequence | TCTGGAACACAAGACACTGGACATATTTAGGTAGGAAAAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000564884.5; ENST00000568954.5; ENST00000393524.6; ENST00000567016.1; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330063 | ||
| mod ID: M6ASITE028392 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658248-71658249:- | [5] | |
| Sequence | ATCTGGTTCTGGAACACAAGACACTGGACATATTTAGGTAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568004.5; ENST00000568954.5; ENST00000393524.6; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330064 | ||
| mod ID: M6ASITE028393 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658255-71658256:- | [5] | |
| Sequence | AATACAAATCTGGTTCTGGAACACAAGACACTGGACATATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000393524.6; ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330065 | ||
| mod ID: M6ASITE028394 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658292-71658293:- | [5] | |
| Sequence | TTTGCCTGCTACATTACAAGACCTTGACCTGACTGGAAATA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000393524.6; ENST00000564884.5; ENST00000568954.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330066 | ||
| mod ID: M6ASITE028395 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658355-71658356:- | [5] | |
| Sequence | AATTTTTTCTTAGTTTGTAGACCTAAGTTGCAACGACTTGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000567016.1; ENST00000564884.5; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330067 | ||
| mod ID: M6ASITE028396 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658734-71658735:- | [5] | |
| Sequence | CATTCCCACAACCATAGCAAACTGTAAAAGGCTGCACACCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000567016.1; ENST00000568954.5; ENST00000564884.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330068 | ||
| mod ID: M6ASITE028397 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658756-71658757:- | [5] | |
| Sequence | TAAGTGGCAACAAGCTTAAAACCATTCCCACAACCATAGCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000568004.5; ENST00000564884.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330069 | ||
| mod ID: M6ASITE028398 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658779-71658780:- | [5] | |
| Sequence | GGAGCAATTGGAGGAACTGAACCTAAGTGGCAACAAGCTTA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000567016.1; ENST00000393524.6; ENST00000564884.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330070 | ||
| mod ID: M6ASITE028399 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658784-71658785:- | [5] | |
| Sequence | AAATTGGAGCAATTGGAGGAACTGAACCTAAGTGGCAACAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000564884.5; ENST00000568954.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330071 | ||
| mod ID: M6ASITE028400 | Click to Show/Hide the Full List | ||
| mod site | chr16:71658811-71658812:- | [5] | |
| Sequence | TGTTGTTTCTTTTTCAGCAAACTAAATAAATTGGAGCAATT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000564884.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330072 | ||
| mod ID: M6ASITE028401 | Click to Show/Hide the Full List | ||
| mod site | chr16:71663911-71663912:- | [5] | |
| Sequence | TTGCAAACAATCAGTTACAGACCTTTCCTGCAAGGTAAAAT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000567016.1; ENST00000564884.5 | ||
| External Link | RMBase: m6A_site_330073 | ||
| mod ID: M6ASITE028402 | Click to Show/Hide the Full List | ||
| mod site | chr16:71663925-71663926:- | [5] | |
| Sequence | GCGAATCTTGCACCTTGCAAACAATCAGTTACAGACCTTTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000393524.6; ENST00000564884.5; ENST00000568004.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330074 | ||
| mod ID: M6ASITE028403 | Click to Show/Hide the Full List | ||
| mod site | chr16:71667201-71667202:- | [5] | |
| Sequence | TGCACTCACGAGGCTGCCAGACACCCTCTTCTCCAAGGCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568954.5; ENST00000567016.1; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330082 | ||
| mod ID: M6ASITE028404 | Click to Show/Hide the Full List | ||
| mod site | chr16:71667276-71667277:- | [5] | |
| Sequence | GGGACACAATCATGTGCAAAACCTTCCAACACTGGTAGAGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000567016.1; ENST00000568004.5; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330083 | ||
| mod ID: M6ASITE028405 | Click to Show/Hide the Full List | ||
| mod site | chr16:71667293-71667294:- | [5] | |
| Sequence | CTTAGAAAACTGATGCTGGGACACAATCATGTGCAAAACCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000567016.1; ENST00000568004.5; ENST00000568954.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330084 | ||
| mod ID: M6ASITE028406 | Click to Show/Hide the Full List | ||
| mod site | chr16:71667305-71667306:- | [5] | |
| Sequence | AGTAGCTTGAGTCTTAGAAAACTGATGCTGGGACACAATCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000568004.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330085 | ||
| mod ID: M6ASITE028407 | Click to Show/Hide the Full List | ||
| mod site | chr16:71669367-71669368:- | [5] | |
| Sequence | ATTATTTATTTTCTGCAGAAACCTGCTAGAGTGTGTCCCTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330086 | ||
| mod ID: M6ASITE028408 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676467-71676468:- | [5] | |
| Sequence | TCAGTGGCTTTTCCCTTCGGACCCTCTATGCCAGTTCCAAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330087 | ||
| mod ID: M6ASITE028409 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676528-71676529:- | [5] | |
| Sequence | AGCTCCTTATGCAGCTTGGAACAGCTGCACTGTGGGCGGAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000567016.1; ENST00000393524.6; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330088 | ||
| mod ID: M6ASITE028410 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676574-71676575:- | [5] | |
| Sequence | CACCCACGTGGATCTGCGGGACAACCGACTGACTGACTTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568004.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330089 | ||
| mod ID: M6ASITE028411 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676600-71676601:- | [5] | |
| Sequence | GAAAATCTGGAGGGAAATAAACACATCACCCACGTGGATCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000538126.5; ENST00000568004.5; ENST00000393524.6; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330090 | ||
| mod ID: M6ASITE028412 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676632-71676633:- | [5] | |
| Sequence | TAAGGATGAACCATTTGAAAACCATGGTTATTGAAAATCTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568004.5; ENST00000393524.6; ENST00000568954.5; ENST00000567016.1; ENST00000538126.5 | ||
| External Link | RMBase: m6A_site_330091 | ||
| mod ID: M6ASITE028413 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676643-71676644:- | [5] | |
| Sequence | TTTCTGCGTATTAAGGATGAACCATTTGAAAACCATGGTTA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000393524.6; ENST00000538126.5; ENST00000568004.5 | ||
| External Link | RMBase: m6A_site_330092 | ||
| mod ID: M6ASITE028414 | Click to Show/Hide the Full List | ||
| mod site | chr16:71676688-71676689:- | [5] | |
| Sequence | CTGGTAAGCACATTTAATAGACTCTTATTTATGATTATTTT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000538126.5; ENST00000568004.5; ENST00000567016.1; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330093 | ||
| mod ID: M6ASITE028415 | Click to Show/Hide the Full List | ||
| mod site | chr16:71679495-71679496:- | [5] | |
| Sequence | CTGAACTTGTCCCATAATAAACTTGGGTTGTTTCCTATATT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568954.5; ENST00000538126.5; ENST00000574977.1; ENST00000568004.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330094 | ||
| mod ID: M6ASITE028416 | Click to Show/Hide the Full List | ||
| mod site | chr16:71679511-71679512:- | [5] | |
| Sequence | TTCTCAACTGAAGGGCCTGAACTTGTCCCATAATAAACTTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000574977.1; ENST00000568004.5; ENST00000393524.6; ENST00000538126.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330095 | ||
| mod ID: M6ASITE028417 | Click to Show/Hide the Full List | ||
| mod site | chr16:71681776-71681777:- | [5] | |
| Sequence | AACTTCATGCAGTTAGAAAGACCCGGAGGCCTCGATACACT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000574977.1; ENST00000393524.6; ENST00000568954.5; ENST00000568004.5; ENST00000567016.1; ENST00000538126.5 | ||
| External Link | RMBase: m6A_site_330096 | ||
| mod ID: M6ASITE028418 | Click to Show/Hide the Full List | ||
| mod site | chr16:71684516-71684517:- | [5] | |
| Sequence | CCTATCATGTCAGCTTCGAGACTTTGGCCGAGTACCAGCGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000574977.1; ENST00000567016.1; ENST00000568954.5; ENST00000538126.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330097 | ||
| mod ID: M6ASITE028419 | Click to Show/Hide the Full List | ||
| mod site | chr16:71684537-71684538:- | [5] | |
| Sequence | CAGCAGGAGCCCAAGCTCAGACCTATCATGTCAGCTTCGAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000538126.5; ENST00000574977.1; ENST00000568954.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330098 | ||
| mod ID: M6ASITE028420 | Click to Show/Hide the Full List | ||
| mod site | chr16:71690556-71690557:- | [5] | |
| Sequence | CCTCAGTGAAGGATTGTCAAACTGGAAAGATGCACATTTTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000538126.5; ENST00000567016.1; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330099 | ||
| mod ID: M6ASITE028421 | Click to Show/Hide the Full List | ||
| mod site | chr16:71690637-71690638:- | [5] | |
| Sequence | ATAATGTACGCAAGGGAAAGACCCAGCTGCATAAGTGGGCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000393524.6; ENST00000538126.5 | ||
| External Link | RMBase: m6A_site_330100 | ||
| mod ID: M6ASITE028422 | Click to Show/Hide the Full List | ||
| mod site | chr16:71702721-71702722:- | [5] | |
| Sequence | TGTGTAATCAGGAGACTGGAACCTACTGAACGACCTCTTCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000567016.1; ENST00000568954.5; ENST00000538126.5 | ||
| External Link | RMBase: m6A_site_330101 | ||
| mod ID: M6ASITE028423 | Click to Show/Hide the Full List | ||
| mod site | chr16:71702727-71702728:- | [5] | |
| Sequence | TTGAATTGTGTAATCAGGAGACTGGAACCTACTGAACGACC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000538126.5; ENST00000393524.6; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330102 | ||
| mod ID: M6ASITE028424 | Click to Show/Hide the Full List | ||
| mod site | chr16:71714520-71714521:- | [5] | |
| Sequence | TTATTTACAGCTTCATGGAGACCTGGTCAGGTGAGGTCTCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000538126.5; ENST00000393524.6 | ||
| External Link | RMBase: m6A_site_330103 | ||
| mod ID: M6ASITE028425 | Click to Show/Hide the Full List | ||
| mod site | chr16:71714584-71714585:- | [5] | |
| Sequence | TCGTCCTTTGCACTGTAGAGACACCAGCATCAGAAATATGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000568954.5; ENST00000538126.5; ENST00000567016.1 | ||
| External Link | RMBase: m6A_site_330104 | ||
| mod ID: M6ASITE028426 | Click to Show/Hide the Full List | ||
| mod site | chr16:71714679-71714680:- | [5] | |
| Sequence | TGTTTACCTTTATGGAGCAGACACTACCACTGCCACTACAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393524.6; ENST00000538126.5; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330105 | ||
| mod ID: M6ASITE028427 | Click to Show/Hide the Full List | ||
| mod site | chr16:71714730-71714731:- | [5] | |
| Sequence | GTTTGGTTCTCGAGAAAGAGACTGGCTAAGAGAAGATGTAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000538126.5; ENST00000393524.6; ENST00000567016.1; ENST00000568954.5 | ||
| External Link | RMBase: m6A_site_330106 | ||
| mod ID: M6ASITE028428 | Click to Show/Hide the Full List | ||
| mod site | chr16:71714863-71714864:- | [5] | |
| Sequence | TAGAGAGAGGTGGGGTGAGGACTGAAATGTCTAATTCAGTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000568954.5; ENST00000567016.1; ENST00000393524.6; ENST00000538126.5 | ||
| External Link | RMBase: m6A_site_330107 | ||
References



